Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2019 Dec 6;99(3):1628–1642. doi: 10.1016/j.psj.2019.10.057

The profiling of amino acids in crop milk and plasma and mRNA abundance of amino acid transporters and enzymes related to amino acid synthesis in the crop tissue of male and female pigeons during incubation and chick-rearing periods

P Xie ∗,†,‡,1, MX Han †, WX Chen †, XP Wan §, YG Xu ∗,†, DQ Gong ‡
PMCID: PMC7587674  PMID: 32115035

Abstract

The present study was carried out to investigate the changes in amino acid (AA) contents of crop milk and plasma and mRNA abundance of AA transporters and AA synthesis–related enzymes in the crop tissue of male and female pigeons during incubation and chick-rearing periods. Forty-two pairs of adult White King pigeons with 2 fertile eggs per pair were randomly divided into 7 groups by different breeding stages. The AA content of crop milk decreased from day 1 (R1) to day 25 (R25) of chick rearing (P < 0.05). In both male and female adult pigeons, the contents of Thr, Leu, Val, His, Asp, and Pro in plasma increased to maximum levels on R25. Parental sex effect and interaction between stage and sex were observed in the AA contents of pigeon plasma (P < 0.05). For AA transporters, the mRNA abundances of SNAT2, ASCT1, LAT1, and y+LAT2 in the male crops reached the highest value on day 17 of incubation (I17), and the peak mRNA levels of PAT-1, xCT, b0,+AT, and CAT1 were found on R7 (P < 0.05). In females, the abundances of ASCT1, B0AT1, asc-1, and CAT1 mRNA peaked on R1, whereas the maximum levels of LAT1, PAT-1, b0,+AT, and y+LAT2 were observed on R7. For enzymes involved in AA synthesis, the highest gene expressions of glutamate dehydrogenase 1, acetolactate synthase in both parent pigeons, and L-threonine 3-dehydrogenase in female pigeon crops were attained on I17. The expressions of ornithine-δ-aminotransferase, glutamic-oxal(o)acetic transaminase 1, glutamic-oxal(o)acetic transaminase 2, asparagine synthetase, serine hydroxymethyltransferase 2, and glutamic-pyruvic transaminase 2 in both sexes and argininosuccinate lyase and L-threonine 3-dehydrogenase in males were the highest on R1. In conclusion, AA used for pigeon crop milk formation may originate from plasma and intracellular synthesis. The genes involved in AA transport and synthesis varied significantly with sexual effects, indicating that other factors should be considered in future explorations of the mechanism of protein formation in crop milk.

Key words: pigeon, crop milk, plasma, amino acid transporter, enzyme

Introduction

To provide optimal nutritional support for squabs, the crop sac of pigeon undergoes a dramatic series of changes in size, morphology, and function throughout the life cycle of epithelial cells, in response to prolactin and local growth factors (Horseman and Buntin, 1995, Gillespie et al., 2011, Xie et al., 2018). Crop milk contains predominantly protein (60% of dry matter) and lipids (30% of dry matter) at the beginning of regurgitation (Carr and James, 1931, Xie et al., 2017). This nourishing cheese-like substance was considered to be the major reason for squabs' much higher maturation rate compared with that of broilers, quails, and ostriches (Sales and Janssens, 2003). Crop milk is produced by both parental pigeons and cannot be stored by the organ; however, differences in the composition of crop milk between male and female pigeons are rarely examined because of sampling difficulties, and to date, there has been a paucity of information regarding the protein synthesis of crop milk in the pigeon.

During lactation, the mammary gland creates a large demand for free amino acids (AA) from blood to feed milk production because more than 90% of milk protein is synthesized de novo in mammary tissues (Backwell et al., 1996). The uptake of AA is carried out by different transporters located on the cell membrane, and these AA transporter systems can be divided into neutral, cationic, anionic, and others; some of them shuttle multiple AA into and out of the cells (Bröer, 2008). However, inconsistent results concerning the expression patterns of AA transporter genes in the mammary gland from pregnancy to lactation have been reported in different mammals. Some have shown that the expression of L-type AA transporter 1 (LAT1), Na+-dependent cationic AA transporter (CAT1), Na+-coupled neutral AA transporter 2 (SNAT2), excitatory AA transporter 3 (EAAT3), and alanine/serine/cysteine/threonine transporter (ASCT1) in the mammary gland coincided with the peak of milk production in the rat and sow (Alemán et al., 2009, Chen et al., 2018), whereas Laspiur et al. (2004) found that CAT1 and ASCT1 expressions do not change, and B0,+ mRNA abundance was lower during lactation in the pig. In pigeons, various AA transporters in the small intestine had been analyzed during the posthatch period (Gao et al., 2016, Zhang et al., 2017), and their expressions were considered to be representative of organ development; however, the potential role of these transporters in crop milk formation remains unknown.

Owing to insufficient uptake by mammary epithelial cells, in situ and de novo biosynthesis of nonessential AA (NEAA) is an important pathway supporting milk protein production, and it has been reported that some essential AA (EAA) can be taken up in excess for conversion to specific NEAA (Bröer, 2008). For example, branched-chain AA (BCAA) (valine, leucine, and isoleucine) are catalyzed to provide amino groups for the synthesis of glutamate and glutamine (DeSantiago et al., 1998, Lei et al., 2012), which are necessary for neonatal growth and digestive tract maturation (Cabrera et al., 2013). During the process of the intramammary metabolism of AA, key enzymes such as arginase, ornithine-δ-aminotransferase (OAT), and branched-chain alpha-keto acid dehydrogenase are indispensable and extensively studied (Yip and Knox, 1972, Basch et al., 1995, DeSantiago et al., 1998). An interesting question is whether these AA metabolic enzymes exist in pigeon crop tissues and are involved in crop milk formation. The author has presented the hypothesis that AA used for protein synthesis in crop milk probably originated from 2 pathways: one dependent on AA transport systems for targeting plasma AA and the other on de novo biosynthesis of AA in crop epithelial cells.

Therefore, the objective of the present study was to determine the changes in the AA composition of crop milk and plasma and gene expression of AA transporters and AA metabolic enzymes in crop tissues of male and female pigeons during incubation and chick rearing under artificial farming conditions.

Materials and methods

All procedures used in this study were approved by the Animal Care Advisory Committee of Yangzhou University.

Birds and Housing

Eighty-four (42 males and 42 females) adult White King pigeons of 60 wk of age were obtained from a commercial pigeon farm (Kunpeng Pigeon Co., Ltd., Xuzhou, China). All pigeons were paired after sexual maturity and chosen to have the same oviposition interval. Each pair was housed in an artificial aviary equipped with a nest and perch and subjected to a 50-D study, which included a 7-D acclimation and a 43-D experimental period, the latter consisting of 18-D incubation and 25-D chick-rearing periods. Birds were randomly divided into 7 groups according to their different breeding stages with 3 incubation times (4 [I4], 10 [I10], and 17 D [I17]) and 4 chick-rearing times (1 [R1], 7 [R7], 15 [R15], and 25 D [R25]). To maintain the broodiness of parental birds, plastic eggs were brought into cages only after the second egg was laid as described previously (Xie et al., 2018). Baby squabs hatched from the incubator were reared by parents after 18 D of incubation. To investigate the sexual effects on AA composition in male and female pigeons, the paired birds were separated into adjacent cages at night (21:00 pm) on the 18th D of incubation to avoid stress, with one squab fed by each parent (Xie et al., 2017). The birds were fed a pellet diet of 55% corn, 24.5% soybean meal (44.2% CP), 11% wheat, 1.2% dicalcium phosphate, 2% limestone, 0.25% salt, 0.5% vitamin and mineral premix, 2% soybean oil, 3.42% zeolite powder, 0.07% lysine, and 0.06% methionine (16.67% CP, 12.00 MJ/kg of ME, 1.13% calcium, 0.34% available P, 0.89% lysine, and 0.31% methionine). The nutrient data can be referenced from our previous study (Xie et al., 2016). The birds received feed, sand, and water ad libitum. Light was provided for 16 h daily throughout the experiment.

Sample Preparation

The pellet diets were ground to pass a 1-mm screen, and quintuple samples were used to analyze AA composition. Crop milk was produced by adult pigeons, but it cannot be stored by the organ, so milk of parents was often collected from young pigeons soon after being fed during the chick-rearing period (Bharathi et al., 1997). According to the method described previously (Xie et al., 2017), a surgical blade was used to carefully make slits on the crop of squabs after disinfection with povidone-iodine, and pigeon milk was collected and incision was immediately closed by double sutures. Two samples from the same group were pooled, aliquoted, and stored at −80°C for AA analysis.

Both plasma AA composition and gene expressions in crop tissues were determined in adult pigeons. After a 12-h fast, blood from parental pigeons was collected via wing vein puncture into tubes containing EDTA, placed on ice, and centrifuged at 1,500 × g for 20 min at 4°C. Plasma from 2 adult birds of the same sex was pooled, aliquoted, and stored at −80°C for AA analysis. After blood sampling, all pigeons were euthanized by cervical dislocation, and their crop tissues were quickly frozen in liquid nitrogen and stored at −80°C for gene detection. After sampling, eggs and squabs were transferred to nests at the pigeon farm to be cared for by other pigeons.

AA Analysis

Amino acid analysis was done for assessing the correlation between AA in plasma and AA in crop milk during “lactation” in pigeons. AA concentrations in feed samples and crop milk were measured using HPLC with an Agilent 1,100 series system (Agilent Technologies, Santa Clara, CA) after hydrolysis in 6 mol HCl at 110°C for 24 h. AA concentrations in plasma were determined according to the method described by Sano et al. (2018). Briefly, sulfosalicylic acid was added to plasma to a final concentration of 5%, and then, the samples were placed on ice for 15 min followed by centrifugation to remove precipitated proteins. The extracts were filtered through 0.22 μm Millipore membranes (Millipore Corp., Bedford, MA) and analyzed using an AA analyzer (Hitachi L-8900, Tokyo, Japan). The following AAs were evaluated: Pro, Glu, Gly, Ala, Ser, Asp, Cys, Tyr, Phe, Met, Lys, Thr, Leu, Ile, Val, His, and Arg.

RNA Isolation and Real-Time Quantitative PCR

TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) was used for the isolation of total RNA from the crop tissue. Briefly, frozen samples were ground with liquid nitrogen, and tissue powder was immediately transferred into TRIzol reagent, then deproteinized by chloroform, precipitated with isopropanol, and washed in 75% ethanol; finally, the resulting RNA was resuspended in RNase-free water. RNA quality was confirmed by both native RNA electrophoresis and determination of the absorbance ratio 260 nm/280 nm. cDNA was synthesized by M-MLV reverse transcriptase at 42°C for 60 min with an oligo dT-Adaptor primer.

To investigate whether intracellular availability of AA was controlled by coordinated activity of AA carrier proteins and enzymes responsible for de novo AA synthesis, fourteen AA transporters grouped in 3 categories (neutral, cationic, and anionic AA transporters) and 13 enzymes were analyzed in crops during incubation and chick rearing. Specific primers (Table 1) were designed using Primer Premier 5.0 software (Premier Biosoft, Palo Alto, CA), and β-actin was used as the internal control gene. The mRNA abundance of these genes was detected with real-time quantitative PCR. Real-time quantitative PCR was performed using SYBR Premix Ex Taq (Takara, Dalian, China) in a C1000 Touch Thermal Cycler equipped with a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA) and evaluated with CFX Manager 3.1 software (Bio-Rad). The PCR program was 95°C for 30 s followed by 39 cycles of 95°C for 5 s and 60°C for 30 s. Each sample was analyzed in triplicate. Melting curve analysis was used to verify amplification specificity. The relative expression quantity was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001).

Table 1.

Primers used in the present study.

Target gene Nucleotide sequence (5’→3′) Accession No. Size (bp)
Genes involved in amino acid transport
 b0,+AT F: ATTATTGGAATCCCCTTGGTTAC XM_005514428 80
R: AGTTCTGTTGAAGTCATTACGGTG
 y+LAT2 F: ACATTTCCCTCGCACTCT XM_005504755 215
R: CACTGCCACAGCATCACT
 CAT1 F: CTTCGCCGTGGTGATA XM_005501421 108
R: CCGAGGACGAGGATGT
 SNAT2 F: AAAGCCGAAGCCGTAAAAGAA XM_005499916 92
R: GTATCCAAAGAGAGCAGCCAATAAA
 ASCT1 F: TCGTTCAATGAGGCGACTATG XM_013367937 142
R: CGAAGATGTATTTTCCCAGGCT
 LAT1 F: TGTTTCCTTCTGGATGACGC XM_021290674 197
R: TCTCTGCTTTTCCTGCTTATGA
 LAT4 F: GACCTTCACATCGCTTACG XM_005502005 163
R: TGCCCAGACAAGCAGAAT
 B0AT1 F: TGGCATAGCAGCAATGTCGG XM_005509991 95
R: CTTGGAAGGAGTTGAAGAAATACC
 ATB0,+ F: AGCGTGGCAACTGGTCAA XM_005500482 110
R: TCCGCCGTTCTGGTAGGT
 asc-1 F: ACCTCCTCGTCCCCATCACTTA XM_013371151 296
R: CCTCGTGGTTGTCTTGCTTGTG
 EAAT3 F: ACAGGTGTTGCTGCTTTG XM_021294088 171
R: GGTGCTGCCCACTCTAT
 xCT F: ATCTTCATCTCTCCCAAAGGCAT XM_005499885 101
R: AGGGCACCAAAGAGCGAGAG
 IMINOB F: AACATAGCTCCTCCGCCTTTC XM_021300732 98
R: GCCTTCCTGCCTTCACTCTTT
 PAT-1 F: TTGGGGAAGGCGTGTAGTG XM_021288996 204
R: ACAAAAGGCAGCAGGGAAAG
Genes involved in amino acid synthesis
 GDH1 F: TGCCCTGCGACATCCTCATC XM_021288950 217
R: GGTTCAGGTTCTTCAGCCACTCA
 GS F: CACCGAGGAGATGAGGAAAGAG XM_013371526 242
R: CAAAGTAGCCGCAGCCGTC
 OAT F: CTTGGCGAATACGAGGAGATG XM_013368105 222
R: GCTGGATGGGTCGGTAGAA
 ASL F: AGGAGGCTGTCTTTGATGTTGTGG XM_021286946 245
R: CAGGCTGAGATTATTGAGGGTGA
 ASN F: ATTCCCATATCTGTGGCTGTGTTAC XM_021290989 202
R: CACTTTTCTGTTGGTGGTGTCC
 GOT1 F: AGAACTTTGGGCTCTACAATGAAC XM_013368474 257
R: GGATTCCAGGCGAGACCGA
 GOT2 F: CGGTTCTTCAAGTCCAGTCG XM_005504788 116
R: TTGGGGTCATAGTAGCGGTAA
 TDH F: GTTTCCAACCCCAATCCCTC XM_021294171 279
R: CTTGGCGAATACGAGGAGATG
 PDH F: CGATAGCACTACTGGCTTGTTG XM_005498831 296
R: CAGACAGGGGGGCTGAGAG
 SHMT1 F: ATCGCCGACGCCAACAGTG XM_005504475 97
R: CGCAGTGGTCAAAGGGGGA
 SHMT2 F: GGTGGATAAGAAGACGGGCAA XM_005514134 77
R: GCAGGGAGGGGAAAACAGC
 GPT2 F: GCTTTCCGTTCGCATTTGTC XM_005504680 276
R: GGTGCCATTTTGTGAGCCTTTG
 ACSN F: CCGAGGTTTGGGTCCTTTAT XM_005513927 126
R: CAATCTGGCTCCAACACGC
Internal control
 β-actin F: TCAGGGTGTGATGGTTGGTAT XM_005504502 159
R: TCATTGTAGAAAGTGTGGTGCC
Open in a new tab

Abbreviations: 3PGDH, phosphoglycerate dehydrogenase; ACSN, acetolactate synthase; asc-1, asc-type amino acid transporter 1; ASCT1, Na+-dependent neutral amino acid transporter; ASL, argininosuccinate lyase; ASN, asparagine synthetase; ATB0'+, Na+- and Cl−-dependent neutral and cationic amino acid transporter; b0,+AT, Na+-dependent cationic and zwitterionic amino acid transporter; B0AT1, Na+-dependent neutral amino acid transporter; CAT1, Na+-dependent cationic amino acid transporter; EAAT3, excitatory amino acid transporter 3; F, forward; GDH1, glutamate dehydrogenase 1; GOT1, glutamic-oxal(o)acetic transaminase 1; GOT2, glutamic-oxal(o)acetic transaminase 2; GPT2, glutamic-pyruvic transaminase 2; GS, glutamine synthetase; IMINOB, Na+- and Cl−-dependent proline IMINO transporter; LAT1, L-type amino acid transporter 1; LAT4, L-type amino acid transporter 4; OAT, ornithine-δ-aminotransferase; PAT-1, proton-coupled amino acid transporter 1; R, reverse; SHMT1, serine hydroxymethyltransferase 1; SHMT2, serine hydroxymethyltransferase 2; SNAT2, Na+-coupled neutral amino acid transporter 2; TDH, L-threonine 3-dehydrogenase; xCT, cystine/glutamate exchange transporter; y+LAT2, Na+-dependent cationic and Na+-dependent neutral amino acid transporter 2.

Statistical Analysis

All data are presented as means ± SE. Data were statistically evaluated using SPSS 17.0 (SPSS Inc., Chicago, IL) and analyzed using the GLM procedure. The model included the main effects of stage, sex, and their interactions. Differences among breeding stages were estimated by Duncan's post hoc test. All statements of significance are based on P < 0.05.

Results

AA Content

As shown in Tables 2 to Table 3, Table 4, the breeding stage had a significant effect on the AA contents of crop milk and pigeon plasma (P < 0.05). All EAA and NEAA in the crop milk decreased markedly from day 1 to day 25 of chick rearing (P < 0.05) (Table 3), which is close to the AA levels of the pigeons' diet (Table 2). The contents of Val, Glu, and Ala in the male crop milk tended to be higher than those in the females (P = 0.060–0.066), but there was no significant difference in all AA contents between the male and female crop milk. An interaction between stage and sex was also not significant (P > 0.05) (Table 5). In male pigeon plasma, Thr, Leu, Val, Phe, Arg, His, Asp, and Pro increased to their maximum levels on R25, whereas Met, Cys, Gly, Ser, and Glu peaked on R1 (P < 0.05) (Table 4). In female pigeon plasma, Met, Thr, Ile, Leu, Val, His, Tyr, Asp, Glu, Ala, and Pro increased to their maximum levels on R25, whereas Cys and Arg peaked on R1, and the highest levels of Lys, Phe, Gly, and Ser were found on R7 (P < 0.05) (Table 4). A parental sex effect was observed in the AA contents of pigeon plasma, except for Cys, Phe, and Arg (P < 0.05) (Table 6). Concentrations of Met, Thr, Leu, His, Gly, Asp, Ser, and Ala in the female pigeons were higher than those in the male pigeons from R1 to R25 (P < 0.001) (Table 4, Table 6). For most plasma AA, except for Phe, Gly, and Asp, there was a significant interaction between stage and sex (P < 0.05) (Table 6).

Table 2.

Analyzed concentrations of amino acids in the diet.1

Amino acids Concentration (%)
Essential amino acids (EAA)
 Lysine 0.88
 Methionine 0.32
 Cystine 0.33
 Threonine 0.63
 Isoleucine 0.64
 Leucine 1.38
 Valine 0.75
 Phenylalanine 0.81
 Arginine 1.13
 Histidine 0.35
 Glycine 0.67
 Tyrosine 0.33
Nonessential amino acids (NEAA)
 Asparagine 1.38
 Serine 0.74
 Glutamine 2.58
 Alanine 0.77
 Proline 0.51
Open in a new tab
1

Values were presented as the means of triplicate per sample.

Table 3.

Analyzed concentrations of amino acids (% dry matter) in crop milk during 25 D of chick rearing.1

Item Chick-rearing period2
R1
 R7
 R15
 R25
Male Female Male Female Male Female Male Female
Essential amino acids (EAA)
 Lys 4.02 ± 0.14A 3.63 ± 0.36a 1.60 ± 0.05B 1.23 ± 0.13b 0.97 ± 0.04C 0.93 ± 0.06b 0.86 ± 0.01C 0.86 ± 0.01b
 Met 1.10 ± 0.02A 1.00 ± 0.16a 0.40 ± 0.01B 0.35 ± 0.01b 0.37 ± 0.003B 0.36 ± 0.01b 0.36 ± 0.001B 0.37 ± 0.003b
 Cys 0.85 ± 0.03A 0.84 ± 0.06a 0.31 ± 0.01B 0.33 ± 0.003b 0.32 ± 0.004B 0.32 ± 0.003b 0.32 ± 0.001B 0.32 ± 0.001b
 Thr 2.71 ± 0.07A 2.48 ± 0.23a 1.16 ± 0.03B 0.96 ± 0.05b 0.86 ± 0.04C 0.78 ± 0.07b 0.66 ± 0.01D 0.65 ± 0.002b
 Ile 2.04 ± 0.04A 1.88 ± 0.16a 0.88 ± 0.02B 0.75 ± 0.05b 0.71 ± 0.004C 0.64 ± 0.02b 0.61 ± 0.01D 0.61 ± 0.002b
 Leu 4.98 ± 0.13A 4.62 ± 0.37a 2.31 ± 0.04B 1.98 ± 0.11b 1.78 ± 0.01C 1.64 ± 0.15b 1.39 ± 0.01D 1.34 ± 0.01b
 Val 2.56 ± 0.04A 2.34 ± 0.19a 1.16 ± 0.03B 0.97 ± 0.06b 0.80 ± 0.01C 0.78 ± 0.02b 0.75 ± 0.01C 0.75 ± 0.01b
 Phe 2.18 ± 0.04A 2.11 ± 0.12a 1.38 ± 0.03B 1.15 ± 0.11b 0.88 ± 0.01C 0.86 ± 0.03b 0.81 ± 0.004C 0.83 ± 0.01b
 Arg 3.39 ± 0.08A 3.13 ± 0.27a 1.57 ± 0.04B 1.36 ± 0.05b 1.31 ± 0.01C 1.21 ± 0.05b 1.13 ± 0.002D 1.16 ± 0.01b
 His 1.02 ± 0.01A 0.95 ± 0.06a 0.59 ± 0.01B 0.51 ± 0.04b 0.40 ± 0.01C 0.39 ± 0.02b,c 0.35 ± 0.003D 0.36 ± 0.001c
 Gly 2.47 ± 0.06A 2.25 ± 0.20a 1.16 ± 0.02B 0.96 ± 0.07b 0.83 ± 0.03C 0.76 ± 0.04b 0.65 ± 0.01D 0.69 ± 0.02b
 Tyr 1.55 ± 0.06A 1.46 ± 0.12a 0.71 ± 0.02B 0.56 ± 0.06b 0.46 ± 0.01C 0.41 ± 0.05b 0.32 ± 0.01D 0.33 ± 0.01b
Nonessential amino acids (NEAA)
 Asp 4.63 ± 0.12A 4.28 ± 0.35a 2.36 ± 0.06B 2.03 ± 0.10b 1.86 ± 0.02C 1.69 ± 0.15b 1.38 ± 0.02D 1.39 ± 0.003b
 Ser 2.59 ± 0.07A 2.41 ± 0.19a 1.25 ± 0.03B 1.09 ± 0.04b 0.97 ± 0.03C 0.90 ± 0.09b,c 0.74 ± 0.002D 0.41 ± 0.34c
 Glu 6.88 ± 0.12A 6.42 ± 0.42a 4.12 ± 0.08B 3.57 ± 0.27b 3.04 ± 0.07C 2.80 ± 0.11b 2.54 ± 0.04D 2.57 ± 0.004b
 Ala 3.02 ± 0.07A 2.80 ± 0.23a 1.39 ± 0.03B 1.16 ± 0.06b 1.05 ± 0.06C 0.87 ± 0.06b 0.76 ± 0.01D 0.76 ± 0.01b
 Pro 1.00 ± 0.04A 1.03 ± 0.01a 0.80 ± 0.02B 0.77 ± 0.04b 0.64 ± 0.03C 0.59 ± 0.09b,c 0.51 ± 0.003D 0.50 ± 0.001c
Open in a new tab

A–D, a–cMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05).

1

Data are shown as means of 3 pooled determinations of 2 crop milk samples each.

2

The stages included day 1 (R1), 7 (R7), 15 (R15), and 25 (R25) of the chick-rearing period.

Table 4.

Analyzed concentrations of amino acids (μg/mL) in pigeon plasma during 25 D of chick rearing.1

Item Chick-rearing period2
R1
 R7
 R15
 R25
Male Female Male Female Male Female Male Female
Essential amino acids (EAA)
 Lys 67.30 ± 0.34B 69.93 ± 0.07a 67.82 ± 0.08B 70.13 ± 0.08a 70.30 ± 0.08A 68.71 ± 0.46b 69.85 ± 0.13A 69.57 ± 0.04b
 Met 8.61 ± 0.04A 9.18 ± 0.03c 8.55 ± 0.24A,B 9.41 ± 0.08b 8.20 ± 0.79B 8.72 ± 0.07d 8.43 ± 0.11C 10.02 ± 0.03a
 Cys 3.08 ± 0.17A 2.99 ± 0.02a 3.02 ± 0.44A 2.98 ± 0.03a 2.81 ± 0.09B 2.87 ± 0.01b 2.54 ± 0.07C 2.64 ± 0.02c
 Thr 101 ± 0.45B 108 ± 0.37b 102 ± 0.17A,B 108 ± 0.67b 102 ± 0.37B 106 ± 0.08c 103 ± 0.35A 111 ± 0.50a
 Ile 14.76 ± 0.09B 14.14 ± 0.05b 14.65 ± 0.02B 14.26 ± 0.04b 15.06 ± 0.04A 14.30 ± 0.04b 14.65 ± 0.03B 14.76 ± 0.09a
 Leu 50.30 ± 0.17C 51.69 ± 0.15c 51.12 ± 1.11B 52.11 ± 0.06b 52.05 ± 0.10A 52.30 ± 0.08b 52.08 ± 0.19A 52.75 ± 0.14a
 Val 26.30 ± 0.12B 26.71 ± 0.11b 26.61 ± 0.15B 28.00 ± 0.02a 26.56 ± 0.06B 26.12 ± 0.05c 28.01 ± 0.03A 28.22 ± 0.13a
 Phe 11.99 ± 0.03B 12.38 ± 0.09a,b 12.28 ± 0.15A,B 12.61 ± 0.13a 11.98 ± 0.04B 11.96 ± 0.19b 12.44 ± 0.14A 12.37 ± 0.06a,b
 Arg 68.35 ± 0.16B 70.37 ± 0.06a 69.95 ± 0.19A 70.26 ± 0.20a 70.09 ± 0.16A 69.27 ± 0.42b 70.38 ± 0.17A 68.64 ± 0.36b
 His 31.69 ± 0.17B 33.22 ± 0.20bc 31.99 ± 0.05B 33.72 ± 0.13b 31.28 ± 0.04C 32.60 ± 0.03c 32.43 ± 0.02A 34.67 ± 0.30a
 Gly 5.64 ± 0.06A 6.16 ± 0.09b 5.69 ± 0.05A 6.42 ± 0.02a 5.23 ± 0.06B 5.89 ± 0.05c 5.21 ± 0.06B 6.00 ± 0.03b,c
 Tyr 13.67 ± 0.07B 12.94 ± 0.04c 14.02 ± 0.03A 13.26 ± 0.03b 13.03 ± 0.05C 12.80 ± 0.03d 13.08 ± 0.04C 13.98 ± 0.05a
Nonessential amino acids (NEAA)
 Asp 12.79 ± 0.08B 13.58 ± 0.15a,b 13.01 ± 0.07A,B 13.86 ± 0.13a,b 12.81 ± 0.08B 12.96 ± 0.09b 13.28 ± 0.16A 14.26 ± 0.56a
 Ser 53.04 ± 0.29A 56.01 ± 0.13a 52.71 ± 0.23A,B 56.08 ± 0.10a 52.07 ± 0.09B 55.63 ± 0.20a 50.15 ± 0.09C 54.60 ± 0.33b
 Glu 32.10 ± 0.07A 29.52 ± 0.06b 31.45 ± 0.13B 29.89 ± 0.15a 30.31 ± 0.17C 28.58 ± 0.04c 28.16 ± 0.19D 30.19 ± 0.11a
 Ala 42.00 ± 0.03 44.99 ± 0.17c 42.50 ± 0.75 45.62 ± 0.05b 42.55 ± 0.11 42.86 ± 0.10d 42.41 ± 0.28 48.15 ± 0.10a
 Pro 21.06 ± 0.49B 22.87 ± 0.10b 22.31 ± 0.10A 22.98 ± 0.03b 22.15 ± 0.06A 22.05 ± 0.03c 22.85 ± 0.22A 24.04 ± 0.01a
Open in a new tab

A–D, a–dMean values within the same row not sharing a common superscript letter are significantly different (P < 0.05).

1

Data are shown as means of 3 pooled determinations of 2 pigeon plasma samples each.

2

The stages included day 1 (R1), 7 (R7), 15 (R15), and 25 (R25) of the chick-rearing period.

Table 5.

P-values for the effects of stage, sex, and their interaction in analyzed concentrations of amino acids in pigeon crop milk during 25 D of chick rearing.

Item P-value
Stage Sex Stage × sex
Essential amino acids (EAA)
 Lys <0.001 0.096 0.459
 Met <0.001 0.331 0.755
 Cys <0.001 0.868 0.950
 Thr <0.001 0.106 0.542
 Ile <0.001 0.084 0.572
 Leu <0.001 0.099 0.600
 Val <0.001 0.066 0.316
 Phe <0.001 0.138 0.455
 Arg <0.001 0.111 0.572
 His <0.001 0.112 0.154
 Gly <0.001 0.103 0.360
 Tyr <0.001 0.182 0.732
Nonessential amino acids (NEAA)
 Asp <0.001 0.098 0.526
 Ser <0.001 0.104 0.734
 Glu <0.001 0.060 0.472
 Ala <0.001 0.066 0.629
 Pro <0.001 0.816 0.933
Open in a new tab

Table 6.

P-values for the effects of stage, sex, and their interaction in analyzed concentrations of amino acids in pigeon plasma during 25 D of chick rearing.

Item P-value
Stage Sex Stage × sex
Essential amino acids (EAA)
 Lys <0.001 <0.001 <0.001
 Met <0.001 <0.001 <0.001
 Cys <0.001 0.86 0.046
 Thr <0.001 <0.001 0.015
 Ile <0.001 <0.001 <0.001
 Leu <0.001 <0.001 0.004
 Val <0.001 <0.001 <0.001
 Phe 0.003 0.075 0.13
 Arg 0.036 0.75 <0.001
 His <0.001 <0.001 0.045
 Gly <0.001 <0.001 0.13
 Tyr <0.001 <0.001 <0.001
Nonessential amino acids (NEAA)
 Asp 0.008 <0.001 0.30
 Ser <0.001 <0.001 0.015
 Glu <0.001 <0.001 <0.001
 Ala <0.001 <0.001 <0.001
 Pro <0.001 <0.001 0.001
Open in a new tab

Gene Expression of Neutral AA Transporters

mRNA abundances of SNAT2, ASCT1, and LAT1 in the male crops reached maximum levels at I17 (P < 0.05) (Figure 1, A–C), whereas abundances of ASCT1 and B0AT1 mRNA in the female crops and LAT4 mRNA in the male crops peaked on R1 (P < 0.05) (Figure 1, B, D and E). In the females, gene expression of LAT1 reached a significant 10-fold increase at day 7 of chick rearing (P < 0.05) (Figure 1C), and the peak value for asc-1 expression was attained on R1, where an approximate 70-fold increase was observed compared with I4 (P < 0.05) (Figure 1G). Expressions of LAT4 and ATB0'+ genes in the female crops and asc-1 gene in the male crops decreased significantly after I17 (Figure 1, D, F and G). A significant interaction of stage and sex for gene expression of ASCT1, LAT4, B0AT1, ATB0'+, and asc-1 was observed in the study (P < 0.05) (Table 7).

Figure 1.

Figure 1

Open in a new tab

Changes in relative abundance of mRNA for Na+-coupled neutral amino acid transporter 2 (SNAT2) (A), Na+-dependent neutral amino acid transporter (ASCT1) (B), L-type amino acid transporter 1 (LAT1) (C), L-Type amino acid transporter 1 (LAT4) (D), Na+-dependent neutral amino acid transporter (B0AT1) (E), Na+- and Cl−-dependent neutral and cationic amino acid transporter (ATB0'+) (F), and asc-type amino acid transporter 1 (asc-1) (G). The stages included incubation periods of I4, I10, and I17 and the chick-rearing periods of R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A–D) or lowercase letters (a–d) are significantly different (P < 0.05).

Table 7.

P-values for the effects of stage, sex, and their interaction in expressions of genes involved in amino acid transport in male and female pigeons during incubation and chick-rearing period.

Item Genes involved in amino acid transport
SNAT2 ASCT1 LAT1 LAT4 B0AT1 ATB0'+ asc-1 EAAT3 xCT IMINOB PAT-1 b0,+AT CAT1 y+LAT2
P-value
 Stage <0.001 <0.001 0.001 0.002 0.001 <0.001 <0.001 <0.001 0.010 0.021 <0.001 0.002 <0.001 <0.001
 Sex 0.427 <0.001 0.081 0.757 <0.001 <0.001 <0.001 0.014 0.169 0.570 <0.001 0.970 <0.001 0.929
 Stage × sex 0.612 <0.001 0.122 0.015 <0.001 <0.001 <0.001 <0.001 0.340 0.061 0.749 0.008 <0.001 0.881
Open in a new tab

Abbreviations: asc-1, asc-type amino acid transporter 1; ASCT1, Na+-dependent neutral amino acid transporter; ATB0'+, Na+- and Cl−-dependent neutral and cationic amino acid transporter; B0AT1, Na+-dependent neutral amino acid transporter; b0,+AT, Na+-dependent cationic and zwitterionic amino acid transporter; CAT1, Na+-dependent cationic amino acid transporter; EAAT3, excitatory amino acid transporter 3; IMINOB, Na+- and Cl−-dependent proline IMINO transporter; LAT1, L-type amino acid transporter 1; LAT4, L-type amino acid transporter 4; PAT-1, proton-coupled amino acid transporter 1; SNAT2, Na+-coupled neutral amino acid transporter 2; xCT, cystine/glutamate exchange transporter; y+LAT2, Na+-dependent cationic and Na+-dependent neutral amino acid transporter 2.

Gene Expression of Anionic AA and Imino Acid Transporters

EAAT3 gene expression changed significantly with stage, sex, and their interaction (P < 0.05) (Table7) and reached the highest level at I10 in both the male and female pigeon crops (P < 0.05) (Figure 2A). xCT gene expression in the male pigeon crops increased 6.6-fold on day 7 of chick rearing (P < 0.05) (Figure 2B), and similarly, PAT-1 gene expression in both the male and female pigeons gradually reached maximum values on R7 with a 7.4- to 11.2-fold increase compared with the beginning of incubation and then sharply decreased (P < 0.05) (Figure 2D). IMINOB gene expression peaked on R25 in the females, whereas no significant change was observed in the males (P > 0.05) (Figure 2C).

Figure 2.

Figure 2

Open in a new tab

Changes in relative abundance of mRNA for excitatory amino acid transporter 3 (EAAT3) (A), cystine/glutamate exchange transporter (xCT) (B), Na+- and Cl−-dependent proline IMINO transporter (IMINOB) (C), and proton-coupled amino acid transporter 1 (PAT-1) (D). The stages included incubation periods of I4, I10, and I17 and chick-rearing periods of R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A–D) or lowercase letters (a–d) are significantly different (P < 0.05).

Gene Expression of Cationic AA Transporters

The peak mRNA levels of b0,+AT in both male and female pigeons, CAT1 in the male pigeons and y+LAT2 in the female pigeons were attained on R7, where a 3.2- to 22-fold increase was observed compared with day 4 of incubation (P < 0.05) (Figure 3, A–C). mRNA levels of both CAT1 in the female pigeons and y+LAT2 in the male pigeons increased to their highest level on R1 (P < 0.05) (Figure 3, B and C).

Figure 3.

Figure 3

Open in a new tab

Changes in relative abundance of mRNA for Na+-dependent cationic and zwitterionic amino acid transporter (b0,+AT) (A), Na+-dependent cationic amino acid transporter (CAT1) (B), and Na+-dependent cationic and Na+-dependent neutral amino acid transporter 2 (y+LAT2) (C). The stages included incubation periods of I4, I10, and I17 and chick-rearing periods of R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A–D) or lowercase letters (a–d) are significantly different (P < 0.05).

Gene Expression of GDH1, GS, OAT, and ASL

Gene expression of glutamate dehydrogenase 1 (GDH1), glutamine synthetase (GS), OAT, and argininosuccinate lyase (ASL) varied significantly with stage and sex (P < 0.001) (Table 8). GDH1 expression in both parent pigeon crops increased to their highest values on I17, and there was a sharp 100-fold increase in GS expression on R25 compared with I4 (P < 0.05) (Figure 4, A and B). Gene expressions of OAT in both males and females and ASL in males were highest on R1, whereas female ASL gene expression peaked on R10 (P < 0.05) (Figure 4, C and D).

Table 8.

P-values for the effects of stage, sex, and their interaction in expressions of genes involved in amino acid synthesis in male and female pigeons during incubation and chick-rearing period.

Item Genes involved in amino acid synthesis
GDH1 GS OAT ASL GOT1 GOT2 ASN TDH 3PDGH SHMT1 SHMT2 GPT2 ACSN
Stage <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 <0.001 0.002
Sex 0.001 <0.001 <0.001 <0.001 0.217 <0.001 0.195 0.126 0.023 <0.001 0.006 <0.001 0.244
Stage × sex 0.077 <0.001 0.001 <0.001 0.156 0.002 <0.001 <0.001 0.086 <0.001 <0.001 <0.001 0.004
Open in a new tab

Abbreviations: 3PGDH, phosphoglycerate dehydrogenase; ACSN, acetolactate synthase; ASL, argininosuccinate lyase; ASN, asparagine synthetase; GDH1, glutamate dehydrogenase 1; GOT1, glutamic-oxal(o)acetic transaminase 1; GOT2, glutamic-oxal(o)acetic transaminase 2; GPT2, glutamic-pyruvic transaminase 2; GS, glutamine synthetase; OAT, ornithine-δ-aminotransferase; SHMT1, serine hydroxymethyltransferase 1; SHMT2, serine hydroxymethyltransferase 2; TDH, L-threonine 3-dehydrogenase.

Figure 4.

Figure 4

Open in a new tab

Changes in relative abundance of mRNA for glutamate dehydrogenase 1 (GDH1) (A), glutamine synthetase (GS) (B); ornithine-δ-aminotransferase (OAT) (C), and argininosuccinate lyase (ASL) (D). The stages included incubation periods of I4, I10, and I17 and chick-rearing periods of R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A–D) or lowercase letters (a–d) are significantly different (P < 0.05).

Gene Expression of GOT1, GOT2, and ASN

Glutamic-oxal(o)acetic transaminase 1 (GOT1), glutamic-oxal(o)acetic transaminase 2 (GOT2), and asparagine synthetase (ASN) all maintained relatively higher levels of gene expression in both the male and female pigeon crops from I17 to R7, and their maximum values were observed on R1 with a 3- to 11.6-fold increase compared with day 4 of incubation (P < 0.05) (Figure 5). A significant interaction of stage and sex for gene expression of GOT2 and ASN was observed (P < 0.05) (Table 8).

Figure 5.

Figure 5

Open in a new tab

Changes in relative abundance of mRNA for glutamic-oxal(o)acetic transaminase 1 (GOT1) (A), glutamic-oxal(o)acetic transaminase 2 (GOT2) (B), and asparagine synthetase (ASN) (C). The stages included incubation periods of I4, I10, and I17; chick-rearing periods of R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A–C) or lowercase letters (a–d) are significantly different (P < 0.05).

Gene Expression of TDH, 3PDGH, SHMT1, and SHMT2

Gene expression of L-threonine 3-dehydrogenase (TDH) in the male and female pigeon crops reached maximum values on R1 and I17, respectively (P < 0.05) (Figure 6A). Gene expressions of serine hydroxymethyltransferase 1 (SHMT1) and serine hydroxymethyltransferase 2 (SHMT2) varied significantly with sex and interaction of stage and sex (P < 0.05) (Table 8). 3-Phosphoglycerate dehydrogenase (3PDGH) gene expressions in the females and SHMT1 gene expression in the males increased to the highest level on R7 (P < 0.05) (Figure 6, B and C), whereas SHMT2 gene expression in both male and female pigeons peaked on R1 (P < 0.05) (Figure 6D).

Figure 6.

Figure 6

Open in a new tab

Changes in relative abundance of mRNA for L-threonine 3-dehydrogenase (TDH) (A), 3-phosphoglycerate dehydrogenase (3PDGH) (B), serine hydroxymethyltransferase 1 (SHMT1) (C), and serine hydroxymethyltransferase 2 (SHMT2) (D). The stages included incubation periods of I4, I10, and I17 and chick-rearing periods of R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A–C) or lowercase letters (a–d) are significantly different (P < 0.05).

Gene Expression of GPT2 and ACSN

mRNA abundance of glutamic-pyruvic transaminase 2 (GPT2) in the male and female pigeons reached a peak level on R1, with a 3.1- to 9.4-fold increase, whereas the maximum value for acetolactate synthase (ACSN) mRNA abundance was attained on I17 (P < 0.05) (Figure 7), and expression of the 2 genes was also affected by the interaction of stage and sex (P < 0.05) (Table 8).

Figure 7.

Figure 7

Open in a new tab

Changes in relative abundance of mRNA for glutamic-pyruvic transaminase 2 (GPT2) (A) and acetolactate synthase (ACSN) (B). The stages included incubation periods of I4, I10, and I17 and chick-rearing periods of R1, R7, R15, and R25. Values are means ± SEM (n = 6 males and females). Bars with the different capital letters (A–C) or lowercase letters (a–c) are significantly different (P < 0.05).

Discussion

Owing to the extreme deficiency of carbohydrates, protein in crop milk is fundamental for the growth and development of pigeon squabs (Hu et al., 2016). AA are the building blocks of proteins that control various metabolic pathways important for whole-body homeostasis (Wu, 2003). In pigeon milk, approximately 17% of the protein is composed of free AA, and these proportions increase during the first week of production (Vandeputte-Poma and van Grembergen, 1959, Vandeputte-Poma, 1980). Consistent with results found previously (Hedge, 1972, Zhang et al., 2017), our data showed that Glu, Asp, and Leu were the 3 most abundant AA. All AA concentrations in the present study decreased significantly on R7 and reached their lowest levels on R25, which is close to the AA levels of the pigeons' diet. With the end of 1-wk peak lactation, there was a feed transition for pigeon squabs (Shetty et al., 1992). Pellet diets or grains appeared in the crop milk, and nearly half of crop milk has been substituted for whole grains up to 14 D of squab age. On day 28 of chick rearing, “lactation” has completely ceased (Vandeputte-Poma, 1980), and crop milk was fully changed into parental pigeon feed. However, young pigeons older than 20 D still lacked the self-feeding capacity, so adults “regurgitated” almost entirely pigeon feed to the young. Therefore, high contents of AA in crop milk at the beginning of “lactation” were gradually “diluted.” This can well explain why the AA concentrations continuously decreased.

During lactation in mammals, the uptake of AA from circulation into the mammary gland is enhanced (Rezaei et al., 2016), so AA concentrations of plasma were often measured as an indicator of milk protein synthesis. Sciascia et al. (2015) reported that an increase in milk protein concentration is accompanied by elevated concentrations of intracellular AA in mammary glands, but a decrease in the AA concentration of plasma was observed, suggesting inconsistent AA metabolism in different tissues. However, Chen et al. (2018) found that in sows, the plasma concentrations of most AA were greater on day 1 of lactation compared with those on day 17. Our results showed that not all plasma AA exhibit a similar pattern change; about half were higher late in chick rearing than that at the beginning, and the rest were higher on R1 or R7. In addition, our previous study showed that whatever feeding strategy is adopted, body weight loss of parental pigeons seemed to be inevitable upon the completion of rearing, and the breast and thigh muscles, which function as an AA reserve, quickly reduced in weights (Xie et al., 2017, Xie et al., 2018). Therefore, as found in mammals (Trottier, 1995, Chen et al., 2018), it is probable that AA originating from the feed and muscle tissues through protein catabolism will provide substrates for milk synthesis in pigeons. Interestingly, parental pigeon sex has no effect on AA concentrations in crop milk in our study, but 8 types of plasma AA in the female pigeons were higher than those in the male pigeons. The different uptake efficiency of AA from blood into crop milk between male and female pigeons may be an important reason. Moreover, plasma AA were also used for self-sustainment in animals. Different breeding behaviors (Lea et al., 1986) and liver metabolism (Wan et al., 2018) between male and female pigeons indicated their potential different AA requirement during the breeding period.

In pigeons, AA transporters have not been studied in any other tissues except the small intestine. During peak lactation in mammals, gene expressions of SNAT2, LAT1, LAT2, ASCT1, CAT1, EAAT3, b0,+AT, and y+LAT2 have all been reported to increase significantly, suggesting their potential role in milk protein synthesis (Shennan et al., 2002, Alemán et al., 2009, Manjarin et al., 2011, Chen et al., 2018). SNAT2, mainly expressed in epithelial cells, recruits neutral AA. Its gene expression can be activated by prolactin, and a previous study found that prolactin was a main reason for crop milk formation; in addition, its level in pigeon serum maintained a high level from day 17 of incubation to day 4 of chick rearing (Dumont, 1965, Xie et al., 2018). The uptake of Ala, Ser, and Cys by ASCT1 in multiple types of cells was independent of pH and energy but dependent on Na+ (Katragadda et al., 2005). The ASC system was not reported to be responsive to hormones, but its changing pattern suggested that prolactin regulation might be involved. LAT1 and LAT4 are charged with the transportation of aromatic and large BCAA in various types of cells. LAT1 is an obligatory antiporter and cannot mediate the net uptake or efflux of its targets, whereas LAT4 is shown to mediate the Na+-independent uniport of AA despite its narrow substrate specificity (Babu et al., 2003, Bodoy et al., 2005). Higher levels of LAT4 in male pigeons possibly enhanced AA transport efficiency from the plasma AA reserve. Different LAT4 expressions between male and female pigeons showed that a sexual effect exists.

B0AT1 transports almost all neutral AA. Its relatively higher expression in female crops during peak secretion suggests its importance only in female pigeons. ATB0,+ shows a high affinity for both neutral and cationic AA; however, it may be nonessential to milk formation because of lower expression. A consistent result was the observation that system B0,+ (ATB0,+) decreased from early to peak lactation in mammals (Laspiur et al., 2004). asc-1 conveys the Na+-dependent high-affinity transport of short-chain neutral AA. AA efflux could be strongly transstimulated under the regulation of this transporter when intracellular and extracellular AA concentrations need to be balanced (Nakauchi et al., 2000). Sharp increases in asc-1 in female pigeons indicated its special role in AA transport compared with its depressed expression in male pigeons.

The transcript abundance of EAAT3 in crop tissues maintained a low level after I10. The uptake of Glu and Asp is far less than their output in mammalian milk (Trottier et al. 1997). These 2 AA are NEAA, and their contents were higher than other AA in crop milk. Glu can be produced through catalysis of alpha-ketoglutarate and transamination during the intracellular AA metabolism because activities of GDH1, GOT1, GOT2, and GPT2 were all enhanced. Lipid content of crop milk produced by the males was higher during the early stages of chick rearing than that produced by the females. More lipid accumulation often causes more oxidative stress and can induce xCT activity (Bannai et al., 1991), facilitating the exchange of extracellular cystine for the synthesis of intracellular glutathione, an antioxidant that plays an important role in maintaining redox balance (Patel et al., 2004).

According the changing patterns of gene expression in the present study, proline uptake by crop cells was mainly dependent on PAT-1 instead of IMINOB. However, a previous study found that short-chain fatty acids, not just an amino group, are also PAT1 substrates (Foltz et al., 2004). Owing to the acidic microenvironment and abundant active microorganisms in the crop sac (Shetty et al., 1990), it is speculated that short-chain fatty acids will be increased with the process of milk formation.

The expression of cationic AA transporters, b0,+AT and CAT1, was found to increase from I17 to I7 in the present study. In mammals, the absorption of NEAA from circulation by mammary cells is insufficient to support milk protein production (Mepham, 1982). EAA, especially cationic AA, are taken up in excess by lactating cells, and they can be converted to NEAA or intermediate products for the Krebs cycle (Menzies et al., 2009). For example, excessive arginine in the mammary gland can be converted into proline by OAT and pyrroline-5-carboxylate reductase (Basch et al., 1995, Basch et al., 1996). A similar metabolic process may exist in pigeon crop cells. OAT gene expression was observed to be higher during the peak of crop milk formation. y+LAT2 is charged for cationic AA efflux, and the activated gene, also found in the present study, may play a role in the balance of intracellular and extracellular content of relevant AA (Bröer et al., 2000).

Neutral (SNAT2, ASCT1, and LAT1) and cationic (b0,+AT, CAT1, and y+LAT2) AA transporters in crop tissues of both parental sexes analyzed in our study showed significant higher expressions from I17 to R7, and they could be an important reason for lower concentrations of responsive AA in plasma at the beginning of “lactation” in pigeons. However, the fluctuation of anionic AA transporters (EAAT3, xCT and IMINOB) did not coincide well with the changing pattern of Asp, Glu, and Pro and biosynthesis in situ of these 3 NEAA because the high expression of related enzymes from I17 to R7 should be taken into consideration. Meanwhile, some AA showed different changing patterns between male and female pigeons. It suggests that AA transporter was not the only determinant for plasma AA concentration, and other potential factors, such as self-sustainment, AA metabolism, and hormones, may be involved, which still needs further research.

The genes involved in AA synthesis in the present study were all detected by their expressions, which showed active AA metabolism in the crop sacs of pigeons. Glutamine synthetase is a key enzyme for glutamine production in most animal cells (Wu, 2013), but its activity is absent in mammary glands (Li et al., 2009), differing from pigeon crops. Our data showed that GS expression in crop tissue increased dramatically in the females in the late stages of chick rearing, whereas in the males, it maintained a low level over the entire breeding stage, suggesting that a sexual effect exists in glutamine synthesis. ASL converts citrulline to arginine under the regulation of glucocorticoids (Flynn et al., 1999). The higher levels of ASL gene expression from I10 to I17 suggest that de novo synthesis of arginine was possible as an advance reserve before crop milk secretion.

Asparagine is synthesized by ASN through a transfer of the amide nitrogen of glutamine to aspartate in an ATP-dependent reaction (Richards and Schuster, 1998). In our study, ASN increased significantly from I17 to R7, and we speculated that asparagine is mainly dependent on de novo biosynthesis as is the case in mammals (Trottier et al., 1997) because of lower expression in relative transporter.

The conversion of the L-threonine to 2-amino-3-ketobutyrate by TDH is the first step of glycine synthesis. In “lactating” pigeons, serum insulin increases significantly (Hu et al., 2016) and was shown to enhance the glycine synthesis (Menzies et al., 2009), so TDH may be involved in insulin regulation. The biosynthesis reaction of serine from a glycolytic intermediate 3-phosphoglycerate was initiated by 3PDGH (Yamasaki et al., 2001), which was shown to maintain relatively high levels after day 10 of incubation. Serine hydroxymethyltransferase exists as cytosolic (SHMT1) and mitochondrial isozyme (SHMT2), which catalyze the transfer of a beta carbon from serine to tetrahydrofolate (THF) to form glycine and 5,10-methylene-THF (Hebbring et al., 2012). The changing pattern of 3PDGH, SHMT1, and SHMT2 and higher levels of serine in pigeon plasma at the beginning of chick rearing suggested that serine may be a very important origination for glycine.

2-Acetolactate is converted from pyruvate by ACSN as the initial step in the valine and leucine pathway or subsequently with 2-ketobutyrate to form 2-aceto-2-hydroxybutyrate as the intermediate in the isoleucine pathway (Gollop et al., 1988). Concentrations of BCAA, Ile, Leu, and Val in pigeon plasma are observed to be significantly lower on R1, suggesting that their influxes in crop cells finally lead to the depressed ACSN expression responsible for BCAA synthesis.

In the current study, most of enzymes related in AA synthesis showed maximum expression levels from I17 to R7, which is the peak of crop milk secretion. Therefore, de novo biosynthesis of related AA in epithelial cells, such as Glu, Pro, Arg, Asp, Ser, and Gly, could be an important pathway for crop milk formation. The final changing pattern of AA concentrations in pigeon milk was probably dependent on the combined action of AA transporters and enzymes related in AA synthesis or decomposition in crop tissues.

Conclusions

The present study speculates that the AA used for crop milk formation in pigeons may partially originate from free AA in plasma, and their uptake into crop cells may be dependent on the efficiency of various transporters. Changes in the gene expression of AA synthesis–related enzymes suggested an active intracellular AA metabolism, providing an important source for NEAA in crop milk. In addition, although the final AA composition in male and female pigeons has exhibited no differences, the genes involved in AA transport and synthesis vary significantly with sexual effects, which indicate that other factors, such as self-sustainment, AA metabolism, and hormones, should be considered in future explorations of the mechanisms of crop milk formation.

Acknowledgments

The authors thank all the members in the school for their generous technical suggestions. The research was supported by National Natural Funds of China (No. 31501974), Natural Science Foundation of Jiangsu Province, China (BK20150462), and China Postdoctoral Science Foundation, China (2017M621839).

References

  1. Alemán G., López A., Ordaz G., Torres N., Tovar A.R. Changes in messenger RNA abundance of amino acid transporters in rat mammary gland during pregnancy, lactation, and weaning. Metabolism. 2009;58:594–601. doi: 10.1016/j.metabol.2008.12.003. [DOI] [PubMed] [Google Scholar]
  2. Babu E., Kanai Y., Chairoungdua A., Kim D.K., Iribe Y., Tangtrongsup S., Jutabha P., Li Y., Ahmed N., Sakamoto S., Anzai N., Nagamori S., Endou H. Identification of a novel system L amino acid transporter structurally distinct from heterodimeric amino acid transporters. J. Biol. Chem. 2003;278:43838–43845. doi: 10.1074/jbc.M305221200. [DOI] [PubMed] [Google Scholar]
  3. Backwell F.R., Bequette B.J., Wilson D., Metcalf J.A., Franklin M.F., Beever D.E., Lobley G.E., MacRae J.C. Evidence for the utilization of peptides for milk protein synthesis in the lactating dairy goat in vivo. Am. J. Physiol. 1996;271:955–960. doi: 10.1152/ajpregu.1996.271.4.R955. [DOI] [PubMed] [Google Scholar]
  4. Bannai S., Sato H., Ishii T., Taketani S. Enhancement of glutathione levels in mouse peritoneal macrophages by sodium arsenite, cadmium chloride and glucose/glucose oxidase. Biochim. Biophys. Acta. 1991;1092:175–179. doi: 10.1016/0167-4889(91)90153-o. [DOI] [PubMed] [Google Scholar]
  5. Basch J.J., Wickham E.D., Farrell H.M. Ornithine-delta-aminotransferase in lactating bovine mammary glands. J. Dairy Sci. 1995;78:825–831. doi: 10.3168/jds.S0022-0302(95)76694-2. [DOI] [PubMed] [Google Scholar]
  6. Basch J.J., Wickham E.D., Farrell H.M. Pyrroline-5-carboxylate reductase in lactating bovine mammary glands. J. Dairy Sci. 1996;79:1361–1368. doi: 10.3168/jds.S0022-0302(96)76493-7. [DOI] [PubMed] [Google Scholar]
  7. Bharathi L., Shenoy K.B., Hegde S.N. Biochemical differences between crop tissue and crop milk of pigeons (Columba Livia) Comp. Biochem. Physiol. A. 1997;116:51–55. [Google Scholar]
  8. Bodoy S., Martín L., Zorzano A., Palacín M., Estévez R., Bertran J. Identification of LAT4, a novel amino acid transporter with system L activity. J. Biol. Chem. 2005;280:12002–12011. doi: 10.1074/jbc.M408638200. [DOI] [PubMed] [Google Scholar]
  9. Bröer S. Amino acid transport across mammalian intestinal and renal epithelia. Physiol. Rev. 2008;88:249–286. doi: 10.1152/physrev.00018.2006. [DOI] [PubMed] [Google Scholar]
  10. Bröer A., Wagner C., Lang F., Bröer S. Neutral amino acid transporter ASCT2 displays substrate-induced Na+ exchange and a substrate-gated anion conductance. Biochem. J. 2000;346:705–710. [PMC free article] [PubMed] [Google Scholar]
  11. Cabrera R.A., Usry J.L., Arrellano C., Nogueira E.T., Odle J. Effects of creep feeding and supplemental glutamine or glutamine plus glutamate (Aminogut) on pre- and post-weaning growth performance and intestinal health of piglets. J. Anim. Sci. Biotechnol. 2013;4:29. doi: 10.1186/2049-1891-4-29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Carr R.H., James C.M. Synthesis of adequate protein in the glands of the pigeon crop. Am. J. Physiol. 1931;97:227–231. [Google Scholar]
  13. Chen F., Zhang S.H., Deng Z.X., Zhou Q.Q., Cheng L., Kim S.W., Chen J., Guan W.T. Regulation of amino acid transporters in the mammary gland from late pregnancy to peak lactation in the sow. J. Anim. Sci. Biotechnol. 2018;9:103–114. doi: 10.1186/s40104-018-0250-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. DeSantiago S., Torres N., Suryawan A., Tovar A.R., Hutson S.M. Regulation of branched-chain amino acid metabolism in the lactating rat. J. Nutr. 1998;128:1165–1171. doi: 10.1093/jn/128.7.1165. [DOI] [PubMed] [Google Scholar]
  15. Dumont J.N. Prolactin-induced cytologic changes in the mucosa of the pigeon crop during crop-“milk” formation. Z. Zellforsch. Mikrosk. Anat. 1965;68:755–782. doi: 10.1007/BF00343930. [DOI] [PubMed] [Google Scholar]
  16. Flynn N.E., Meininger C.J., Kelly K., Ing N.H., Morris S.M., Wu G. Glucocorticoids mediate the enhanced expression of intestinal type Ⅱ arginase and argininosuccinate lyase in postweaning pigs. J. Nutr. 1999;129:799–803. doi: 10.1093/jn/129.4.799. [DOI] [PubMed] [Google Scholar]
  17. Foltz M., Boll M., Raschka L., Kottra G., Daniel H. A novel bifunctionality: PAT1 and PAT2 mediate electrogenic proton/amino acid and electroneutral proton/fatty acid symport. FASEB J. 2004;18:1758–1760. doi: 10.1096/fj.03-1387fje. [DOI] [PubMed] [Google Scholar]
  18. Gao C.Q., Yang J.X., Chen M.X., Yan H.C., Wang X.Q. Growth curves and age-related changes in carcass characteristics, organs, serum parameters, and intestinal transporter gene, expression in domestic pigeon (Columba livia) Poult. Sci. 2016;95:867–877. doi: 10.3382/ps/pev443. [DOI] [PubMed] [Google Scholar]
  19. Gillespie M.J., Haring V.R., McColl K.A., Monaghan P., Donald J.A., Nicholas K.R., Moore R.J., Crowley T.M. Histological and global gene expression analysis of the ‘lactating’ pigeon crop. BMC Genomics. 2011;12:452–461. doi: 10.1186/1471-2164-12-452. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gollop N., Barak Z., Chipman D.M. Assay of products of acetolactate synthase. Meth. Enzymol. 1988;166:234–240. doi: 10.1016/s0076-6879(88)66031-9. [DOI] [PubMed] [Google Scholar]
  21. Hebbring S.J., Chai Y., Ji Y., Abo R.P., Jenkins G.D., Fridley B., Zhang J., Eckloff B.W., Wieben E.D., Weinshilboum R.M. Serine hydroxymethyltransferase 1 and 2: gene sequence variation and functional genomic characterization. J. Neurochem. 2012;120:881–890. doi: 10.1111/j.1471-4159.2012.07646.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hedge S.N. The amino-acid composition of pigeon milk. Curr. Sci. 1972;41:23–24. [Google Scholar]
  23. Horseman N.D., Buntin J.D. Regulation of pigeon cropmilk secretion and parental behaviors by prolactin. Annu. Rev. Nutr. 1995;15:213–238. doi: 10.1146/annurev.nu.15.070195.001241. [DOI] [PubMed] [Google Scholar]
  24. Hu X.C., Gao C.Q., Wang X.H., Yan H.C., Chen Z.S., Wang X.Q. Crop milk protein is synthesised following activation of the IRS1/Akt/TOR signalling pathway in the domestic pigeon (Columba livia) Br. Poult. Sci. 2016;57:855–862. doi: 10.1080/00071668.2016.1219694. [DOI] [PubMed] [Google Scholar]
  25. Katragadda S., Talluri R.S., Pal D., Mitra A.K. Identification and characterization of a Na+-dependent neutral amino acid transporter, ASCT1, in rabbit corneal epithelial cell culture and rabbit cornea. Curr. Eye Res. 2005;30:989–1002. doi: 10.1080/02713680500306439. [DOI] [PubMed] [Google Scholar]
  26. Laspiur J.P., Burton J.L., Weber P.S., Kirkwood R.N., Trottier N.L. Short communication: amino acid transporters in porcine mammary gland during lactation. J. Dairy Sci. 2004;87:3235–3237. doi: 10.3168/jds.s0022-0302(04)73459-1. [DOI] [PubMed] [Google Scholar]
  27. Lea R.W., Vowles D.M., Dick H.R. Factors affecting prolactin secretion during the breeding cycle of the ring dove (Streptopelia risoria) and its possible role in incubation. J. Endocrinol. 1986;110:447–458. doi: 10.1677/joe.0.1100447. [DOI] [PubMed] [Google Scholar]
  28. Lei J., Feng D., Zhang Y., Zhao F.Q., Wu Z., San Gabriel A., Fujishima Y., Uneyama H., Wu G. Nutritional and regulatory role of branched-chain amino acids in lactation. Front. Biosci. 2012;17:2725–2739. doi: 10.2741/4082. [DOI] [PubMed] [Google Scholar]
  29. Li P., Knabe D.A., Kim S.W., Lynch C., Hutson S., Wu G. Lactating porcine mammary tissue catabolized branched-chain amino acids for glutamine and asparate synthesis. J. Nutr. 2009;139:1502–1509. doi: 10.3945/jn.109.105957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  31. Manjarin R., Steibel J.P., Zamora V., Am-In N., Kirkwood R.N., Ernst C.W., Weber P.S., Taylor N.P., Trottier N.L. Transcript abundance of amino acid transporters, β-casein, and α-lactalbumin in mammary tissue of periparturient, lactating, and postweaned sows. J. Dairy Sci. 2011;94:3467–3476. doi: 10.3168/jds.2011-4163. [DOI] [PubMed] [Google Scholar]
  32. Mepham T.B. Amino acid utilization by lactating mammary gland. J. Dairy Sci. 1982;65:287–298. doi: 10.3168/jds.S0022-0302(82)82191-7. [DOI] [PubMed] [Google Scholar]
  33. Menzies K.K., Lefèvre C., Macmillan K.L., Nicholas K.R. Insulin regulates milk protein synthesis at multiple levels in the bovine mammary gland. Funct. Integr. Genomics. 2009;9:197–217. doi: 10.1007/s10142-008-0103-x. [DOI] [PubMed] [Google Scholar]
  34. Nakauchi J., Matsuo H., Kim D.K., Goto A., Chairoungdua A., Cha S.H., Inatomi J., Shiokawa Y., Yamaguchi K., Saito I., Endou H., Kanai Y. Cloning and characterization of a human brain Na+-independent transporter for small neutral amino acids that transports D-serine with high affinity. Neurosci. Lett. 2000;287:231–235. doi: 10.1016/s0304-3940(00)01169-1. [DOI] [PubMed] [Google Scholar]
  35. Patel S.A., Warren B.A., Rhoderick J.F., Bridges R.J. Differentiation of substrate and non-substrate inhibitors of transport system xc(-): an obligate exchanger of L-glutamate and L-cystine. Neuropharmacology. 2004;46:273–284. doi: 10.1016/j.neuropharm.2003.08.006. [DOI] [PubMed] [Google Scholar]
  36. Rezaei R., Wu Z., Hou Y., Bazer F.W., Wu G. Amino acids and mammary gland development: nutritional implications for milk production and neonatal growth. J. Anim. Sci. Biotechnol. 2016;7:20. doi: 10.1186/s40104-016-0078-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Richards N.G., Schuster S.M. Mechanistic issues in asparagine synthetase catalysis. Adv. Enzymol. Relat. Areas Mol. Biol. 1998;72:145–198. doi: 10.1002/9780470123188.ch5. [DOI] [PubMed] [Google Scholar]
  38. Sales J., Janssens G.P.J. Nutrition of the domestic pigeon (Columba livia domestica) World Poult. Sci. J. 2003;59:221–232. doi: 10.1093/ps/82.9.1457. [DOI] [PubMed] [Google Scholar]
  39. Sano A., Kakazu E., Morosawa T., Inoue J., Kogure T., Ninomiya M., Iwata T., Umetsu T., Nakamura T., Takai S., Shimosegawa T. The profiling of plasma free amino acids and the relationship between serum albumin and plasma-branched chain amino acids in chronic liver disease: a single-center retrospective study. J. Gastroenterol. 2018;53:978–988. doi: 10.1007/s00535-018-1435-5. [DOI] [PubMed] [Google Scholar]
  40. Sciascia Q.L., Pacheco D., Mccoard S.A. Administration of exogenous growth hormone is associated with changes in plasma and intracellular mammary amino acid profiles and abundance of the mammary gland amino acid transporter SLC3A2 in mid-lactation dairy cows. PLoS One. 2015;10:e0134323. doi: 10.1371/journal.pone.0134323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Shennan D.B., Calvert D.T., Travers M.T., Kudo Y., Boyd C.A.R. A study of L-leucine, L-phenylalanine and L-alanine transport in the perfused rat mammary gland: possible involvement of LAT1 and LAT2. Biochim. Biophys. Acta. 2002;1564:133–139. doi: 10.1016/s0005-2736(02)00410-8. [DOI] [PubMed] [Google Scholar]
  42. Shetty S., Sridhar K.R., Shenoy K.B., Hegde S.N. Observations on bacteria associated with pigeon crop. Folia. Microbiol. 1990;35:240–244. doi: 10.1007/BF02820491. [DOI] [PubMed] [Google Scholar]
  43. Shetty S., Bharathi L., Shenoy K.B., Hegde S.N. Biochemical properties of pigeon milk and its effect on growth. Comp. Biochem. Physiol. B. 1992;162:632–636. [Google Scholar]
  44. Trottier N. Univ Illinois; Urbana: 1995. Protein Metabolism in the Lactating Sow. PhD Diss. [Google Scholar]
  45. Trottier N.L., Shipley C.F., Easter R.A. Plasma amino acid uptake by the mammary gland of the lactating sow. J. Anim. Sci. 1997;75:1266–1278. doi: 10.2527/1997.7551266x. [DOI] [PubMed] [Google Scholar]
  46. Vandeputte-Poma J., van Grembergen G. Freie Aminosaure in der Kropfmilch der Taube. Naturwissenschafen. 1959;46:329–330. [Google Scholar]
  47. Vandeputte-Poma J. Feeding, growth and metabolism of the pigeon, Columba livia domestica: duration and role of crop milk feeding. J. Comp. Physiol. 1980;135:97–99. [Google Scholar]
  48. Wu G. Amino acids: metabolism, functions, and nutrition. Amino Acids. 2003;37:1–17. doi: 10.1007/s00726-009-0269-0. [DOI] [PubMed] [Google Scholar]
  49. Wu G. CRC Press; Boca Raton: 2013. Amino Acids: Biochemistry and Nutrition. [Google Scholar]
  50. Wan X.P., Xie P., Bu Z., Zou X.T. Changes in hepatic glucose and lipid metabolism-related parameters in domestic pigeon (Columba livia) during incubation and chick rearing. J. Anim. Physiol. Anim. Nutr. 2018;102:e558–e568. doi: 10.1111/jpn.12796. [DOI] [PubMed] [Google Scholar]
  51. Xie P., Jiang X.Y., Bu Z., Fu S.Y., Zhang S.Y., Tang Q.P. Free choice feeding of whole grains in meat-type pigeons:Ⅰ. effect on performance, carcass traits, and organ development. Br. Poult. Sci. 2016;57:699–706. doi: 10.1080/00071668.2016.1206191. [DOI] [PubMed] [Google Scholar]
  52. Xie P., Wang X.P., Bu Z., Zou X.T. Differential expression of fatty acid transporters and fatty acid synthesis-related genes in crop tissues of male and female pigeons (Columba livia domestica) during incubation and chick rearing. Br. Poult. Sci. 2017;58:594–602. doi: 10.1080/00071668.2017.1357798. [DOI] [PubMed] [Google Scholar]
  53. Xie P., Wan X.P., Bu Z., Diao E.J., Gong D.Q., Zou X.T. Changes in hormone profiles, growth factors and mRNA expression of the related receptors in crop tissue, relative organ weight, and serum biochemical parameters in the domestic pigeon (Columba livia) during incubation and chick-rearing periods under artificial farming conditions. Poult. Sci. 2018;97:2189–2202. doi: 10.3382/ps/pey061. [DOI] [PubMed] [Google Scholar]
  54. Yamasaki M., Yamada K., Furuya S., Mitoma J., Hirabayashi Y., Watanabe M. 3-Phosphoglycerate dehydrogenase, a key enzyme for l-serine biosynthesis, is preferentially expressed in the radial glia/astrocyte lineage and olfactory ensheathing glia in the mouse brain. J. Neurosci. 2001;21:7691–7704. doi: 10.1523/JNEUROSCI.21-19-07691.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Yip M.C.M., Knox W.E. Function of arginase in lactating mammary gland. Biochem. J. 1972;127:893–899. doi: 10.1042/bj1270893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zhang X.Y., Zhang N.N., Wan X.P., Li L.L., Zou X.T. Gene expression of amino acid transporter in pigeon (Columbia livia) intestine during post-hatch development and its correlation with amino acid in pigeon milk. Poult. Sci. 2017;96:1120–1131. doi: 10.3382/ps/pew320. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES