Skip to main content
Poultry Science logoLink to Poultry Science
. 2019 Dec 18;99(3):1326–1331. doi: 10.1016/j.psj.2019.10.071

Research Note: Correlation analysis of interleukin-6, interleukin-8, and C-C motif chemokine ligand 2 gene expression in chicken spleen and cecal tissues after Eimeria tenella infection in vivo

Hailiang Yu ∗, Wenbin Zou ∗, Xiaohui Wang ∗, Guojun Dai ∗,1, Tao Zhang ∗, Genxi Zhang ∗, Kaizhou Xie ∗, Jinyu Wang ∗, Huiqiang Shi †
PMCID: PMC7587758  PMID: 32115023

Abstract

IL-6, IL-8, and C-C motif chemokine ligand 2 (CCLi2) are important factors in inflammatory and immune responses. To investigate their relationships in the spleen and cecum and between coccidiosis-infected and uninfected states, we performed quantitative real-time PCR to compare the relative expression difference of IL-6, IL-8, and CCLi2 in the same tissues between the infection and control groups. In addition, the correlations of the relative expression levels of these 3 genes were determined in the same and different tissues within the same group. The results showed that the expression levels of IL-6, IL-8, and CCLi2 in the spleen and cecum of the infected group were all higher than those of the uninfected group (P < 0.05). The correlation coefficients among the IL-6, IL-8, and CCLi2 expression levels in the spleen or cecum were all positive in both the infection and control groups. In the spleen tissues, CCLi2 expression was strongly correlated with IL-6 and IL-8 in the uninfected group (P < 0.01), and the correlation coefficients reached 0.853 (R2 = 0.728) and 0.996 (R2 = 0.992), respectively. The expression of CCLi2 was also strongly correlated with IL-8 (R reached 0.890, R2 = 0.792) in the infected group. In the cecal tissues, the expression levels of the 3 genes were all extremely significantly correlated in the uninfected group (P < 0.01), and the correlation coefficients ranged from 0.498 to 0.765, indicating moderate correlations. The expression of IL-6 was extremely significantly positively correlated with IL-8 and CCLi2 in the infected group (P < 0.01), with moderate correlations (R ranged from 0.469–0.639). In addition, the expression levels of the 3 genes were not significantly correlated (P > 0.05) between the spleen and cecum tissues in either the infection group or the control group. These results indicate that IL-6, IL-8, and CCLi2 were correlated and play an important role in coccidiosis infection of Jinghai yellow chicken. Our data also provide a basis for further exploring the role of these 3 genes in genetic breeding for coccidiosis resistance.

Key words: Eimeria tenella, cecum, spleen, gene expression, correlation analysis

Introduction

Chickens are one of the most important sources of meat. However, the poultry industry is constantly threatened by parasites, especially avian coccidiosis. It is estimated that the annual global economic loss caused by coccidiosis exceeds $3 billion (Sharman et al., 2010, Blake and Tomley, 2014), at least 70% of which is due to a decrease in production performance caused by subclinical symptoms of coccidiosis, including individual growth retardation and a reduction in the feed conversion ratio, and 24% of which is due to increased expenses for drug prevention and treatment (Li et al., 2005). In addition, the weak effects of anticoccidials against different strains of pathogens and the high cost of vaccine production are still concerns in the global poultry industry (Wang et al., 2019). Therefore, research on selecting birds with natural resistance to chicken coccidia and other pathogens is important.

Using the RNA-seq technique to screen the differentially expressed genes between Eimeria tenella–infected and uninfected cecal tissues of Jinghai yellow chickens on the seventh day, Lin (2015) revealed that the differentially expressed genes significantly enriched in cytokine-cytokine receptor pathway interactions included IL-6, IL-8, IL-12b, IL-15, IL-17, and TGFB2. Among their gene products, IL-6 is a multifunctional cytokine that plays a vital role in many acute-phase reactions, autoimmune diseases, and hematopoietic mechanisms, particularly inflammatory bowel disease (Nishimichi et al., 2006, Neurath and Finotto, 2011, Schett et al., 2013). Rose-John et al. (2017) discovered that the host defense against bacterial and fungal pathogen infection was primarily mediated by classical IL-6 signaling pathways. IL-8 is an important chemokine in birds. By binding to the receptor CXCR1 on immune cells, IL-8 attracts immune cells to the affected area and then participates in the immune response, achieving immune cell resistance and promoting wound healing; it is significantly associated with acute or chronic inflammatory diseases and autoimmune diseases (Grimm et al., 1996, Coussens and Werb, 2002, Savage et al., 2004). Studies have demonstrated that parasite replication was significantly inhibited in chickens given the pcDNA3-1E vaccine along with IL-8 plasmids (Lillehoj and Lillehoj, 2000, Min et al., 2001) and that IL-8 can be used as an adjuvant for the DNA vaccine of E. tenella. Chemokine C-C motif 2 (CCLi2) is a member of the chemokine CC subfamily. As a promoter of the inflammatory response, CCLi2 plays an important role in promoting the migration of monocytes by binding to the CCR2 receptor (Mahad et al., 2005, Qian et al., 2011, O'Connor et al., 2015). These findings suggest that cytokines (IL-6) and chemokines (IL-8 and CCLi2) play a key role in pathogen infection in chickens, including that of E. tenella. Swaggerty et al. (2015) reported that selection for the proinflammatory mediators IL-6, IL-8 (CXCLi2), and CCLi2 produces chickens more resistant to E. tenella. However, the relationships among these 3 genes in the coccidial-infected state and the uninfected state and between different tissues are unclear in current studies. Thus, determination of the expression and regulation of the chicken IL-6, IL-8, and CCLi2 genes and the relationships among the expression levels of these 3 genes and coccidiosis should be performed.

In our study, quantitative real-time PCR (qRT-PCR) was applied to detect the relative mRNA expression levels of the proinflammatory cytokine IL-6 and the chemokines IL-8 and CCLi2 in the spleen and cecal tissues of Jinghai yellow chickens (Gallus gallus). The differences in relative expression levels of the 3 genes were compared between the infection and control groups, and correlations of the relative expression levels were analyzed. The objective of this study was to provide a basis for subsequent research on resistance to coccidia in chickens.

Materials and methods

Animals

A total of 80 (40♂, 40♀) 1-day-old healthy and physiologically similar Jinghai yellow chickens were selected from the Jinghai Yellow Chicken Resource Farm, Haimen, Jiangsu Province, China. All the chicks were randomly divided into the infected and uninfected groups and were kept in single cages free of coccidiosis by flame disinfection with a gasoline torch and fed antibiotic-free feed and water for up to 30 D (Wang et al., 2019). Each chicken in the infected group was orally infected with 2.5 × 104 E. tenella sporulated oocysts. The uninfected group received the same amount of normal saline. All protocols for animal sample collection were approved by the Animal Welfare Committee of Yangzhou University (permit number: SYXK (Su) IACUC 2012-0029), and all efforts were made to minimize the suffering of the chickens.

Tissue Collection

The animals were slaughtered on the seventh day after infection, and the spleen and cecal tissues of all chickens in the infected and uninfected groups were collected in a cryotube, immediately stored in liquid nitrogen, and then transferred to a freezer for storage at −70°C.

RNA Isolation and Quality Assessment

Total RNA from chicken tissues was isolated using the TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. A NanoPhotometer spectrophotometer (Implen, Inc., Westlake Village, CA) was used to assess the optical density value (A260/A280) of the total RNA. RNA integrity was assessed using an RNA Nano 6000 Assay Kit with a Bioanalyzer 2100 system (Agilent Technologies, Santa Clara, CA). RNA degradation was monitored with 1% agarose gels. Qualified RNA samples were diluted to 100 ng/μL and stored at −70°C.

Primer Design and qRT-PCR Performance

Based on the published chicken IL-6, IL-8, and CCLi2 gene sequences in GenBank (https://www.ncbi.nlm.nih.gov/genbank/), qRT-PCR primers for the 3 target genes were designed using the Primer Premier 5 software (PREMIER Biosoft, Palo Alto, CA). The reference genes GAPDH and β-actin were used as previously described (Fang, 2012). All primers were synthesized by Sangon Biotech Co. (Shanghai, China), and the primer information is presented in Table 1.

Table 1.

Quantitative real-time PCR primers used in this study.

Gene amplified Primer name Primer sequence (5'→3′) Amplification size (bp) GenBank accession no.
IL-6 F CAAGGTGACGGAGGAGGAC 254 AJ309540
R TGGCGAGGAGGGATTTCT
IL-8 F GGCTTGCTAGGGGAAATGA 136 AJ009800
R AGCTGACTCTGACTAGGAAACTGT
CCLi2 F GGCAGACTACTACGAGACCAACAG 70 L34553
R ACGGCCCTTCCTGGTGAT
GAPDH F GGTGGTGCTAAGCGTGTTAT 264 K01458
R ACCTCTGTCATCTCTCCACA
β-actin F ACACGGTATTGTCACCAACT 263 L08165
R TAACACCATCACCAGAGTCC

cDNA Synthesis

The extracted total RNA was reverse transcribed with PrimeScript RT Master Mix (Takara Bio Inc, Otsu, Japan) according to the manufacturer's instructions, and reverse transcription was carried out in a final volume of 40 μL assembled on ice containing 8 μL of 5 × PrimeScript RT Master Mix, 2000 ng of RNA template, and RNase-free ddH2O added to 40 μL. The reaction conditions were 37°C for 15 min and 85°C for 5 s. The samples were stored at −20°C.

Quantitative Real-Time PCR

Fluorescence quantitative analysis was performed using the SYBR Green I dye method (Bio-Rad Co., Hercules, CA) with a total volume of 20 μL, which contained 10 μL of SYBR Premix Ex Taq II (Tli RNaseH Plus), 0.8 μL each of upstream and downstream primer, 0.4 μL of ROX Reference Dye Ⅱ dye, 2 μL of cDNA template, and ddH2O added to 20 μL.

qRT-PCR was carried out as follows: preliminary denaturation at 94°C for 30 s, followed by 40 cycles of denaturation for 5 s at 95°C and annealing for 34 s at 60°C. Data at multiple points were collected for dissolution curve analysis, and the procedure was as follows: 95°C for 15 s; 60°C for 1 min; and 95°C for 15 s and 60°C for 15 s. Each sample was analyzed in triplicate.

Statistical Analysis

We used the 2−ΔΔCt method (Livak and Schmittgen, 2001, Adnan et al., 2011) to analyze the qRT-PCR results. SPSS 25.0 was used for correlation analysis of the relative expression of the target genes in different tissues.

Results

RNA Isolation Results

The extracted RNA was monitored with formaldehyde-denatured agarose gel electrophoresis, and the results showed that the 28S and 18S bands of the total RNA samples were bright, clear, and sharp. The image is shown in Figure 1. We used a UV spectrophotometer to assess the extracted RNA. The A260/A280 value of the RNA sample was found to be between 1.8 and 2.0, suggesting that the extracted RNA had a high purity and could be used for the next step of the experiment.

Figure 1.

Figure 1

Agarose gel electrophoresis image of the total RNA. The marker used here was the DL15,000 DNA marker. Electrophoretic profiles showed the extracted RNA from 6 chickens selected randomly.

Differences in IL-6, IL-8, and CCLi2 Gene Expression in the Spleen and Cecum of the Infection and Control Groups

As shown in Figure 2A, the IL-6, IL-8, and CCLi2 genes were all expressed in the spleen and cecal tissues of Jinghai yellow chickens in the infection and control groups. In the spleen tissues, the relative expression levels of the IL-6, IL-8, and CCLi2 genes in the infected group were all significantly higher than those in the control group (P < 0.05), and the relative expression level of the IL-6 gene in the infected group was extremely significantly different from that in the control group (P < 0.01). In the cecal tissues, the relative expression levels of the IL-6, IL-8, and CCLi2 genes of the infected group were all extremely significantly different from those of the control group (P < 0.01).

Figure 2.

Figure 2

Comparison of the expression of the IL-6, IL-8, and CCLi2 genes between the spleen and cecum of the Jinghai yellow chickens in the infected group and the control group. *Indicates a significant difference (P < 0.05) and **indicates an extremely significant difference (P < 0.01). (A) A comparison of the relative expression of genes in different groups in the same tissue. (B) A comparison of the relative expression of genes in different tissues in the same group. CCLi2, C-C motif chemokine ligand 2.

As shown in Figure 2B, the relative expression levels of other genes were significant or extremely significant in both the control group and the infected group (P < 0.05 or P < 0.01), while the relative expression levels of IL-6 in the spleen and cecum of the controls were not significant (P > 0.05). Moreover, the relative expression levels of each gene in the cecum were higher than those in the spleen.

Correlation Analysis of IL-6, IL-8, and CCLi2 Gene Expression in the Spleen and Cecal Tissues

As shown in Table 2, the expression levels of the IL-6, IL-8, and CCLi2 genes in the spleen and cecal tissues were all positively correlated in both the infection group and the control group. In the spleen tissues of the control group, the relative expression levels of the IL-8 and IL-6 genes did not show a significant positive correlation (P > 0.05), but there was an extremely significant positive correlation (P < 0.01) between the relative expression of IL-8 and IL-6 and that of CCLi2; in the spleen tissues of the infected group, the correlation coefficient between the expression of IL-6 and IL-8 was positive (P < 0.01), and extremely significantly positive correlations were found between the expression of IL-6 and IL-8 and that of CCLi2 (P < 0.01). In the cecal tissues of the control group, there were extremely significant positive correlations (P < 0.01) between the relative expression of IL-8 and CCLi2 and that of IL-6, and the relative expression levels of the IL-8 and CCLi2 genes were also significantly correlated (P < 0.05); in the cecal tissues of the infected group, there were extremely significant positive correlations (P < 0.01) between the relative expression of IL-8 and CCLi2 and that of IL-6, but the relative expression correlation between IL-8 and CCLi2 genes were not significantly correlated (P > 0.05).

Table 2.

Correlation analysis of the expression of the 3 genes in the spleen and cecal tissues of the infected and control groups1.

Genes IL-6 IL-8 CCLi2
IL-6 1 (1) 0.475** (0.639**) 0.579** (0.469**)
IL-8 0.261 (0.667**) 1 (1) 0.890** (0.324)
CCLi2 0.853** (0.498**) 0.996** (0.765**) 1 (1)

*Significant correlation (P < 0.05), **extremely significant correlation (P < 0.01), and “no superscript designator” indicates no significant correlation (P > 0.05).

1

The correlation coefficients above and below the diagonal are based on the infected group and the control group, respectively. The data in brackets are correlation coefficients of expression of the 3 genes in the cecum.

Correlation Analysis of IL-6, IL-8, and CCLi2 Gene Expression in the Spleen and Cecal Tissues

The correlations of the relative expression of the 3 genes were determined in the spleen vs. the cecum of the infected group (Table 3). The results showed that there was no significant positive correlation (P > 0.05) between the relative expression of IL-6, IL-8, and CCLi2 in the spleen and that of IL-6 in the cecum, and the relative expression of IL-8 and CCLi2 in spleen and that of IL-8 in cecum were not significantly negatively correlated (P > 0.05). The relative expression of IL-6 in the spleen and that of IL-8 in the cecum were not significantly negatively correlated (P > 0.05), and the relative expression levels of IL-6, IL-8, and CCLi2 in the spleen were not significantly negatively correlated with CCLi2 in the cecum (P > 0.05). The correlations among the relative expression levels of the 3 genes in the spleen and the same genes in the cecum of the control group were examined, and we found that the expression levels of the IL-6, IL-8, and CCLi2 genes were not significantly correlated (P > 0.05) between the spleen and cecal tissues. Moreover, in the control group, only the CCLi2 gene in the cecum had no significant positive correlation with IL-8 and CCLi2 in the spleen (P > 0.05), and there was no significant negative correlation between the other genes (P > 0.05).

Table 3.

Correlation analysis of the expression of the 3 genes in the spleen and cecum of the infected and control groups.

Cecum Spleen in the infection group
Spleen in the control group
IL-6 IL-8 CCLi2 IL-6 IL-8 CCLi2
IL-6 +0.091 +0.062 +0.297 −0.284 −0.146 −0.113
IL-8 −0.014 +0.169 +0.203 −0.380 −0.101 −0.067
CCLi2 −0.162 −0.110 −0.023 −0.442 +0.194 +0.207

+ indicates a positive correlation; – indicates a negative correlation. There are no significant correlations (P < 0.05).

Discussion

Chickens have no lymph nodes, only primitive lymphoid tissues, and the cecal tonsils and spleens play a dominant role in the immune response. Moreover, T lymphocytes in the spleens of chickens show proliferation and immune functions from 4 D of age and have perfected these functions at 30 D of age (Luan et al., 2008). The main target of E. tenella is in the cecum, and the spleen is an important immune organ in chickens (Jarosinski et al., 2005, Guo et al., 2013). Therefore, we selected chicks aged 30 D and detected the relative expression of 3 genes in the spleen and cecum on the seventh day after oral feeding of E. tenella to explore the correlations between these 3 genes and coccidiosis infection in chickens.

Many studies have shown that the relative expression levels of IL-6, IL-8, and CCLi2 are higher in infectious conditions than in noninfectious conditions after challenge with different pathogens (Sadeyen et al., 2004, Kim et al., 2008, Fernando et al., 2015). E. tenella can strongly induce an immune response and increase IL-8 expression in the cecum (Cornelissen et al., 2009). The transcripts of IL-6 were increased up to 2020-fold after primary E. tenella infection. These results are consistent with our current data; meanwhile, we also observed that in the cecal tissue, the expression of IL-6 was the highest in the infected group, higher than that of IL-8, and CCLi2 showed the lowest expression. The same pattern was observed in the spleen.

The body's defense tends to function as a whole, and thus, the interaction between immune factors is very important in pathogen infection. Baron et al. (2015) suggested that synergistic expression of IL-8 and IL-6 contributes to disease recovery and resistance to pathogens. Kogut et al. (2003) confirmed that the mRNA expression of IL-6 and IL-8 was significantly upregulated in chickens after Salmonella infection, and IL-6 expression was significantly positively correlated with IL-8. Kim et al. (2008) clearly state that coexpression of IL-6 and IL-8 was associated with enhanced resistance to Eimeria maxima infection in chickens. CCLi2 could promote the secretion of the anti-inflammatory cytokines IL-4 and IL-6 (Luther and Cyster, 2001). In this study, the expression levels of IL-6, IL-8, and CCLi2 in the spleen or cecum were all positively related, either in the infection or the control group. Swaggerty et al. (2015) developed a novel selection method based on the identification and selection of chickens with an inherently high and low phenotype of proinflammatory mediators, such as IL-6, IL-8, and CCLi-2. The results showed that the positive synergistic effect of the 3 genes increased the resistance to pathology associated with coccidial infections compared with the low-line birds. Swaggerty et al. (2004) also found that the expression of IL-6 and IL-8 in chickens with resistance to Salmonella was higher than that in susceptible chickens and that most of the resistant chickens had a strong positive correlation between IL-6 and IL-8 gene expression. Similarly, in the spleen tissue of this study, the expression of CCLi2 was strongly correlated with IL-6 and IL-8 in the uninfected group and also with IL-8 in the infected group. Another study by Laurent et al. (2001) found that the mRNA expression of the proinflammatory cytokines IL-8 and CCLi2 was upregulated in the cecum of chickens starting at 3 to 4 D after infection with E. tenella. In our study, the expression levels of the 3 genes in the cecal tissues were moderately correlated in the uninfected group. The expression of IL-6 was positively moderately correlated with IL-8 and CCLi2 in the infected group. In addition, the expression levels of the 3 genes were not correlated between the spleen and cecal tissues, either in the infection or the control group. We speculate that this may be because the regulatory mechanisms of the expression of the 3 genes are different in different organs. In conclusion, the expression levels of IL-6, IL-8, and CCLi2 are all correlated with each other in the spleen and cecum. The findings of this study can enhance our understanding of the expression relationships of immune-related genes and provide a basis for genetic breeding strategies of coccidiosis resistance.

Acknowledgements

This research was supported by the earmarked fund for Jiangsu Agricultural Industry Technology System (JATS[2019]449), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), and the China Agriculture Research System (CARS-41-G23).

References

  1. Adnan M., Morton G., Hadi S. Analysis of rpoS and bolA gene expression under various stress-induced environments in planktonic and biofilm phase using 2(-DeltaDeltaCT) method. Mol. Cell. Biochem. 2011;357:275–282. doi: 10.1007/s11010-011-0898-y. [DOI] [PubMed] [Google Scholar]
  2. Baron V.T., Pio R., Jia Z., Mercola D. Early growth response 3 regulates genes of inflammation and directly activates IL6 and IL8 expression in prostate cancer. Br. J. Cancer. 2015;112:755–764. doi: 10.1038/bjc.2014.622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Blake D.P., Tomley F.M. Securing poultry production from the ever-present Eimeria challenge. Trends Parasitol. 2014;30:12–19. doi: 10.1016/j.pt.2013.10.003. [DOI] [PubMed] [Google Scholar]
  4. Coussens L.M., Werb Z. Inflammation and cancer. Nature. 2002;420:860–867. doi: 10.1038/nature01322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cornelissen J.B.W.J., Swinkels W.J.C., Boersma W.A., Rebel J.M.J. Host response to simultaneous infections with Eimeria acervulina, maxima and tenella: a cumulation of single responses. Vet. Parasitol. 2009;162:58–66. doi: 10.1016/j.vetpar.2009.02.001. [DOI] [PubMed] [Google Scholar]
  6. Fang Q. Yangzhou University; Yangzhou, China: 2012. Cloning and Sequence Analysis of Avian Toll-like Receptors Genes and the Differences of Innate Immunity in Different Chicken Lines against Salmonella Infection. Master thesis. [Google Scholar]
  7. Fernando F.S., Okino C.H., Silva K.R., Fernandes C.C., Gonçalves M.C.M., Montassier M.F.S., Vasconcelos R.O., Montassier H.J. Increased expression of interleukin-6 related to nephritis in chickens challenged with an avian infectious bronchitis virus variant. Pesqui. Vet. Bras. 2015;35:216–222. [Google Scholar]
  8. Grimm M.C., Elsbury S.K., Pavli P., Doe W.F. Interleukin 8: cells of origin in inflammatory bowel disease. Gut. 1996;38:90–98. doi: 10.1136/gut.38.1.90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Guo A., Cai J., Gong W., Yan H., Luo X., Tian G., Zhang S., Zhang H., Zhu G., Cai X. Transcriptome analysis in chicken cecal epithelia upon infection by Eimeria tenella in vivo. PLoS One. 2013;8:e64236. doi: 10.1371/journal.pone.0064236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Jarosinski K.W., Njaa B.L., O'Connell P H., Schat K.A. Pro-inflammatory responses in chicken spleen and brain tissues after infection with very virulent plus marek's disease virus. Viral Immunol. 2005;18:148–161. doi: 10.1089/vim.2005.18.148. [DOI] [PubMed] [Google Scholar]
  11. Kogut M.H., Rothwell L., Kaiser P. Differential regulation of cytokine gene expression by avian heterophils during receptor-mediated phagocytosis of opsonized and nonopsonized Salmonella enteritidis. J. Interferon Cytokine Res. 2003;23:319–327. doi: 10.1089/107999003766628160. [DOI] [PubMed] [Google Scholar]
  12. Kim D.K., Lillehoj H.S., Hong Y.H., Park D.W., Lamont S.J., Han J.Y., Lillehoj E.P. Immune-related gene expression in two B-complex disparate genetically inbred Fayoumi chicken lines following Eimeria maxima infection. Poult. Sci. 2008;87:433–443. doi: 10.3382/ps.2007-00383. [DOI] [PubMed] [Google Scholar]
  13. Laurent F., Mancassola R., Lacroix S., Menezes R., Naciri M. Analysis of chicken mucosal immune response to Eimeria tenella and Eimeria maxima infection by quantitative reverse transcription-PCR. Infect. Immun. 2001;69:2527–2534. doi: 10.1128/IAI.69.4.2527-2534.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Li G.Q., Kanu S., Xiao S.M., Xiang F.Y. Responses of chickens vaccinated with a live attenuated multi-valent ionophore-tolerant Eimeria vaccine. Vet. Parasitol. 2005;129:179–186. doi: 10.1016/j.vetpar.2004.09.034. [DOI] [PubMed] [Google Scholar]
  15. Lillehoj H.S., Lillehoj E.P. Avian coccidiosis. A review of acquired intestinal immunity and vaccination strategies. Avian Dis. 2000;44:408–425. [PubMed] [Google Scholar]
  16. Lin Y.X. Yangzhou Univ.; Yangzhou, China: 2015. RNA Sequencing Analysis of Chicken Cecum Tissues Following Eimeria tenella Infection and Coccidiosis Evaluation of Jinghai Yellow Chicken Cross-Breeding System Parents. Master thesis. [Google Scholar]
  17. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  18. Luan W.M., Yang S.B., Yang L.H., Zhang Y.L., Gao J.J., He Z.Y. Development of T lymphocyte subpopulations in chicken spleen. Chin. J. Vet. Sci. 2008;28:33–34. [Google Scholar]
  19. Luther S.A., Cyster J.G. Chemokines as regulators of T cell differentiation. Nat. Immunol. 2001;2:102–107. doi: 10.1038/84205. [DOI] [PubMed] [Google Scholar]
  20. Mahad D., Callahan M.K., Williams K.A., Ubogu E.E., Kivisakk P., Tucky B., Kidd G., Kingsbury G.A., Chang A., Fox R.J., Mack M., Sniderman M.B., Ravid R., Staugaitis S.M., Stins M.F., Ransohoff R.M. Modulating CCR2 and CCL2 at the blood-brain barrier: relevance for multiple sclerosis pathogenesis. Brain. 2005;129:212–223. doi: 10.1093/brain/awh655. [DOI] [PubMed] [Google Scholar]
  21. Min W., Lillehoj H.S., Burnside J., Weining K.C., Staeheli P., Zhu J.J. Adjuvant effects of IL-1beta, IL-2, IL-8, IL-15, IFN-alpha, IFN-gamma TGF-beta4 and lymphotactin on DNA vaccination against Eimeria acervulina. Vaccine. 2001;20:267–274. doi: 10.1016/s0264-410x(01)00270-5. [DOI] [PubMed] [Google Scholar]
  22. Neurath M.F., Finotto S. IL-6 signaling in autoimmunity, chronic inflammation and inflammation-associated cancer. Cytokine Growth Factor Rev. 2011;22:83–89. doi: 10.1016/j.cytogfr.2011.02.003. [DOI] [PubMed] [Google Scholar]
  23. Nishimichi N., Kawashima T., Hojyo S., Horiuchi H., Furusawa S., Matsuda H. Characterization and expression analysis of a chicken interleukin-6 receptor alpha. Dev. Comp. Immunol. 2006;30:419–429. doi: 10.1016/j.dci.2005.05.007. [DOI] [PubMed] [Google Scholar]
  24. O'Connor T., Borsig L., Heikenwalder M. CCL2-CCR2 signaling in disease pathogenesis. Endocr. Metab. Immune Disord. Drug Targets. 2015;15:105–118. doi: 10.2174/1871530315666150316120920. [DOI] [PubMed] [Google Scholar]
  25. Qian B.Z., Li J., Zhang H., Kitamura T., Zhang J., Campion L.R., Kaiser E.A., Snyder L.A., Pollard J.W. CCL2 recruits inflammatory monocytes to facilitate breast-tumour metastasis. Nature. 2011;475:222–225. doi: 10.1038/nature10138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Rose-John S., Winthrop K., Calabrese L. The role of IL-6 in host defence against infections: immunobiology and clinical implications. Nat. Rev. Rheumatol. 2017;13:399–409. doi: 10.1038/nrrheum.2017.83. [DOI] [PubMed] [Google Scholar]
  27. Sadeyen J.R., Trotereau J., Velge P., Marly J., Beaumont C., Barrow P.A., Bumstead N., Lalmanach A.C. Salmonella carrier state in chicken: comparison of expression of immune response genes between susceptible and resistant animals. Microbes Infect. 2004;6:1278–1286. doi: 10.1016/j.micinf.2004.07.005. [DOI] [PubMed] [Google Scholar]
  28. Savage S.A., Abnet C.C., Mark S.D., Qiao Y.L., Dong Z.W., Dawsey S.M., Taylor P.R., Chanock S.J. Variants of the IL8 and IL8RB genes and risk for gastric cardia adenocarcinoma and esophageal squamous cell carcinoma. Cancer Epidemiol. Biomarkers Prev. 2004;13:2251–2257. [PubMed] [Google Scholar]
  29. Schett G., Elewaut D., McInnes I.B., Dayer J.M., Neurath M.F. How cytokine networks fuel inflammation: toward a cytokine-based disease taxonomy. Nat. Med. 2013;19:822–824. doi: 10.1038/nm.3260. [DOI] [PubMed] [Google Scholar]
  30. Sharman P.A., Smith N.C., Wallach M.G., Katrib M. Chasing the golden egg: vaccination against poultry coccidiosis. Parasite Immunol. 2010;32:590–598. doi: 10.1111/j.1365-3024.2010.01209.x. [DOI] [PubMed] [Google Scholar]
  31. Swaggerty C.L., Kogut M.H., Ferro P.J., Rothwell L., Pevzner I.Y., Kaiser P. Differential cytokine mRNA expression in heterophils isolated from salmonella-resistant and-susceptible chickens. Immunology. 2004;113:139–148. doi: 10.1111/j.1365-2567.2004.01939.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Swaggerty C.L., Pevzner I.Y., Kogut M.H. Selection for pro-inflammatory mediators produces chickens more resistant to Eimeria tenella. Poult. Sci. 2015;94:37–42. doi: 10.3382/ps/peu053. [DOI] [PubMed] [Google Scholar]
  33. Wang X., Zou W., Yu H., Lin Y., Dai G., Zhang T., Zhang G., Xie K., Wang J., Shi H. RNA sequencing analysis of chicken cecum tissues following Eimeria tenella infection in vivo. Genes (Basel) 2019;10:E420. doi: 10.3390/genes10060420. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES