Skip to main content
BioMed Research International logoLink to BioMed Research International
. 2020 Oct 16;2020:5465439. doi: 10.1155/2020/5465439

Assessment of the Antibacterial Effects of Bismuth Nanoparticles against Enterococcus faecalis

Azita Azad 1, Sahar Rostamifar 2, Farzan Modaresi 3,✉, Ali Bazrafkan 2, Zahra Rezaie 4
PMCID: PMC7603547  PMID: 33150176

Abstract

Introduction

Enterococcus faecalis (E. faecalis) is the most important species in dentistry and plays a significant role in the etiology of persistent apical lesions after root canal treatment. Up to date, the intracanal application of 2% chlorhexidine for 7 days is the best way to eliminate E. faecalis. However, due to the ability of this bacterium to persist and survive in harsh environments, many studies have been directed towards finding an alternative strategy for prevention or eradication of it. This study was conducted to investigate the effect of bismuth nanoparticles on E. faecalis, as an etiologic factor in recurrent root canal infections.

Methods

Forty patients, referred to Endodontic Ward of Shiraz University of Medical Science for endodontic pretreatment, provided root canal samples. First, all samples were transferred in Enterococcosel broth and incubated. Then, samples which showed growth were plated on blood agar plates and incubated for further PCR procedure. Nanoparticle powder was dissolved in high-purity water, and the final concentration of bismuth nanoparticles (BiNPs) was measured by the spectrophotometer. Minimum inhibitory concentration (MIC) of BiNPs against E. faecalis was determined by microbroth dilution method according to methods for antimicrobial susceptibility tests. Also, bactericidal assays were conducted in Mueller-Hinton broth medium and reported as the concentration of BiNPs that reduced the viable bacterial count by 99.9%.

Results

Of all samples, 77.5% revealed the presence of E. faecalis by PCR. Also, E. faecalis growth inhibition was observed at concentrations ranging from 0.625 μg/ml to 20 μg/ml (geometric mean: 2.337 μg/ml), and the MBC values were between 1.25 μg/ml and 40 μg/ml (geometric mean: 4.781 μg/ml), which in comparison with chlorhexidine, these values were about one-eighth of chlorhexidine.

Conclusion

The experimental data suggest that bismuth nanoparticles could be an interesting alternative to combat E. faecalis, which, in view of the advantages mentioned for bismuth nanoparticle like inhibiting Streptococcus mutans biofilm formation and higher antibacterial activity compared to chlorhexidine, can be suggested to be used in different fields of dentistry.

1. Introduction

Enterococcus faecalis as a member of Enterococcus genus is a Gram-positive, facultative anaerobe that most commonly found as the commensal in the gastrointestinal tract (including the oral cavity) and the urogenital system. Of all Enterococci species, E. faecalis is the most important species in dentistry due to their role in dental diseases, including endodontic infections, periodontitis, and dental caries [1, 2]. In this regard, studies have shown a significant association of E. faecalis with the occurrence of endodontic treatment failures [3]. Unlike primary intraradicular infections, which are polymicrobial and predominated by Gram-negative anaerobic rods, the organisms involved in secondary infections are limited to one or a few bacterial species [4]. E. faecalis is a persistent microorganism that, in spite of making a small part of the flora in untreated canals, plays an important role in the etiology of persistent apical lesions after root canal treatment. It is usually found in a high percentage of endodontic failures and it can remain alive in the root canal as a single microorganism or as a main constituent of the flora [4]. The presence of E. faecalis is associated with different forms of endodontic infection, such as primary and persistent endodontic infections. In primary infections, it is more often found in asymptomatic chronic periradicular lesions than in acute periradicular periodontitis or abscesses. It is isolated in 4 to 40% of primary endodontic infections, while its frequency in teeth with failed treatment is nine times more [5]. Studies using culture methods for isolation of Enterococci in secondary endodontic infections reported a prevalence between 24 and 77%, whilst using a PCR method results in an isolation rate ranging from 67 to 77% [6], so the molecular methods can be a benefit in this regard due to their high sensitivity and accuracy, among which multiplex polymerase chain reaction (PCR) is one of the latest [7]. Indeed, E. faecalis can be one of the substantial factors in root canal treatment failures, and its presence at the time of obturation might significantly reduce the treatment success rates [8]. Its pathogenicity primarily relies upon its survival and persistence in the root canals, although it has additional virulence factors, such as the ability to attach and forms biofilm on host surfaces [9]. Many studies have investigated different endodontic medicaments and irrigant to eradicate and/or prevent E. faecalis from gaining access to the root canal system during treatment. For instance, 3% to full-strength sodium hypochlorite can destroy E. faecalis, including its existence as a biofilm [10]. EDTA and 10% citric acid solution have a little antibacterial effect against E. faecalis activity; however, they have the capability to remove the inorganic part of the smear layer, allowing other irrigants to reach to the dentinal tubules [11]. Also, MTAD, a new root canal irrigant consisting of a mixture of tetracycline, an acid, and detergent, has demonstrated a promising ability to eradicate E. faecalis [12]. Likewise, 2% chlorhexidine gel or liquid is effective in eliminating E. faecalis from superficial layers and dentinal tubules, which may be assigned to substantive antimicrobial effect [13]. Other irrigants which showed to be effective at eliminating E. faecalis include stannous fluoride and ozonated water [14]. On the other hand, calcium hydroxide, a commonly used intracanal medicament, showed to be almost ineffective against these bacteria [15]. Furthermore, the antibacterial activities of several sealers have also been examined against E. faecalis, with Roth 811, a zinc oxide eugenol-based sealer, having the strongest inhibitory effects [16]. Until further investigations, the intracanal application of 2% chlorhexidine for 7 days is reported to be the best way to eliminate E. faecalis [17, 18]. However, due to the ability of this bacterium to persist and survive in harsh environments as well as the emerging resistance among Enterococcus spices, many studies have been directed towards finding an alternative strategy for prevention or eradication of E. faecalis from the root canal system [1]. Amongst these strategies, nanoparticles, typically 0.2–100 nm in size, showed good results as novel antimicrobial agents. Their privilege might be due to their high surface-to-volume ratio, which increases the interactions between these particles and microorganisms, improving their inhibitory effects [19]. Also, the differences in size and surface area between these particles and conventional antimicrobial agents can reduce the chance of developing resistance [19]. Up to now, the metals most frequently used for biomedical applications include gold, titanium, silver, copper, zinc, magnesium, and bismuth [20]. Bismuth (Bi) is a diamagnetic, crystalline, and brittle metal of the VA group, typically found as bismuth sulfide, bismuth oxide, and bismuth carbonate [21]. Studies have shown that bismuth derivatives and its nanoparticulate forms inhibit Helicobacter pylori growth by altering their Krebs cycling, amino acid, and nucleotide metabolisms, and they can be used as an antidiarrheal agent to treat nausea, vomiting, and stomach pain [22]. Additionally, it was reported that BiNPs exhibited antibacterial and antifungal activities at concentrations lower than 1 mM and 2 mM, respectively [23, 24]. Also, they can interfere with the biofilm formation of S. mutans, the main etiological agent of dental decays [23]. However, bismuth nanoscale particles' potential for application in dentistry has not been extensively studied, and the present study was conducted to investigate the effect of BiNPs on the standard strain and clinical isolates of E. faecalis, as an etiologic factor in recurrent root canal infections.

2. Methods

2.1. Sample Taking

Forty patients, ages from 18 to 45 years old, including 22 males and 18 females, referred to Endodontic Ward of Shiraz University of Medical Science for endodontic pretreatment, provided root canal samples, which were then analyzed for the presence of E. faecalis. All samples were obtained from patients who had rooted canal therapy completed more than 1 year ago. Patients who were pregnant, diabetic, smoker, and those requiring pretreatment due to missing canals, broken instruments, perforations, ledges, or calcified root canals were excluded. None of the selected teeth have termini of the root canal filling more than 5 mm short in radiographic findings and periodontal pockets deeper than 4 mm. After supragingival scaling and isolation with a rubber dam, samples were taken by one of the authors as previously described by Gomes et al. [13]. The tooth and the adjacent field were decontaminated with a 2.5% sodium hypochlorite for 30 s each and then inactivated with 5% sodium thiosulfate. As the previous restorations were removed and the access cavities prepared, the pulp chambers were disinfected with 5.25% sodium hypochlorite, and the obturation materials were removed with ProTaper nickel-titanium rotary instruments SX-F2 (WNT, India) under irrigation with sterile saline. The microbial samples were collected by inserting two sterile paper points into the working length of the canal and keeping them in place for 60 s. The debris on the paper points were transferred into sterile 2 ml Eppendorf tubes containing viability medium Gotenberg agar III transport medium and evaluated immediately within 2 hrs. After shaking the samples in a mixer for 60 s (Vortex, Scientific Industries Inc., Springfield, MA), 1 ml of each sample were used for culture, and the other 1 ml were frozen at −20°C for by PCR procedures [13]. Additionally, a standard strain of E. faecalis (ATCC 51299) obtained from the American Type Culture Collection was studied.

The study was approved by the Ethics Committee of Shiraz University of Medical Science (96-01-03-14924). Patients were informed of the study procedures and goals, and written consent was obtained.

2.2. Culture and Identification Procedures

First, all samples were transferred into Enterococcosel broth (HiMedia, India) and incubated for 72 h at 35°C. Then, samples which showed growth were plated on blood agar plates (Plast Labor, Rio de Janeiro, RJ, Brazil) and incubated at 35°C for further usages [8].

2.3. PCR Procedures

One-milliliter aliquots from positive cultures in Enterococcosel broth (HiMedia, India) were transferred to microtubes, and DNA was extracted by boiling as described by Siqueira and Rocas (2004). Gene that encode for 16S rRNA of E. faecalis was targeted. The entire PCR products were loaded into 1% agarose (Cinnagen, Tehran, Iran) gel and electrophoresed (Akhtarian, Tehran, Iran) for 1-1.5 h in the 1 × TAE buffer along with a molecular weight marker. After staining with ethidium bromide (Merck), the DNA bands were visualized under UV illumination (UVP Gel Documentation, Upland, CA, USA), and the prevalence of E. faecalis was reported as the percentage of cases investigated. Primer sequence and PCR condition used for identification of E. faecalis is shown in Table 1 [25].

Table 1.

Oligonucleotide used in this study for identification of Enterococcus faecalis by PCR [25].

Target DNA Sequence of primer (5′-3′) Condition Amplicon size (pb)
16S rRNA GTTTATGCCGCATGGCATAAGA G CCGTCAGGGGACGTTCAG 95°C -2 min; 36 cycles (95°C -30 s; 60°C -60 s; 72°C 60 s) and 72°C -2 min 310

2.4. Preparation and Characterization of BiNP Solution

Eight milligrams of nanoparticle powder (Nano Scientific Co, USA) were dissolved in 200 ml of high-purity water and sonicated (Biometra, Germany) for 20 minutes at 900 watts. The sonicated solution was sterilized by passing through a 0.2 μm filter (Control Biogene, Spain), and the final concentration of BiNPs was measured by the spectrophotometer (Eppendrof, Germany). The shape, size, and distribution of synthesized BiNPs have been characterized by the high-resolution transmission electron microscopy (TEM) with a JEM 1011 microscope (JEM-1011 “JEOL LTD,” Japan).

2.5. Bacterial Suspension

Overnight grown cultures of E. faecalis strains in TSA broth (HiMedia, India) at 37°C were centrifuged at 6000 rpm for 4 min (Eppendrof, Germany), and the supernatants were discarded. The collected cells were washed twice with sterile distilled water. Subsequently, the cells were suspended in 5 ml of TSA broth and incubated for 4 h at 37°C, and their concentrations were adjusted to match the turbidity of 0.5 McFarland using a spectrophotometer.

2.6. Antimicrobial Susceptibility Testing

Minimum inhibitory concentration (MIC) of BiNPs against E. faecalis was determined by microbroth dilution method according to methods for antimicrobial susceptibility tests for bacteria that grow aerobically, 11th edition. Starter cultures of E. faecalis were grown at 35°C for 4 h at 200 rpm and used to make 0.5-McFarland standard suspensions, which were further diluted at a ratio of 1 : 100 (5 × 105 CFU/ml) in Mueller-Hinton broth medium (HiMedia, India). In brief, 10 μl of bacterial inoculum was added to Mueller-Hinton broth medium containing 100 μl of serial dilutions of BiNPs in the wells of microtiter plates (Cinnagen, Tehran, Iran). The final concentration of BiNPs ranged from 40 to 1 μg/ml. One hundred microliters of culture medium with 10 μl of the bacterial inoculum without BiNPs was used as a negative control group. Also, chlorhexidine 2% (Oral-B, USA) ranging from 100 to 1 μl/ml was used as the positive control. The plates were incubated at 37°C for 24 h, and the minimum inhibitory concentrations were visually determined and represented as the lowest concentration of the BiNPs that inhibited the bacterial growth as compared with control groups. Each experiment was performed in triplicate. Also, bactericidal assays were conducted in a Mueller-Hinton broth medium. Minimal bactericidal concentrations were reported as the concentration of BiNPs that reduced the viable bacterial count by 99.9% at 24 h of incubation. Viable bacterial counts were determined by standard plating on Mueller-Hinton agar media [26].

3. Results

3.1. Identification of E. faecalis by PCR Procedure

Forty adult patients consisted of 22 men and 18 women with a mean age of 30.175 (range from 18 to 45 years) were provided samples in the study. Thirty-one out of 40 samples (77.5%) revealed the presence of E. faecalis by PCR identification technique loaded into 1% agarose electrophoresis gel (Figure 1). However, eleven root canal samples (22.5%) showed no growth of bacteria. Details regarding subjects were presented in Table 2.

Figure 1.

Figure 1

Electrophoresis of E. faecalis 16S rRNA gene on 1% agarose gel. The target gene was of 310 bp. Lane 1: control positive. Lanes 2–16: PCR product of 16S rRNA gene (310 bp); ladder: 100 bp DNA size marker.

Table 2.

Characteristics of the patients and presence of E. faecalis.

Patient no. Age (year) Gender (M/F) Presence of E. faecalis Patient no. Age (year) Gender (M/F) Presence of E. faecalis
1 19 M + 21 43 F +
2 29 F + 22 31 M +
3 20 M + 23 30 M +
4 41 M - 24 28 F -
5 22 F + 25 20 F +
6 18 F + 26 45 M +
7 45 F - 27 45 M +
8 40 M + 28 33 F -
9 33 M + 29 20 M +
10 30 M + 30 29 M +
11 32 M + 31 30 F +
12 39 M + 32 36 F +
13 19 F - 33 37 F +
14 27 M - 34 20 M +
15 21 F + 35 19 M -
16 35 M + 36 24 F -
17 19 F + 37 34 M +
18 37 F + 38 31 M +
19 26 M - 39 24 F +
20 36 M + 40 40 F +

3.2. BiNPs Characterization

Water dispersion of BiNPs has been produced with the aim of their antimicrobial activity estimation against E. faecalis. By transmission electron microscopy, it has been found that nanoparticles have an average particles' size of 40 nm with spherical form (Figure 2).

Figure 2.

Figure 2

High-resolution transmission electron microscopic image of an isolated bismuth nanoparticles performed by JEOL Jem 1011 Electron Microscope.

3.3. Antimicrobial Susceptibility Testing

To explore the possible antibacterial activity of bismuth nanoparticles, their effect on E. faecalis growth was determined. The results showed E. faecalis growth inhibition at concentrations ranging from 0.625 μg/ml to 20 μg/ml (geometric mean: 2.337 μg/ml). Also, the MBC values were between 1.25 μg/ml and 40 μg/ml (geometric mean: 4.781 μg/ml). Regarding the standard strain of E. faecalis, the MIC and MBC values of BiNPs were 5 μg/ml and 10 μg/ml, respectively. This was while the MIC and MBC values of chlorhexidine were recorded as 40 μl/ml and 80 μl/ml. Table 3 shows the MIC and MBC value of all tested isolates towards BiNPs.

Table 3.

MIC and MBC values of BiNPs against E. faecalis.

Patient no. Presence of E. faecalis The MIC of BiNP (μg/ml) MBC of BiNP Patient no. Presence of E. faecalis The MIC of BiNP (μg/ml) MBC of BiNP
1 + 2.5 5 21 + 1.25 2.5
2 + 5 10 22 + 5 10
3 + 1.25 2.5 23 + 5 5
4 - - - 24 - - -
5 + 2.5 5 25 + 2.5 5
6 + 5 5 26 + 1.25 5
7 - - - 27 + 1.25 5
8 + 20 40 28 - - -
9 + 2.5 5 29 + 5 10
10 + 1.25 2.5 30 + 2.5 5
11 + 0.625 2.5 31 + 0.625 1.25
12 + 1.25 5 32 + 0.625 1.25
13 - - - 33 + 5 10
14 - - - 34 + 2.5 5
15 + 5 10 35 - - -
16 + 10 20 36 - - -
17 + 2.5 5 37 + 1.25 1.25
18 + 0.625 1.25 38 + 0.625 1.25
19 - - - 39 + 5 10
20 + 1.25 2.5 40 + 10 20

4. Discussion

Amongst the Enterococci species isolated from root canals, E. faecalis is the most common species; however, it constitutes a small proportion of the microbial species isolated from root canals. In this study, the prevalence of E. faecalis among the selected patients was recorded as 77.5%. Also, previous researches studying the existence of E. faecalis in root-filled teeth with periapical lesions have reported a wide range of prevalence from 24 to 77% which can be due to the differences in the methods of identification [5, 27, 28]. Additionally, other studies have isolated E. faecalis in teeth with prior unsuccessful treatment with a range of 30% to 90% [5, 29]. Most of these studies have been conducted using culturing methods. These methods have provided great insight into the microbiology of endodontic diseases. However, molecular studies have several superiorities when compared with culture. Molecular methods, particularly, polymerase chain reaction (PCR), are more accurate, more predictable, more sensitive, and faster techniques, which may justify the higher prevalence of E. faecalis in this study [2]. Antimicrobial drug resistance among Enterococci species has encouraged development of alternative therapeutic strategies. Amongst these strategies, nanomaterials have turned up as noteworthy and innovative antimicrobial agents [30]. Transmission electron microscopy (TEM), high-resolution TEM (HRTEM), and low-resolution TEM (LRTEM) had facilitated the characterization of NPs and revolutionized their use [31]. Due to the advantages of nanoparticles, several studies have been conducted on the antibacterial effects of nanoparticles, most of which on silver nanoparticles. For example, the study of Sadeghi et al. regarding the comparison of the antimicrobial effect of silver nanoparticles and chlorhexidine on Streptococcus sanguis and Actinomyces viscosis showed that silver nanoparticle had an antimicrobial effect better than chlorhexidine [32]. Furthermore, in the study of Niakan et al., they compared the effect of silver nanoparticles with Deconex disinfectants on Staphylococcus aureus and Pseudomonas aeruginosa and found that silver nanoparticles antimicrobial effect is superior [33]. In this work, we focused on the effectiveness of bismuth nanoparticles in inhibiting the growth of E. faecalis, by broth microdilution method, a standard method which is more accurate, reliable, and easier to interpret compared to other methods such as well diffusion method [34], although the inhibitory effect of elemental bismuth is detected at comparatively high concentrations because of its limited water solubility. However, lower concentrations can be attained with chelating agents such as dimercaptopropanol. Bismuth-dimercaptopropanol has high solubility with reduced antimicrobial activity [35]. Nevertheless, our results showed more effective antibacterial activity of BiNPs against E. faecalis in comparison with chlorhexidine, in a way that the MIC and MBC of bismuth nanoparticles were about one-eighth of chlorhexidine.

Chlorhexidine, as a gold standard for the removal of microbial plaque, has a strong antiseptic effect, and studies comparing the effect of chlorhexidine with other antibacterial products show that chlorhexidine has a stronger antibacterial effect on dental plaque microorganisms than other substances. For example, Haffajee et al. showed that chlorhexidine mouthwash has a stronger antimicrobial effect than herbal mouthwashes [36]. However, it can cause complications such as discoloration of the teeth and tongue, taste disturbance, and it also increases the risk of oropharyngeal cancers due to the high alcohol content (12%), which necessitates the use of other therapeutic strategies [37]. Overall, the experimental data suggest that bismuth nanoparticles could be an interesting alternative to combat E. faecalis, which, in view of the advantages mentioned for bismuth nanoparticle like inhibiting Streptococcus mutans biofilm formation and higher antibacterial activity compared to chlorhexidine, can be suggested to be used in different fields of dentistry. However, there is still insufficient research into long-term effects as well as its complications on human beings, and its use requires more extensive studies. In addition, the compatibility of nanoparticles with the nature and the method of their recovery requires more researches.

5. Conclusion

The experimental data suggest that bismuth nanoparticles could be an interesting alternative to combat E. faecalis, which, in view of the advantages mentioned for bismuth nanoparticle like inhibiting Streptococcus mutans biofilm formation and higher antibacterial activity compared to chlorhexidine, can be suggested to be used in different fields of dentistry.

Acknowledgments

The authors thank the vice chancellery of Shiraz University of Medical Sciences for supporting the research (grant no. 96 01 03-14924). This manuscript is relevant to the thesis of Dr. Sahar Rostamifar. The authors thank Dr. M. Vosoughi from the Dental Research Development Center for the statistical analysis.

Data Availability

The experimental and clinical data used to support the findings of this study are included within the article.

Disclosure

This study is part of a dentistry thesis (no. 14924).

Conflicts of Interest

The authors declare no conflicts of interest.

Authors' Contributions

The authors alone are responsible for the content and writing of the paper.

References

  • 1.Radeva E., Karayasheva D. Importance of Enterococci (Enterococcus faecalis) for dental medicine - microbiological characterization, prevalence and resistance. International Journal of Science and Research. 2017;6(7):1970–1973. doi: 10.21275/art20175821. [DOI] [Google Scholar]
  • 2.Stuart C. H., Schwartz S. A., Beeson T. J., Owatz C. B. Enterococcus faecalis: its role in root canal treatment failure and current concepts in retreatment. Journal of Endodontics. 2006;32(2):93–98. doi: 10.1016/j.joen.2005.10.049. [DOI] [PubMed] [Google Scholar]
  • 3.Nayak M., Kotigadde S., Shetty H., Vineet R., Antony B. Impact of Peptostreptococcus on type 2 diabetes mellitus related secondary root canal infections. International Journal of Pharmaceutical Sciences and Research. 2013;4(10):p. 4001. [Google Scholar]
  • 4.Sundqvist G., Figdor D., Persson S., Sjögren U. Microbiologic analysis of teeth with failed endodontic treatment and the outcome of conservative re-treatment. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology. 1998;85(1):86–93. doi: 10.1016/S1079-2104(98)90404-8. [DOI] [PubMed] [Google Scholar]
  • 5.Rôças I. N., Siqueira J. F., Jr., Santos K. R. Association of Enterococcus faecalis with different forms of periradicular diseases. Journal of Endodontics. 2004;30(5):315–320. doi: 10.1097/00004770-200405000-00004. [DOI] [PubMed] [Google Scholar]
  • 6.Mohammadi Z. Effects of root canal irrigants on the planktonic form of Enterococcus faecalis: a review. Nigerian Journal of Medicine. 2015;24(3):261–267. [PubMed] [Google Scholar]
  • 7.Azad A., Modaresi F., Zahed M., Zarei M., Ranjbaran A., Jahrom Z. K. Multiplex polymerase chain reaction for detection of bacteremia during dental extraction. Journal of Investigative and Clinical Dentistry. 2019;10, article e12425 doi: 10.1111/jicd.12425. [DOI] [PubMed] [Google Scholar]
  • 8.Zoletti G. O., Pereira E. M., Schuenck R. P., Teixeira L. M., Siqueira J. F., dos Santos K. R. N. Characterization of virulence factors and clonal diversity of Enterococcus faecalis isolates from treated dental root canals. Research in Microbiology. 2011;162(2):151–158. doi: 10.1016/j.resmic.2010.09.018. [DOI] [PubMed] [Google Scholar]
  • 9.Love R. Enterococcus faecalis–a mechanism for its role in endodontic failure. International Endodontic Journal. 2001;34(5):399–405. doi: 10.1046/j.1365-2591.2001.00437.x. [DOI] [PubMed] [Google Scholar]
  • 10.Siqueira J., Jr., Machado A., Silveira R., Lopes H., De Uzeda M. Evaluation of the effectiveness of sodium hypochlorite used with three irrigation methods in the elimination of Enterococcus faecalis from the root canal, in vitro. International Endodontic Journal. 1997;30(4):279–282. doi: 10.1111/j.1365-2591.1997.tb00708.x. [DOI] [PubMed] [Google Scholar]
  • 11.Torabinejad M., Khademi A., Babagoli J., et al. A new solution for the removal of the smear layer. Journal of Endodontics. 2003;29(3):170–175. doi: 10.1097/00004770-200303000-00002. [DOI] [PubMed] [Google Scholar]
  • 12.Shabahang S., Torabinejad M. Effect of MTAD on Enterococcus faecalis–contaminated root canals of extracted human teeth. Journal of Endodontics. 2003;29(9):576–579. doi: 10.1097/00004770-200309000-00008. [DOI] [PubMed] [Google Scholar]
  • 13.Gomes B. P., Pinheiro E. T., Gade-Neto C. R., et al. Microbiological examination of infected dental root canals. Oral Microbiology and Immunology. 2004;19(2):71–76. doi: 10.1046/j.0902-0055.2003.00116.x. [DOI] [PubMed] [Google Scholar]
  • 14.Nagayoshi M., Fukuizumi T., Kitamura C., Yano J., Terashita M., Nishihara T. Efficacy of ozone on survival and permeability of oral microorganisms. Oral microbiology and immunology. 2004;19(4):240–246. doi: 10.1111/j.1399-302X.2004.00146.x. [DOI] [PubMed] [Google Scholar]
  • 15.Lin Y.-h., Mickel A. K., Chogle S. Effectiveness of selected materials against Enterococcus faecalis: part 3. The antibacterial effect of calcium hydroxide and chlorhexidine on Enterococcus faecalis. Journal of Endodontics. 2003;29(9):565–566. doi: 10.1097/00004770-200309000-00006. [DOI] [PubMed] [Google Scholar]
  • 16.MICKEL A., NGUYEN T., CHOGLE S. Antimicrobial activity of endodontic sealers on Enterococcus faecalis. Journal of Endodontics. 2003;29(4):257–258. doi: 10.1097/00004770-200304000-00006. [DOI] [PubMed] [Google Scholar]
  • 17.Gomes B. P. F. A., Souza S. F. C., Ferraz C. C. R., et al. Effectiveness of 2% chlorhexidine gel and calcium hydroxide againstEnterococcus faecalisin bovine root dentinein vitro. International Endodontic Journal. 2003;36(4):267–275. doi: 10.1046/j.1365-2591.2003.00634.x. [DOI] [PubMed] [Google Scholar]
  • 18.Basrani B., Santos J. M., Tjäderhane L., et al. Substantive antimicrobial activity in chlorhexidine-treated human root dentin. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology. 2002;94(2):240–245. doi: 10.1067/moe.2002.124002. [DOI] [PubMed] [Google Scholar]
  • 19.Rudramurthy G., Swamy M., Sinniah U., Ghasemzadeh A. Nanoparticles: alternatives against drug resistant pathogenic microbes. Molecules. 2016;21(7):p. 836. doi: 10.3390/molecules21070836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Dizaj S. M., Mennati A., Jafari S., Khezri K., Adibkia K. Antimicrobial activity of carbon-based nanoparticles. Advanced Pharmaceutical Bulletin. 2015;5(1):p. 19. doi: 10.5681/apb.2015.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Claudio C.-R., Chellam S. Seifalian A., Mel A., Kalaskar D. M., editors. Bismuth nanoparticles: antimicrobials of broad-spectrum, low cost and safety, Nanomedicine; 2014. pp. 430–437.
  • 22.Figueroa-Quintanilla D., Salazar-Lindo E., Sack R. B., et al. A controlled trial of bismuth subsalicylate in infants with acute watery diarrheal disease. New England Journal of Medicine. 1993;328(23):1653–1658. doi: 10.1056/NEJM199306103282301. [DOI] [PubMed] [Google Scholar]
  • 23.Cabral-Romero C., Hernandez-Delgadillo, Velasco-Arias, et al. Zerovalent bismuth nanoparticles inhibit Streptococcus mutans growth and formation of biofilm. International Journal of Nanomedicine. 2012;7:p. 2109. doi: 10.2147/IJN.S29854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Cabral-Romero C., Hernandez-Delgadillo R., Velasco-Arias M.-S., Diaz D., Zumeta-Dubé N.-A. Bismuth oxide aqueous colloidal nanoparticles inhibit Candida albicans growth and biofilm formation. International Journal of Nanomedicine. 2013;8:p. 1645. doi: 10.2147/ijn.s38708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Siqueira J. F., Jr., Rôças I. N. Polymerase chain reaction–based analysis of microorganisms associated with failed endodontic treatment. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology. 2004;97(1):85–94. doi: 10.1016/S1079-2104(03)00353-6. [DOI] [PubMed] [Google Scholar]
  • 26.Halkai K. R., Mudda J. A., Shivanna V., Rathod V., Halkai R. Antibacterial efficacy of biosynthesized silver nanoparticles against Enterococcus faecalis biofilm: an in vitro study. Contemporary Clinical Dentistry. 2018;9(2):237–241. doi: 10.4103/ccd.ccd_828_17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Fouad A. F., Zerella J., Barry J., Spångberg L. S. Molecular detection of Enterococcus species in root canals of therapy-resistant endodontic infections. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology. 2005;99(1):112–118. doi: 10.1016/j.tripleo.2004.06.064. [DOI] [PubMed] [Google Scholar]
  • 28.Anderson A. C., Al-Ahmad A., Elamin F., et al. Comparison of the bacterial composition and structure in symptomatic and asymptomatic endodontic infections associated with root-filled teeth using pyrosequencing. PLoS One. 2013;8(12, article e84960) doi: 10.1371/journal.pone.0084960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Pinheiro E., Gomes B., Ferraz C., Sousa E., Teixeira F., Souza-Filho F. Microorganisms from canals of root-filled teeth with periapical lesions. International Endodontic Journal. 2003;36(1):1–11. doi: 10.1046/j.1365-2591.2003.00603.x. [DOI] [PubMed] [Google Scholar]
  • 30.Ravishankar Rai V., Jamuna B. A. In: Nanoparticles and their potential application as antimicrobials. A Méndez-Vilas A., editor. Mysore: Formatex; 2011. [Google Scholar]
  • 31.Hajipour M. J., Fromm K. M., Ashkarran A. A., et al. Antibacterial properties of nanoparticles. Trends in Biotechnology. 2012;30(10):499–511. doi: 10.1016/j.tibtech.2012.06.004. [DOI] [PubMed] [Google Scholar]
  • 32.Sadeghi R., Owlia P., Mb R., Taleghani F., Sharif F. An in-vitro comparison between antimicrobial activity of nanosilver and chlorhexidine against Streptococus sanguis and Actinomyces viscosus. The Journal of Islamic Dental Association of IRAN. 2011;23(4):p. 22531. [Google Scholar]
  • 33.Niakan M., Abassi F., Hamedi R., Aliasghar E., Najafi F., Fatemi M. Antibacterial effect of nanosilver colloidal particles and its comparison with dental disinfectant solution against two strains of bacteria. Daneshvar Medicine. 2012;19(96):65–72. [Google Scholar]
  • 34.Cockerill F., Clinical, Institute LS . Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically: approved standard. Clinical and Laboratory Standards Institute; 2012. [Google Scholar]
  • 35.Badireddy A. R., Hernandez-Delgadillo R., Sánchez-Nájera R. I., Chellam S., Cabral-Romero C. Synthesis and characterization of lipophilic bismuth dimercaptopropanol nanoparticles and their effects on oral microorganisms growth and biofilm formation. Journal of Nanoparticle Research. 2014;16(6):p. 2456. doi: 10.1007/s11051-014-2456-5. [DOI] [Google Scholar]
  • 36.Haffajee A. D., Yaskell T., Socransky S. S. Antimicrobial effectiveness of an herbal mouthrinse compared with an essential oil and a chlorhexidine mouthrinse. The Journal of the American Dental Association. 2008;139(5):606–611. doi: 10.14219/jada.archive.2008.0222. [DOI] [PubMed] [Google Scholar]
  • 37.Newman M. G., Takei H., Klokkevold P. R., Carranza F. A. Newman and Carranza's Clinical Periodontology E-Book. Elsevier Health Sciences; 2018. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The experimental and clinical data used to support the findings of this study are included within the article.


Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES