Impaired mitochondrial function of alveolar macrophages in carbon nanotube-induced chronic pulmonary granulomatous disease

Abstract

Human exposure to carbon nanotubes (CNT) has been associated with the development of pulmonary sarcoid-like granulomatous disease. Our previous studies demonstrated that multi-walled carbon nanotubes (MWCNT) induced chronic pulmonary granulomatous inflammation in mice. Granuloma formation was accompanied by decreased peroxisome proliferator-activated receptor gamma (PPARγ) and disrupted intracellular lipid homeostasis in alveolar macrophages. Others have shown that PPARγ activation increases mitochondrial fatty acid oxidation (FAO) to reduce free fatty acid accumulation. Hence, we hypothesized that the disrupted lipid metabolism suppresses mitochondrial FAO. To test our hypothesis, C57BL/6J mice were instilled by an oropharyngeal route with 100pg MWCNT freshly suspended in 35% Infasurf. Control sham mice received vehicle alone. Sixty days following instillation, mitochondrial FAO was measured in permeabilized bronchoalveolar lavage (BAL) cells. MWCNT instillation reduced the mitochondrial oxygen consumption rate of BAL cells in the presence of palmitoyl-carnitine as mitochondrial fuel. MWCNT also reduced mRNA expression of mitochondrial genes regulating FAO, carnitine palmitoyl transferase-1 (CPT1), carnitine palmitoyl transferase-2 (CPT2), hydroxyacyl-CoA dehydrogenase subunit beta (HADHB), and PPARγ coactivator 1 alpha (PPARGC1A). Importantly, both oxidative stress and apoptosis in alveolar macrophages and lung tissues of MWCNT-instilled mice were increased. Because macrophage PPARγ expression has been reported to be controlled by miR-27b which is known to induce oxidative stress and apoptosis, we measured the expression of miR-27b. Results indicated elevated levels in alveolar macrophages from MWCNT-instilled mice compared to controls. Given that inhibition of FAO and apoptosis are linked to M1 and M2 macrophage activation, respectively, the expression of both M1 and M2 key indicator genes were measured. Interestingly, results showed that both M1 and M2 phenotypes of alveolar macrophages were activated in MWCNT-instilled mice. In conclusion, alveolar macrophages of MWCNT-instilled mice had increased miR-27b expression, which may reduce the expression of PPARγ resulting in attenuation of FAO. This reduction in FAO may lead to activation of M1 macrophages. The upregulation of miR-27b may also induce apoptosis, which in turn can cause M2 activation of alveolar macrophages. These observations indicate a possible role of miR-27b in impaired mitochondrial function in the chronic activation of alveolar macrophages by MWCNT and the development of chronic pulmonary granulomatous inflammation.

1. Introduction

The industrial and medical use of carbon nanotubes (CNT) has substantially grown in the past few decades due to their outstanding physical and biological properties (Serpell et al. 2016). Exposure to CNT in humans has been linked to an increase in pulmonary inflammation, fibrosis, and chronic granulomatous disease (Fatkhutdinova et al. 2016; Schulte et al. 2018). Evidence from clinical case reports and epidemiological studies suggests involvement of CNT in the development of pulmonary sarcoid-like granulomatous inflammation. Izbicki and his colleagues have reported that after the World Trade Center (WTC) disaster in 2001, the incidence of sarcoid-like granulomatous pulmonary disease was elevated among firefighters of Fire Department of New York (Izbicki etal. 2007). Clinical, pathologic, and electron microscopy mineralogic analyses revealed the presence of carbon nanotubes (CNT) of various sizes and lengths in lung samples of some WTC responders diagnosed with pulmonary granulomatous inflammation (Wu et al. 2010). This information indicates that environmental/occupational exposure to CNT may contribute to development of chronic pulmonary granulomatous disease. Chronic granulomatous inflammation has been also observed in different murine models after airway exposure to multi-walled carbon nanotubes (MWCNT) (Huizar et al. 2011; Pacheco et al. 2018).

Alveolar macrophages play a major role in the responses of the lung to toxic injury. Depending on their size, inhaled particles deposit in different areas of the lung. Clearance of these particles is initiated by alveolar macrophages and other immune cells, such as neutrophils and lymphocytes, which are recruited to the affected sites (Geiser 2010). In order to protect against the invading particles, alveolar macrophages release reactive oxidants, such as reactive oxygen species (ROS), reactive nitrogen species (RNS), as well as cytokines, and chemokines (Hiraiwa and van Eeden 2013). Additionally, to limit the exuberant immune response and dampen inflammation, these alveolar macrophages express high levels of peroxisome proliferator activated receptor gamma (PPARγ), a key modulator of redox signaling and immune responses (Croasdell et al. 2015; Kim and Yang 2013). We previously reported downregulation of PPARγ expression within alveolar macrophages of sarcoidosis patients and in a murine model of granulomatous inflammation elicited by MWCNT (Barna et al. 2006; Culver et al. 2004; Huizar et al. 2013). Moreover, we also demonstrated that deficiency of PPARγ in alveolar macrophages results in exacerbation of inflammation (Huizar et al. 2013).

Oxidative stress occurs as a result of imbalance between the production and elimination of ROS and plays an important role in regulating the development of acute and chronic lung diseases (van der Vliet et al. 2018). Exposure of alveolar macrophages to environmental pro-oxidants such as ozone, tobacco, and particulate matters induces the production of ROS within the airways of the lung (Fessler and Summer 2016). The increase in ROS production in turn leads to an increase in macrophage phagocytosis. However, overproduction of ROS also induces apoptotic pathways within airway epithelial cells and macrophages resulting in exaggerated lung inflammation (Fan and Fan 2018; Korns et al. 2011). Importantly, PPARγ plays a protective role against oxidative damage in the lung. This protective capacity of PPARγ is mediated by the activation of antioxidant genes such as hemeoxygenase-1 (HO-1), catalase (CAT), and superoxide dismutase (SOD) (Lee 2017).

In addition to its immunomodulatory and antioxidant role, PPARγ is also involved in regulating lipid metabolism within alveolar macrophages by maintaining the intracellular homeostasis of free fatty acid (FFA) and cholesterol. Previous studies have shown that PPARγ activation increases mitochondrial fatty acid oxidation (FAO) to reduce FFA accumulation in macrophages (Ye et al. 2019). PPARγ also increases ATP-binding cassette lipid transporter-G1 (ABCG1) expression to reduce cholesterol accumulation (Baker et al. 2010). Using MWCNT in a murine model of granulomatous inflammation, we previously demonstrated that MWCNT exposure leads to reduction in PPARγ and ABCG1 expression and results in lipid accumulation in alveolar macrophages (Barna et al. 2016; Huizar et al. 2013). However, the effect of MWCNT exposure on mitochondrial FAO has not been investigated. In the present study, we hypothesized that the MWCNT-induced disrupted lipid metabolism in alveolar macrophages suppresses mitochondrial FAO. To address this hypothesis, we examined the effects of MWCNT instillation on alveolar macrophages: (1) FAO, (2) oxidative stress, and (3) apoptosis in order to determine if these processes were dysregulated in a murine model of chronic pulmonary granulomatous inflammation.

2. Materials and Methods

2.1. Characteristics of Multiwall Carbon Nanotubes (MWCNT) and Preparation of MWCNT suspension

Pristine long MWCNT suspensions (900-1201, lot-GS1802; SES Research, Houston, TX) were freshly prepared at a concentration of 2 mg/ml in 35% Infasurf (Infrasurf; a gift of ONY, Inc., Amherst, NY) diluted in phosphate buffered saline (PBS). The mixtures were bath sonicated (model 1510R-MTH; Branson Ultrasonics Corp. Danbury, CT) to obtain a homogenous suspension. This dose was chosen based on previous studies in which mice were instilled with escalating does of MWCNT (25, 50 and 100 ug). Doses of 25 and 50 ug resulted in minimal granulomatous responses. A dose of 100ug MWCNT was found to produce a marked granulomatous inflammatory response (Huizar et al. 2011). We used this dose range based on National Institute for Occupational Safety and Health (NIOSH) recommended exposure limit which was derived from animal studies conducted using instillation, aspiration, and inhalation techniques to enable CNT exposure of rats and mice (Mercer et al. 2010; NIOSH 2013).

The particle size of MWCNT and the stability of their suspension has been described earlier (Malur et al. 2019) and are reviewed here. Scanning electron microscopy reveals that the MWCNT widths are approximately 20–30 nm with lengths up to microns. X-ray diffraction and Raman spectroscopy demonstrated that the MWCNT batches exhibit the correct crystallographic phase of MWCNTs.

2.2. Animals and carbon nanotubes instillation

All procedures were conducted in conformity with Public Health Service policy on humane care and use of laboratory animals and were approved by the institutional animal care committee at East Carolina University, Animal Use Protocol J199. C57BL/6J mice (Jackson Laboratory, Bar Harbor, ME) were housed in controlled environmental conditions (22 ± 2°C; 12-h light/dark cycle) and provided food and water ad libitum. C57BL/6J mice received a single oropharyngeal instillation of MWCNT or PBS/ surfactant (control) at 8 weeks of age. Mice were anesthetized using inhalation isoflurane and 100μg in 50μl/mouse of MWCNT suspension was instilled using a pipette into the back of the throat while gently holding the tongue forward to expose the epiglottis. 60 days post-instillation, animals were euthanized and bronchoalveolar lavage (BAL) or lungs were harvested for further analysis as previously described (Huizar et al. 2011; Malur et al. 2009). C57BL/6J mice receiving rosiglitazone were given diets loaded with the drug produced by Teklad Diets (Madison, Ml) to deliver 6 mg/kg/day daily, three days prior to instillation of MWCNT until euthanasia (20 days post instillation) (McPeek et al. 2018).

2.3. Histological analysis

Lungs from sham and MWCNT-instilled mice were dissected and fixed in PBS-buffered 10% formalin, dehydrated and paraffin embedded. Whole lung sections (5 μm) were dewaxed, gradually rehydrated and then stained with hematoxylin and eosin (H&E). Digital images were captured using Axio Imager M2 (Zeiss, Inc.).

2.4. Bronchoalveolar Lavage (BAL)

BAL cells from sham and MWCNT mice were collected by aspiration of warm saline from lungs as previously described (Malur et al. 2009). Differential cell counts were obtained using a modified Wright’s stain on cytospin preparations.

2.5. Transmission Electron Microscopy (TEM)

The BAL cell pellets from sham and MWCNT-instilled mice were fixed in 2% glutaraldehyde buffered with 0.1 M sodium cacodylate (pH 6.9). Samples were washed (3X10 min) with sodium cacodylate buffer, post-stained with 2% osmium tetroxide and then washed again (3X10 min) with sodium cacodylate buffer. Samples were subsequently dehydrated with ethanol, infiltrated and embedded in Epon 812 resin and polymerized in an oven at 70° C for 24 h. Microtomy was performed on a Leica EM UC7 and sections were post-stained with saturated aqueous uranyl acetate for 20 min followed by Reynolds’ lead citrate for 5 min (Reynolds 1963). Sections were imaged using a Thermo Fisher Scientific Talos F200X TEM.

2.6. RNA purification and qRT-PCR analysis

Total RNA was extracted from sham and MWCNT-instilled mice BAL cell pellets using miRNeasy Micro Kit (Qiagen, MD, USA) according to the manufacturer’s instructions. Specific primers for miR-27b (MP00005264), SNORD68 (MS00033712), FIZZ1 (NM_020509), ARG1 (NM_007482), INOS (NM_010927), IL12B (NM_008352), CPT1 (NM_013495), CPT2 (NM_009949), HADHB (NM_145558), PPARGC1A (NR_027710), IL6 (NM_031168), and GAPDH (NM_008084) were obtained from Qiagen. Specific primers sequences for HO-1 (Forward 5′- AAGCCGAGAATGCTGAGTTCA′ and reverse 5′- GCCGTGTAGATATGGTACAAGGA′), GCLC (Forward 5′- GGGGTGACGAGGTGGAGTA′ and reverse 5′-GTTGGGGTTTGTCCTCTCCC′), SOD1 (Forward 5′- TGTGTCCATTGAAGATC′ and reverse 5′-CCACCTTTGCCCAAGTC′) and CAT (Forward 5′- GCGTCCAGTGCGCTGTAGA′ and reverse 5′- TCAGGGTGGACGTCAGTGAA′) were obtained from Invitrogen (NY, USA). cDNA for miRNA was synthesized from RNA using miScript II RT Kit (Qiagen) and qRT-PCR was performed using miScript SYBR Green PCR Kit (Qiagen). cDNA for mRNA was synthesized from RNA using RT2 First Strand Kit (Qiagen) and qRT-PCR was performed using RT² SYBR Green qPCR Mastermix (Qiagen) and StepOnePlus PCR system (Thermo Fisher Scientific, USA). Fold change was calculated using 2^−ΔΔCT method in comparison to GAPDH (for mRNA) or SNORD68 (for miRNA) (Livak and Schmittgen 2001).

2.7. Oxygraphic measurement of mitochondrial respiration

The rates of oxygen consumption by mitochondria within BAL cells from sham and MWCNT-instilled mice were determined using a high-resolution respirometer (Oxygraph-2K, from OROBOROS Instruments, Austria) (Perry et al. 2013). BAL cells (500,000) were suspended in 2.5ml MiR05 buffer (0.5mM EGTA, 3mM MgCI, 60mM K-lactobionate, 10mM KH2P04, 20mM HEPES, 110mM sucrose, 0.001 %(w/v) BSA, pH 7.4) in Oxygraph chamber and permeabilized by digitonin (0.01 mg/ml, Sigma) for 10 minutes. Mitochondrial respiration was analyzed in presence of palmitoylcarnitine (0.2mM, Cayman) and malate (2mM) to measure fatty acid oxidation.

2.8. Mitochondrial mass and membrane potential measurements

Mitochondrial mass was detected in alveolar macrophages using MitoTracker® Green FM (Invitrogen). BAL cytospins from sham and MWCNT-instilled mice were incubated with 100 nM MitoTracker® Green FM staining solution for 30 minutes at 37°C, washed with PBS, incubated with plasma membrane marker, Wheat Germ Agglutinin (WGA Alexa Fluor 555 conjugate, 5ug/ml, Invitrogen), for 10 minutes at room temperature, and then washed with PBS. Mitochondrial membrane potential was measured using Image-it tetramethyrhodamine (TMRM) reagent (Invitrogen). BAL cytospins were incubated with 100 nM TMRM staining solution for 30 minutes at 37°C and washed with PBS. Cytospins were then rinsed and-mounted with ProLong Antifade containing DAPI (Invitrogen, USA). Images were captured using confocal microscopy (Zeiss LSM 700).

2.9. Oxidative stress measurements

2.9.1. Intracellular oxidative stress in BAL cells

BAL cytospins from sham and MWCNT-instilled mice were incubated with CellROX green (5 μM, Invitrogen, USA) for 30 minutes at 37°C in dark humidified atmosphere. Cells were fixed using 4% buffered paraformaldehyde for 15 minutes (pH 7.4), rinsed with PBS, air dried, and then mounted with ProLong Antifade containing DAPI (Invitrogen, USA). BAL cells treated with H₂O₂ (40uM, for 15 minutes) were used as positive control. Cells were imaged using confocal microscopy (Zeiss LSM 700).

2.9.2. Oxidative stress in lung homogenate and BAL fluid

Oxidative stress in fresh lung tissues and BAL fluid from sham and MWCNT-instilled mice was measured using DCF ROS/RNS Assay Kit (Abeam, Cambridge, MA) according to manufacturer’s instructions. Briefly, lung tissues (25 mg/mL) were sonicated in PBS on ice, centrifuged at 10,000 g for 10 minutes, and assayed directly. The dichlorodihydrofluorescin DiOxyQ (DCFH-DiOxyQ) probe was first primed with a quench removal reagent, and subsequently stabilized in the highly reactive DCFH form. The probe was then added to the lung homogenate and BAL fluid in a 96-well plate for 30 min. The fluorescence of the probe was measured using Infinite 200 Pro plate reader (Tecan Trading AG, Switzerland) at an excitation wavelength of 480 nm and an emission of 530 nm.

2.9.3. Total glutathione (GSH) measurement in BAL cells

BAL Cells from sham and MWCNT-instilled mice were lysed in TEE buffer (10 mM Tris base, 1 mM EDTA and 1 mM EGTA) containing 0.5% Tween-20. Total glutathione levels were measured in cell lysates as described previously (Elhassanny et al. 2019). Briefly, chromagen (freshly prepared 1:1 solution of 1mM 2,2′-Dithiobis(5-nitropyridine) [DTNP] and glutathione reductase) were added to cell lysates or oxidized glutathione standard (GSSG) in a 96-well plate. The mixture was incubated at room temperature for 15 min and then 10 mM NADPH (Sigma–Aldrich) was added. The absorbance was measured every 1 min for 5 min at 405 nm using Infinite 200 Pro plate reader (Tecan Trading AG, Switzerland).

2.9.4. Thioredoxin reductase activity measurement in BAL cells

Thioredoxin reductase (TrxR) activity from sham and MWCNT-instilled mice was determined as described previously (Elhassanny et al. 2019). BAL cells were lysed in TEE buffer. The activity was measured in the presence of 0.5 mM DTNB (Ellman’s Reagent), 0.25 mM NADPH, and auranofin (a selective TrxR inhibitor). The activity was calculated based on the linear increase in NADPH absorbance overtime.

2.10. Apoptosis measurements

2.10.1. TUNEL assay

DNA fragmentation from sham and MWCNT-instilled mice was measured as an indication of apoptosis in the cytospin of BAL cells and paraffin-embedded lung tissue sections using TUNEL assay kit (In Situ Cell Death Detection Kit; Roche; Indianapolis, IN) according to manufacturer’s instructions. Briefly, cytospins were fixed in 4% paraformaldehyde, incubated with WGA Alexa Fluor 555 conjugate (5ug/ml, Invitrogen), for 10 minutes at room temperature, and then incubated in the permeabilization solution. Paraffin -embedded lung tissues were dewaxed, rehydrated and then treated with proteinase K. Both cytospin samples and lung tissue sections were incubated with TUNEL reaction mixture, rinsed, air dried, and then mounted with ProLong Antifade containing DAPI (Invitrogen, USA). Images were captured using confocal microscopy (Zeiss LSM 700).

2.10.2. Measurement of Caspase 3/7 activity

Caspase 3/7 activity from sham and MWCNT-instilled mice was measured in BAL cells (15,000 cells) and fresh lung tissue homogenate (100ug protein) using Caspase-Glo 3/7 reagent (Promega, Madison, Wl) as directed by the manufacturer. Luminescence was measured by using the Infinite 200 Pro plate reader (Tecan Trading AG, Switzerland).

2.11. Statistical Analyses

Data are presented as the mean ± standard error of the mean (SEM). Student’s t test was carried out using GraphPad Prism 7 software (GraphPad, Inc., San Diego, CA).

3. Results

3.1. MWCNT instillation reduces mitochondrial FAO in alveolar macrophages

We previously demonstrated that MWCNT induced chronic granulomatous inflammation in C57BL/6J mice and that granuloma formation was associated with downregulation of PPARγ, dysregulation of lipid metabolism, and accumulation of intracellular lipids in alveolar macrophages (Barna et al. 2016; Huizar et al. 2013). Studies from other laboratories have demonstrated that PPARγ controls the intracellular levels of free fatty acid by regulating the expression of genes involved in FAO (Ye et al. 2019). Consistent with our previous results, MWCNT instillation induced chronic pulmonary granulomatous inflammation after 60 days in C57BL/6J mice (Figure 1A) (Huizar et al. 2011). Alveolar macrophages represented 99% of the total bronchoalveolar lavage (BAL) cell count in sham group and 94% in MWCNT-instilled mice. The absolute number of cells recovered from BAL of PBS-instilled versus MWCNT did not differ significantly at 60 days (Table 1). To investigate the effect of MWCNT on mitochondrial FAO in alveolar macrophages, we measured mitochondrial respiration in permeabilized BAL cells using Oroboros Oxygraph-2 k in the presence of the long chain fatty acid, palmitoylcarnititne. MWCNT caused a 72% reduction in the mitochondrial oxygen consumption rate (p ≤ 0.05) indicating the impairment of mitochondrial FAO (Figure 1B). We next measured the expression of genes involved in mitochondrial fatty acid oxidation; carnitine palmitoyltransferase-1 (CPT1), carnitine palmitoyltransferase-2 (CPT2), hydroxyacyl-CoA dehydrogenase subunit beta (HADHB), and PPARγ coactivator 1 alpha (PPARGC1A). Results from RT-PCR analysis showed that the relative mRNA expression levels of CPT1, CPT2, HADHB, and PPARGC1A were significantly lower (p ≤ 0.05) in alveolar macrophages of MWCNT-instilled mice when compared to the sham group (Figure 1C). PPARGC1A is a transcriptional coactivator of PPARγ and is involved in regulation of mitochondrial mass and function (Wu et al. 1999; Ye et al. 2017). Because of the reduction in PPARGC1A, we assessed the mitochondrial content and membrane potential in alveolar macrophages, using MitoTracker green and TMRM, respectively. MitoTracker green is a cell permeable dye reacts with the free thiol groups of cystein residues of the mitochondrial proteins. It is non-fluorescent in aqueous solution and becomes fluorescent when accumulates in mitochondrial lipid environment (Cottet-Rousselle et al. 2011). TMRM accumulates in active mitochondria with active membrane potential. Unlike TMRM, MitoTracker green has been shown to accumulate in mitochondria regardless of the mitochondrial membrane potential (Doherty and Perl 2017). Using the two staining protocols, alveolar macrophages from MWCNT-instilled mice showed 50% reduction in mitochondrial content (p ≤ 0.001) (Figure 2A, 2B) and 70% reduction in TMRM fluorescence (p ≤ 0.01) in comparison to the sham group. To clarify whether the reduction in TMRM fluorescence is due to reduction in mitochondrial potential not mitochondrial mass, the ratio TMRM/MitoTracker was calculated (Figure 2E). MWCNT showed significant reduction in TMRM/MitoTracker ratio; thereby indicating a reduction in mitochondrial mass and function (Figure 2C, 2D). Collectively, these results suggest that MWCNT impair mitochondrial function of alveolar macrophages as indicated by the suppression of mitochondrial FAO, the reduced expression of genes involved in FAO, and the reduction in mitochondrial mass and membrane potential.

Figure 1: MWCNT-induced pulmonary granulomatous inflammation is associated with reduction in mitochondrial FAO in alveolar macrophages.

A) Representative hematoxylin and eosin (H&E)–stained lung sections from C57BL/6J sham (left) and MWCNT-instilled (right). B) MWCNT instillation reduced mitochondrial oxygen consumption rate (JO₂) in permeabilized BAL cells in the presence of palmitoylcarnitine/malate/succinate as mitochondrial fuels using Oroborous O2K. C) MWCNT reduced the expression of fatty acid oxidation genes. CPT1, CPT2, HADHB, and PPARGC1A mRNA expression was measured in BAL cells using qRT-PCR. N = number of animals.

Table 1:

Differential cell counts of BAL at 60 days post-instillation.

	Total cells (105)	AM (%)*	Lym (%)*	PMN (%)
Sham (N=9)	4.8 ± 0.5	99.2 ± 0.3	0.3 ± 0.2	0.4 ± 0.2
MWCNT (N=8)	4.5 ± 1.2	94.3 ± 2.0	2.9 ± 0.6	1.6 ± 1

AM=Alveolar Macrophages, Lym=Lymphocytes, PMN=Polymorphonuclear cells. Data presented as mean ±SEM.

^*,p≤ 0.05 vs. sham.

Figure 2: MWCNT instillation reduces mitochondrial mass and membrane potential in alveolar macrophages.

A) Representative Z-stack merging images showing that MWCNT reduced mitochondrial mass in alveolar macrophages (40X). Bronchoalveolar lavage (BAL) cytospins were stained with Wheat germ agglutinin (WGA) for cell membrane glycoprotein (red fluorescence), MitoTracker for mitochondria (green fluorescence), and DAPI for nucleus (blue). B) Mean Fluorescence intensity of MitoTracker was measured in 9 different fields/cytospin using Zen software (blue edition). C) Representative images showing that MWCNT reduced mitochondrial membrane potential in alveolar macrophages (20X). Bronchoalveolar lavage (BAL) cells were stained with TMRM for mitochondria (red fluorescence), and DAPI for nucleus (blue). D) Mean Fluorescence intensity of TMRM was measured using Zen software (blue edition). E) TMRM/MitoTracker fluorescence intensity ratio was calculated. N = number of animals.

3.2. MWCNT are localized in the cytoplasm of alveolar macrophages

To ascertain whether reduction in mitochondrial mass and function in alveolar macrophages is due to damage by phagocytosed MWCNT, we utilized TEM to examine the intracellular localization of MWCNT and the ultrastructural changes associated with mitochondria within alveolar macrophages with MWCNT. Sham control alveolar macrophages (Figure 3A) have a well-defined structure with intact mitochondria. Alveolar macrophages from MWCNT-instilled mice showed that majority of the internalized MWCNT were scattered in the cytoplasm (Figure 3B) with an occasional MWCNT in the phagolysosomes (Figure 3C). Nanotubes were not localized to the mitochondria. In addition, no changes in mitochondrial structure were observed (Figures 3B–3C).

Figure 3: High magnification TEM of alveolar macrophages of C57BL/6 mice instilled with MWCNT.

A) Ultrastructure of alveolar macrophages from PBS/Surfactant-instilled mice (sham). A single alveolar macrophage is shown with a large cluster of mitochondria directly below the nucleus (boxed region). Magnification X4,300. A, inset) High magnification of boxed region in A showing mitochondrial morphology. Magnification X21,000. B) Alveolar macrophages from MWCNT-instilled mice showing several clusters of nanotubes scattered in the cytoplasm. Magnification X3,300 B, inset). High magnification of boxed region in B showing nanotube clusters. Magnification X22,500 C) Alveolar macrophage with nanotube contained in a phagolysosome (boxed region). Arrow indicates a second nanotube in the cytoplasm of the cell. Magnification X8,600. C, inset). High magnification of boxed region in C showing nanotube (arrow) contained in a phagolysosome. Magnification X22,500. N=nucleus, M=mitochondria, P=phagolysosome. Images are representative for 10 and 25 alveolar macrophages from sham and MWCNT-instilled mice, respectively.

3.3. MWCNT instillation induces pulmonary oxidative stress

PPARγ is a key regulator of intracellular redox signaling (Kim and Yang 2013). Because our previous studies showed downregulation of PPARγ in alveolar macrophages of MWCNT-instilled mice, we investigated whether MWCNT induces oxidative stress in both alveolar macrophages and lung tissues using CellRoxGreen reagent. In alveolar macrophages, CellRox fluorescence was significantly higher (p ≤ 0.05) in MWCNT-instilled mice than in the sham group (Figures 4A, 4B). H₂O₂-exposed alveolar macrophages were used in parallel as a positive control. In BAL fluid and lung homogenate, H₂O₂ levels were measured using DCFH-DiOxyQ. As expected, H₂O₂ levels in both BAL fluids (p ≤ 0.05) and lung homogenate (p ≤ 0.001) of MWCNT-instilled mice were significantly higher than in sham mice (Figure 4C, 4D, respectively). Therefore, the presence of MWCNT within alveolar macrophages is associated with pulmonary oxidative stress.

Figure 4: MWCNT instillation increases oxidative stress in BAL and lung tissues.

A) Representative images showing that MWCNT increased oxidative stress in alveolar macrophages (40X). Cytospins of BAL cells from sham and MWCNT-instilled mice were stained with oxidative stress detection reagent, CellRox green, and nuclear stain, DAPI (blue). H₂O₂ treated alveolar macrophages from naive mice were used as a positive control. B) Mean Fluorescence intensity in 9 different fields/cytospin was measured using Zen software (blue edition). C-D) oxidative stress increased in BAL and lung homogenates of MWCNT-instilled mice. DCFH-DiOxyQ probe was used to detect H₂O₂ in BAL fluid (C) and lung tissue homogenates (D). N = number of animals.

3.4. MWCNT instillation does not affect the antioxidant defense of alveolar macrophages

Oxidative (Meister 1991). On the other hand, thioredoxin reductase (TrxR) enzymatically activates the antioxidant, thioredoxin, by restoring it to its reduced form (Arner and Holmgren 2000). We initially examined whether MWCNT affects TrxR- and GSH-based antioxidant systems by measuring stress is generated as a result of imbalance between the production and elimination of ROS. Macrophages protect themselves from increased intracellular ROS levels by increasing the antioxidant defense mechanisms which are partly regulated by PPARγ (Lee 2017). Given that PPARγ is downregulated by MWCNT, we investigated whether MWCNT-induced oxidative stress is due to the downregulated antioxidant systems. Glutathione (GSH) is the primary, non-enzymatic antioxidant within the cell total GSH level and TrxR activities. Alveolar macrophages from MWCNT-instilled mice showed a 42% increase in total GSH levels (p ≤ 0.05) (Figure 5A), TrxR activity, however; remained virtually unchanged (Figure 5B). We then sought to determine whether MWCNT modulated the expression of antioxidant enzymes, such as, SOD and CAT, along with phase 2 detoxifying enzymes, namely, HO-1 and glutamate-cysteine ligase catalytic subunit-4 (GCLC4). Both HO-1 and GCLC4 are regulated by PPARγ and nuclear factor erythroid 2-related factor 2 (Nrf-2) (Lee 2017; Nguyen et al. 2003). Results indicated that MWCNT did not significantly change SOD, CAT, HO-1 and GCLC4 expression compared to sham control (data not shown). These results suggested that MWCNT-induced oxidative stress in alveolar macrophages was unlikely due to reduction in antioxidant defense molecules.

Figure 5: MWCNT instillation does not affect the antioxidant defense of alveolar macrophages.

A) MWCNT increases total glutathione in alveolar macrophages. Total glutathione was measured in BAL cell lysate and normalized to protein concentration. B) MWCNT did not significantly change thioredoxin reductase activity of alveolar macrophages. Trx reductase activity was measured in 10 ug protein of BAL cell lysate. N = number of animals.

3.5. MWCNT instillation induces apoptosis in the lung and the BAL cells

Increased ROS production has been associated with apoptosis in alveolar macrophages (Huang et al. 2003). To test whether MWCNT induces apoptosis, TUNEL and caspase 3/7 assays were performed. The number of TUNEL positive cells in alveolar macrophages was increased from 3.6% (in sham group) to 16.4% (in MWCNT group) indicating increased apoptotic activity (p ≤ 0.01) (Figure 6A, 6B). Furthermore, when lung tissue was analyzed, the number of TUNEL positive cells increased from 0.44/field (in sham group) to 18.22/field (in MWCNT group) (p ≤ 0.05) (Figure 6C, 6D). This observation was further corroborated by measuring the caspase 3/7 activity in both alveolar macrophages and lung tissue. As expected, caspase 3/7 activity was significantly higher in alveolar macrophages (p ≤ 0.01) (Figure 6E) and lung tissue homogenates (p ≤ 0.05) (Figure 6F) from MWCNT-instilled mice when compared to the sham group.

Figure 6: MWCNT instillation induces apoptosis in BAL and lung tissues.

A) Representative tile images showing that MWCNT increased apoptosis in alveolar macrophages (40X). Cytospins of BAL cells from sham and MWCNT-instilled mice were stained with TUNEL reagent for DNA fragmentation (green) and nuclear stain, DAPI (blue). B) The graph shows the percentage of TUNEL positive cells in 9 different fields/BAL cytospin. C) Representative images showing increased apoptosis in lung areas retaining the MWCNT (20X). Lung sections were stained with TUNEL (green) and DAPI (blue). Bright field is showing the retained MWCNT in lung tissues. D) The graph shows the number of TUNEL positive cells/ field (9 different fields/section were considered). Quantification of TUNEL staining was performed using Image J software. E, F) Caspase 3/7 activity was measured in BAL cells (E) and lung tissue homogenates (F). N = number of animals.

3.6. MWCNT instillation induces miR-27b expression in alveolar macrophages

Several studies have reported that miR-27b and its downstream target, PPARγ, control the intracellular levels of free fatty acid (Castano et al. 2018; Jennewein et al. 2010; Ye et al. 2019). MiR27b also modulates oxidative stress and apoptosis in macrophages (Jennewein et al. 2010; Liang et al. 2018). Therefore, we hypothesized that miR27b might play a role in MWCNT effects on alveolar macrophages. We observed a 4 fold increase when compared to sham instilled mice (p ≤ 0.05) (Figure 7A). These results are consistent with the observed elevations in oxidative stress and apoptosis along with the previously observed downregulation of PPARγ. In order to further investigate this pathway, we utilized a PPAR agonist (rosiglitazone). We administered rosiglitazone to MWCNT instilled C57BI/6 mice and observed a reduction in lipid accumulation and granuloma formation at 20 days (McPeek et al. 2018). Alveolar macrophages from rosiglitazone treated mice were evaluated for miR27b expression, a 50% reduction for miR 27b was observed (p < 0.05) (Figure 7B).

Figure 7:

A) MWCNT instillation increases miR-27b expression in alveolar macrophages. MiR-27b expression was measured in BAL cells using qRT-PCR and relative fold change from control (sham) was calculated. B) PPAR activity modulates miR27b expression in alveolar macrophages. MWCNT-instilled mice were treated with Rosiglitazone (ROSI). Rosi reduces miR27b expression in alveolar macrophages. Relative fold change was calculated. N = number of animals.

4. Discussion

Our previous studies have shown that oropharyngeal exposure of MWCNT induces pulmonary granulomas in C57BL/6J mice, which replicate several biologically relevant pathways in human sarcoidosis making it an attractive model to study the role of alveolar macrophages in the development of chronic pulmonary granulomatous inflammation (Huizar et al. 2011; Mohan et al. 2018). We also previously demonstrated that granulomatous inflammation in sarcoidosis patients as well as MWCNT instillation in mice were associated with downregulation of a central regulator of lipid metabolism, PPARγ, with subsequent accumulation of intracellular lipids in alveolar macrophages (Barna et al. 2016; Huizar et al. 2013). PPARγ is a transcription factor that regulates the expression of genes involved in fatty acid metabolism and antioxidant responses of macrophages (Kim and Yang 2013; Ye et al. 2019). PPARγ expression is regulated by miR-27b, which is known to induce oxidative stress and apoptosis (Jennewein et al. 2010; Liang et al. 2018). In the present study, we demonstrated MWCNT instillation: (1) reduced mitochondrial mass, membrane potential, and FAO in alveolar macrophages, (2) elevated oxidative stress in alveolar macrophages, BAL fluid, and lung tissues, (3) increased apoptotic cells in BAL and lung tissues, and (4) increased miR-27b expression in alveolar macrophages. In sum, these findings suggest a possible role of impaired mitochondrial function in the chronic activation of alveolar macrophages by MWCNT and the development of chronic pulmonary granulomatous inflammation.

Our current findings show for the first time that MWCNT increased miR-27b expression and reduced mitochondrial FAO in alveolar macrophages. Several studies have reported that miR-27b and its downstream target, PPARγ, control the intracellular levels of free fatty acid (Castano et al. 2018; Jennewein et al. 2010; Ye et al. 2019). PPARγ attenuates intracellular fatty acid accumulation by reducing FFA influx and more importantly by increasing mitochondrial FAO. Previous studies have shown that activation of PPARγ increases the expression of genes involved in the fatty acid oxidation pathway, including carnitine palmitoyltransferase-1 and -2 (CPT1 and CPT2) (Sharma et al. 2012). In addition, PPARγ also increased the expression of factors involved in mitochondrial biogenesis, including peroxisome proliferator-activated receptor (PPAR)-γ coactivator-1α (PPARGC1A) (Bogacka et al. 2005).

The current and previous studies suggest that PPARγ downregulation and FAO alteration contribute to the granulomatous lung disease. Our previous studies have shown that the use of PPARγ agonist (rosiglitazone) reduced granulomatous inflammation and lipid accumulation induced by MWCNT indicating that PPARγ deficiency contributes to granuloma formation. This effect was observed 20D post-instillation i.e. before the formation of persistent well-formed granulomas (60D post-instillation) (McPeek et al. 2018). Moreover, the use of macrophages specific PPARγ-deficient mice promoted granuloma formation by MWCNT (Huizar et al. 2013). Given that PPARγ is an important regulator for FAO oxidation, it is suggested that FAO oxidation alteration is an earlier event than granuloma formation.

Previous studies of peripheral blood monocytes of sarcoidosis patients have suggested dysregulation in fatty acid metabolism pathways when compared to healthy monocytes (Talreja et al. 2017). However, results from a tuberous sclerosis 2 (Tsc2)- deficient mouse model, granuloma progression was associated with increased mitochondrial fatty acid metabolism in bone marrow derived macrophages (BMDM) (Linke et al. 2017). Given the fact that myeloid Tsc2 deficiency produced spontaneous pulmonary granulomas in mice, the nature of these granulomas may be different from granulomas induced by instillation of MWCNT. Thus, mitochondrial bioenergetics of BMDM of Tsc2-deficient mice may also differ from those of alveolar macrophages of MWCNT-instilled mice.

Since miR-27b is known to reduce the expression of PPARγ, we speculate that elevation of miR-27b by MWCNT causes a reduction in PPARγ expression, which in turn reduces mitochondrial FAO in alveolar macrophages of MWCNT-instilled mice. Moreover, given that MWCNT did not disrupt mitochondria membranes as evidenced by TEM, the observed reduction in mitochondrial mass may be attributed to the downregulation of PPARγ and PPARGC1A in alveolar macrophages.

MiR-27b plays an important role in various physiological and pathological processes by targeting genes involved in inflammatory response, oxidative stress, and apoptosis. Liang et al. demonstrated that overexpression of miR-27b increased ROS production and induced apoptosis in macrophages infected with M. tuberculosis (Liang et al. 2018). The role of miR-27b and pulmonary oxidative stress in chronic pulmonary granulomatous inflammation has not been previously investigated. However, apoptotic cells were previously observed within the lung granulomas and in the BAL cells of pulmonary sarcoidosis patients (Kunitake et al. 1999). Herein, we found that MWCNT increased miR-27b expression in alveolar macrophages and induced oxidative stress and apoptosis in both alveolar macrophages and lung tissues. These results suggest that MWCNT-induced upregulation of miR-27b may contribute to the induction of oxidative stress and apoptosis in murine model of chronic pulmonary granulomatous inflammation. However, additional studies involving miR-27b mimics/inhibitors will further enable investigation into its role in regulating oxidative stress and apoptosis.

Based on in vitro studies macrophage activation has been defined as M1 (pro-inflammatory) and M2 (anti-inflammatory), but recent observations have suggested that the in vivo state may be more complex with a continuum with the presence of both types (Murray et al. 2014). Our previous studies and supplemental figure 1 (Figure S1) have revealed that MWCNT instillation increased the expression of genes associated with both M1 (IFN-T, IL6 and IL12B) and M2 (CCL2, FIZZ1, ARG1, IL10) in alveolar macrophages (Maluretal. 2015). Consistent with these findings, granulomatous tissues of sarcoidosis patients and MWCNT-instilled mice also showed increase in both M1 and M2 macrophage phenotypes (Huizar et al. 2011; Shamaei et al. 2018). Since PPARγ and FAO are involved in the inhibition of M1 pro-inflammatory cytokine production (Namgaladze and Brune 2016; Remmerie and Scott 2018; Ricote et al. 1998), the chronic activation of M1 macrophages in MWCNT-induced granulomatous inflammation might be attributed to the downregulation of PPARγ expression and subsequent reduction in FAO. On the other hand, the presence of M2 phenotype of alveolar macrophages might be due to the presence of apoptotic cells. This suggestion is supported by previous studies which reported that the recognition of apoptotic cells by M1 macrophages results in activation of M2 phenotypes because they have higher capability of clearing apoptotic cells than M1 (Zhong et al. 2018). Interestingly, inhibition of FAO does not inhibit M2 activation (Gonzalez-Hurtado et al. 2017). Therefore, it is not surprising to observe both M1 and M2 phenotypes in MWCNT-induced granulomatous inflammation.

Based on the results obtained from our studies, we propose a model that highlights the role of miR-27b in MWCNT-induced chronic granulomatous inflammation (Figure 7). Under normal circumstances, alveolar macrophages express high levels of PPARγ, which regulates mitochondrial FAO and maintains intracellular redox balance. MWCNT instillation increases miR-27b expression, which in turn might reduce PPARγ expression. Downregulation of PPARγ results in increased lipid accumulation and decreased mitochondrial FAO in alveolar macrophages and indeed activation of M1 alveolar macrophages. On the other hand, elevated miR-27b expression increases ROS production and apoptosis resulting in activation of M2 alveolar macrophages. Both M1 and M2 phenotypes of alveolar macrophages are involved in chronic pulmonary granulomatous inflammation (Figure 9).

5. Conclusions

In this study, we showed that MWCNT increased the expression of miR-27b, which regulates the expression of PPARγ and is known to induce oxidative stress and apoptosis. The upregulation of miR-27b expression is suggested to decrease mitochondrial FAO via pathways downregulating PPARγ expression and inducing apoptosis resulting in activation of both M1 and M2 phenotypes of alveolar macrophages. Even though the current study suggests a possible role in miR-27b and mitochondrial dysfunction in the MWCNT-induced activation of alveolar macrophages in chronic granulomatous inflammation, future studies are needed to verify this role.

Figure 8: Schematic representation of mitochondrial function and miR-27b in MWCNT-induced granulomatous inflammation.

Under normal circumstances, alveolar macrophages express high levels of PPARγ, which regulates mitochondrial FAO and maintains intracellular redox balance. MWCNT instillation increases miR-27b expression, which in turn might reduce PPARγ expression. Downregulation of PPARγ results in an increase in lipid accumulation and a decrease in mitochondrial FAO in alveolar macrophages and indeed activation of M1 alveolar macrophages. On the other hand, elevated miR-27b expression might increase ROS production and apoptosis resulting in activation of M2 alveolar macrophages. Both M1 and M2 phenotypes of alveolar macrophages are involved in chronic pulmonary granulomatous inflammation. Scheme was created with BioRender.com.

Highlights.

• MWCNT induces chronic pulmonary granulomatous inflammation

• MWCNT reduces mitochondrial fatty acid oxidation in alveolar macrophages

• MWCNT induces pulmonary oxidative stress and apoptosis.

• MWCNT increases miR-27b expression in alveolar macrophages.