Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Nov 3.
Published in final edited form as: Am J Med Genet A. 2018 Nov 18;176(12):2887–2891. doi: 10.1002/ajmg.a.40647

Autosomal recessive Stickler syndrome resulting from a COL9A3 mutation

Andrea Hanson-Kahn 1, Bing Li 2, Daniel H Cohn 2,3,4, Deborah A Nickerson 5,7, Michael J Bamshad 5,6; University of Washington Center for Mendelian Genomics7, Louanne Hudgins 1
PMCID: PMC7608529  NIHMSID: NIHMS1634377  PMID: 30450842

Abstract

Stickler syndrome is a connective tissue disorder characterized by hearing loss, ocular anomalies, palatal defects, and skeletal abnormalities. The autosomal dominant form is the most common, but autosomal recessive forms have also been described. We report the second case of autosomal recessive Stickler syndrome due to homozygosity for a loss of function mutation in COL9A3, which encodes the α3 chain of type IX procollagen. The clinical features were similar to the previously described COL9A3 Stickler syndrome family, including moderate to severe sensorineural hearing loss, high myopia, and both tibial and femoral bowing at birth. Radiographs demonstrated abnormal capital femoral epiphyses and mild irregularities of the vertebral endplates. This case further establishes the phenotype associated with mutations in this gene. We suggest that loss of the α3 chain of type IX collagen results in a Stickler syndrome phenotype similar to that of the other autosomal recessive forms caused by mutations in genes encoding the α1 and α2 chains of type IX collagen.

Keywords: autosomal recessive, COL9A3, Stickler syndrome, type IX procollagen

1 |. INTRODUCTION

Stickler syndrome is a genetically heterogeneous connective tissue disorder first described in 1965 (Stickler et al., 1965). There is substantial inter and intrafamilial variability, with the features most commonly associated including sensorineural hearing loss, high myopia, retinal detachment, vitreous anomalies, cataracts, midface hypoplasia, palatal defects, joint hypermobility, and early onset osteoarthritis.

Both autosomal dominant and autosomal recessive forms have been described, all resulting from mutations in genes encoding procollagens that are primarily expressed in cartilage. The autosomal dominant form is most common, with 80–90% of the cases caused by heterozygosity for mutations in COL2A1 (Ahmad et al., 1991; Lieberfarb et al., 2003), which encodes type II procollagen. Mutations in the type XI procollagen gene, COL11A1, account for additional autosomal dominant cases (Majava et al., 2007; Richards et al., 1996) and mutations in COL11A2 cause autosomal dominant OSMED[A] syndrome, formerly known as nonocular Stickler syndrome (Pihlajamaa et al., 1998; Spranger, 1998).

Four families have been described with autosomal recessive Stickler syndrome due to mutations in the COL11A1 type XI procollagen gene (Alzahrani, Alshammari, & Alkuraya, 2012; Richards et al., 2013). Five families have been described with autosomal recessive Stickler syndrome due to homozygosity for loss-of-function mutations in the COL9A1 and COL9A2 type IX procollagen genes (Baker et al., 2011; Nikopoulos et al., 2011; Van Camp et al., 2006) and, more recently, COL9A3 (Faletra et al., 2014).

Autosomal recessive mutations in COL11A2 have also been associated with OSMED[B] syndrome (Temtamy et al., 2006; Vikkula et al., 1995), an osteochondrodysplasia with features that overlap with both the autosomal dominant and autosomal recessive forms of Stickler syndrome. Variants in COL9A3 have previously been associated with autosomal dominant multiple epiphyseal dysplasia (Jeong et al., 2014; Nakashima et al., 2005; Paassilta et al., 1999), adult onset autosomal dominant sensorineural hearing loss (Asamura, Abe, Fukuoka, Nakamura, & Usami, 2005), and increased risk for lumbar disc disease (Paassilta et al., 2001). We report the second family with autosomal recessive Stickler syndrome resulting from a mutation in COL9A3 and compare the phenotype to the other autosomal recessive forms caused by mutations in COL9A1, COL9A2, and COL11A1.

2 |. MATERIALS AND METHODS

2.1 |. Case report

The patient, International Skeletal Dysplasia Registry reference number R08–308A, was born to a 31-year-old G2 P1–2 mother and 33-year-old father via Caesarean section due to failure to progress. The pregnancy was uncomplicated and prenatal ultrasounds were normal. Birth weight was 7 lbs 5 oz (75–90th %ile) and birth length was 19 in. (50–75th %ile).

The patient failed his newborn hearing screen. Audiology evaluation at 5 months identified moderate to severe sensorineural hearing loss on the right from 250 through 4,000 Hz and severe sensorineural hearing loss on the left from 250 through 4,000 Hz. Hearing loss has been stable. A head CT of the temporal bones at 7 months was negative apart from mild enlargement of the vestibular aqueducts.

Ophthalmological evaluation at 5 months showed no evidence of myopia. However, by 2 years, he had developed myopia of −6.75 OD and −8 OS. By 12 years, this had progressed to −10.75 OD and −11.25 OS. No vitreous abnormalities have been noted.

Femoral and tibial bowing were noted at birth. Radiographs at 6 years demonstrated slightly flattened proximal femoral epiphyses, normal knee epiphyses, and mild platyspondyly (Figure 1). Growth parameters have been in the normal range.

FIGURE 1.

FIGURE 1

Open in a new tab

Radiographs at age 6. (a) Flattening of the acetabula and slightly flattened proximal femoral epiphyses. (b) Mild platyspondyly. (c) Irregularity of the medial distal femoral epiphyses

The patient also had autoimmune hypothyroidism that was identified at 10 years. Gross motor development has been normal. Speech was initially delayed but was thought to be related to hearing loss. Intelligence was normal. Clinical features are summarized in Table 1.

TABLE 1.

Clinical features associated with autosomal recessive Stickler syndrome

COL9A1 COL9A1 COL9A2 COL9A3 COL11A1 COL9A3
Van Camp et al. (2006) Nikopoulos et al. (2011) Baker et al. (2011) Faletra et al. (2014) Alzahrani et al. (2012); Richards et al. (2013) Our patient
Craniofacial
Midfacial hypoplasia + + + + − +
Cleft palate − − − − + −
Ophthalmologic
Myopia + + + + + +
Retinal degeneration + + + − − −
Vitreous anomalies + + + − + −
Other Amblyopia, astigmatism Amblyopia, cataracts Amblyopia, astigmatism
Hearing
Sensorineural hearing loss + (mod-severe) + (mild-mod) + (mild-mod) + (mod-severe) + (severe-profound) +
Orthopedic
Pes planus + + + + − −
Epiphyseal changes + + − + − +
Other Genu valga, platyspondyly Scoliosis, degenerative disc changes, coxa vara Tibial rotation Tibial bowing
Open in a new tab

+ = present; − = absent.

Connexin 26 sequencing identified heterozygosity for a 380G>A (R127H) variant. A second variant in the gene was not identified. Testing for the common deletion in connexin 30 was negative. The patient was heterozygous for a variant in the SLC6A4 gene (IVS13 1,544 + 9 C>C/T). Sequence and deletion/duplication analysis of COL2A1, COL11A1, and COL11A2 were negative. Sequence and deletion/duplication analysis of specific exons in COL9A1, COL9A2, and COL9A3 were also negative.

The parents of the patient are third cousins from India. The patient has one older sister. There is no report of hearing loss, myopia, other ocular anomalies, or skeletal anomalies in either parent or in the sister. Neither the parents nor the sister have been examined for features suggestive of an osteochondrodysplasia, nor have they had audiology or ophthalmology evaluations or had radiographs taken. A paternal cousin had moderate hearing loss with onset in adolescence of unknown etiology. Family history was otherwise noncontributory.

2.2 |. Exome sequencing

Exome sequence analysis was performed at the University of Washington Center for Mendelian Genomics using DNA derived from blood from the R08–308 family members. The exome sequencing library was prepared with the NimbleGen SeqCap EZ Exome Library v2.0 kit and sequenced on the Illumina Genome Analyzer IIx platform. Reads were mapped to the human reference genome (NCBI build 37) with BWA (Li & Durbin, 2009) and variants were called with the Genome Analysis Toolkit following their Best Practices recommendations (McKenna et al., 2010). The variants were filtered as described previously (Taylor et al., 2015) and annotated with the SeattleSeq138 Annotation Server. The variant in COL9A3 identified in the family was confirmed by Sanger sequencing with DNA from the proband, parents and an unaffected sibling. Primer sequences used were: COL9A3-exon 13, F: 5′- CTTGGGCTTGAGTAGGGTGACT −3′; R: 5′- GGTAGATATGTGCAGGGCTTGAT −3′.

3 |. RESULTS

In consanguineous Stickler syndrome family R08–308, exome sequencing was used to identify homozygosity for single base duplication c.650dupC in exon 13 of COL9A3 (RefSeq accession number NM_001853.3) of the proband. The frameshift mutation predicts premature termination of translation and absence of the COL9A3 gene product. The nucleotide change was not found in public SNP databases, suggesting that it was unique to the family. Genotyping of the parents and an unaffected sibling showed that all of them were heterozygous for the sequence change (Figure 2).

FIGURE 2.

FIGURE 2

Open in a new tab

COL9A3 mutation in family R08–308. Electropherogram representation of genomic DNA fragments from the patient family members and an unaffected person (control). From top to bottom, an unaffected person, proband, mother, father, and an unaffected sibling. The human reference sequence is shown on top. The location of the single base insertion is indicated by arrows

4 |. DISCUSSION

As in the case described here, the three siblings with autosomal recessive Stickler syndrome described by Faletra et al. (2014) were homozygous for a loss-of-function mutation in COL9A3. The phenotype consisted of moderate to severe sensorineural hearing loss, high myopia, normal vitreous, midface hypoplasia, tibial rotation, mild irregularities of the capital femoral and metacarpal epiphyses, and pes planus. The patients also had moderate to severe intellectual disability, which the authors suggested was unrelated to the COL9A3 mutations.

The features of the patient described here were similar, including moderate to severe sensorineural hearing loss, high myopia, normal vitreous, tibial, and femoral bowing at birth and mild capital femoral epiphyseal flattening. In addition, he had mild platyspondyly with irregularities of the vertebral endplates. Hand radiographs were not available, so we do not know whether there was involvement of the metacarpal epiphyses.

Six families, comprising 12 known cases, have been reported with autosomal recessive Stickler syndrome resulting from homozygosity for loss-of-function mutations in the COL9A1, COL9A2, or COL9A3 genes. Based on studies in the knockout mouse, loss of Col9a1 leads to absence of type IX collagen in cartilage (Hagg et al., 1997) and a similar consequence has been assumed for loss of the α2(IX) or α3 (IX) chains. This inference is supported by the Stickler syndrome phenotype resulting from the loss-of-function mutations in the corresponding human orthologues. Consequently, it is perhaps not surprising that the clinical phenotypes among these autosomal recessive forms of the disorder are similar.

All of the Stickler syndrome patients with type IX collagen defects have exhibited high myopia, midface hypoplasia, and mild–severe hearing loss. Vitreous and retinal degeneration have been reported in patients with mutations in COL9A1 and COL9A2, but have not been reported in patients with mutations in COL9A3.

The phenotype of these patients also appears to be distinct from that of the autosomal recessive form of Stickler syndrome caused by mutations in COL11A1. The patients described by Richards et al. (2013) and Alzahrani et al. (2012) have sensorineural hearing loss, myopia, vitreous abnormalities, and cleft palate. In contrast to patients with type IX collagen defects, the hearing loss is severe-profound. Midfacial hypoplasia and orthopedic issues have not been described.

In conclusion, we report the second family with autosomal recessive Stickler syndrome due to homozygosity for a loss-of-function mutation in COL9A3 and further establish the phenotype associated with mutations in this gene. We suggest that loss of the α3 chain of type IX collagen results in a Stickler syndrome phenotype similar to that of the other autosomal recessive forms caused by mutations in the genes encoding the α1 and α2 chains of type IX collagen.

ACKNOWLEDGMENTS

We thank the family for participating in this study. This work was supported in part by the National Institute of Dental and Craniofacial Research (NIDCR) and the National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS) of the National Institutes of Health under Award Numbers R01AR062651 and RO1AR066124. Sequencing was provided by the University of Washington Center for Mendelian Genomics (UW CMG) which is funded by the National Human Genome Research Institute (NHGRI) and the National Heart, Lung and Blood Institute (NHLBI) Award HG006493. We also thank the March of Dimes Foundation, the Joseph Drown Foundation, and the Orthopaedic Institute for Children for their support of the International Skeletal Dysplasia Registry.

Funding information

National Institute of Dental and Craniofacial Research (NIDCR) and the National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS) of the National Institutes of Health under, Grant/Award Numbers: R01AR062651, RO1AR066124; University of Washington Center for Mendelian Genomics (UW CMG) which is funded by the National Human Genome Research Institute (NHGRI) and the National Heart, Lung and Blood Institute (NHLBI), Grant/Award Number: HG006493

REFERENCES

  1. Ahmad NN, Ala-Kokko L, Knowlton RG, Jimenez SA, Weaver EK, Maguire JI, … Prockop DJ (1991). Stop codon in the procollagen II gene (COL2A1) in a family with the stickler syndrome (arthro-ophthalmopathy). Proceedings of the National Academy of Sciences of the United States of America, 88, 6624–6627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alzahrani F, Alshammari MJ, & Alkuraya FS (2012). Molecular pathogenesis of fibrochondrogenesis: Is it really simple COL11A1 deficiency? Gene, 511, 480–481. [DOI] [PubMed] [Google Scholar]
  3. Asamura K, Abe S, Fukuoka H, Nakamura Y, & Usami S (2005). Mutation analysis of COL9A3, a gene highly expressed in the cochlea, in hearing loss patients. Auris Nasu Larynx, 32, 113–117. [DOI] [PubMed] [Google Scholar]
  4. Baker S, Booth C, Fillman C, Shapiro M, Blair MP, Hyland JC, & Ala-Kokko L (2011). A loss of function mutation in the COL9A2 gene causes autosomal recessive stickler syndrome. American Journal of Medical Genetics. Part A, 155A, 1668–1672. [DOI] [PubMed] [Google Scholar]
  5. Faletra F, D’Adamo AP, Bruno I, Athanasakis E, Biskup S, Esposito L, & Gasparini P (2014). Autosomal recessive stickler syndrome due to a loss of function mutation in the COL9A3 gene. American Journal of Medical Genetics. Part A, 164A, 42–47. [DOI] [PubMed] [Google Scholar]
  6. Hagg R, Hedbom E, Mollers U, Aszodi A, Fassler R, & Bruckner P (1997). Absence of the alpha1(IX) chain leads to a functional knock-out of the entire collagen IX protein in mice. The Journal of Biological Chemistry, 272, 20650–20654. [DOI] [PubMed] [Google Scholar]
  7. Jeong C, Lee JY, Kim J, Chae H, Park HI, Kim M, … Jung J (2014). Novel COL9A3 mutation in a family diagnosed with multiple epiphyseal dysplasia: A case report. BMC Musculoskeletal Disorders, 15, 371–376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Li H, & Durbin R (2009). Fast and accurate short read alignment with burrows-wheeler transform. Bioinformatics, 25, 1754–1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Lieberfarb RM, Levy HP, Rose PS, Wilkin DJ, Davis J, Balog JZ, … Rubin BI (2003). The stickler syndrome: Genotype/phenotype correlation in 10 families with stickler syndrome resulting from seven mutations in the type II collagen gene locus COL2A1. Genetics in Medicine, 5, 21–27. [DOI] [PubMed] [Google Scholar]
  10. Majava M, Hoornaert KP, Bartholdi D, Bouma MC, Bouman K, Carrera M, … Mortier GR (2007). A report on 10 new patients with heterozygous mutations in the COL11A1 gene and a review of genotype-phenotype correlations in type XI collagenopathies. American Journal of Medical Genetics. Part A, 143A, 258–264. [DOI] [PubMed] [Google Scholar]
  11. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, … DePristo MA (2010). The genome analysis toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Research, 20, 1297–1303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Nakashima E, Kitoh H, Maeda K, Haga N, Kosaki R, Mabuchi A, … Ikegawa S (2005). Novel COL9A3 mutation in a family with multiple epiphyseal dysplasia. American Journal of Medical Genetics. Part A, 132A, 181–184. [DOI] [PubMed] [Google Scholar]
  13. Nikopoulos K, Schrauwen I, Simon M, Collin RW, Veckeneer M, Keymolen K, … van den Born LI (2011). Autosomal recessive Stickler syndrome in two families is caused by mutations in the COL9A1 gene. Investigative Ophthalmology & Visual Science, 52, 4774–4769. [DOI] [PubMed] [Google Scholar]
  14. Paassilta P, Lohiniva J, Annunen S, Bonaventure J, Le Merrer M, Pai L, & Ala-Kokko L (1999). COL9A3: A third locus for multiple epiphyseal dysplasia. American Journal of Human Genetics, 64, 1036–1044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Paassilta P, Lohiniva J, Göring HH, Perälä M, Räinä SS, Karppinen J, … Ala-Kokko L (2001). Identification of a novel common genetic risk factor for lumbar disk disease. JAMA, 285, 1843–1849. [DOI] [PubMed] [Google Scholar]
  16. Pihlajamaa T, Prockop DJ, Faber J, Winterpacht A, Zabel B, Giedion A, … Ala-Kokko L (1998). Heterozygous glycine substitution in the COL11A2 gene in the original patient with the Weissenbacher-Zweymuller syndrome demonstrates its identity with heterozygous OSMED (nonocular Stickler syndrome). American Journal of Medical Genetics, 80, 115–120. [DOI] [PubMed] [Google Scholar]
  17. Richards AJ, Fincham GS, McNinch A, Hill D, Poulson AV, Castle B, … Snead MP (2013). Alternative splicing modifies the effect of mutations in COL11A1 and results in recessive type 2 Stickler syndrome with profound hearing loss. Journal of Medical Genetics, 50, 765–771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Richards AJ, Yates JR, Williams R, Payne SJ, Pope FM, Scott JD, & Snead MP (1996). A family with stickler syndrome type 2 has a mutation in the COL11A1 gene resulting in the substitution of glycine 97 by valine in alpha 1(XI) collagen. Human Molecular Genetics, 5, 1339–1343. [DOI] [PubMed] [Google Scholar]
  19. Spranger J (1998). The type XI collagenopathies. Pediatric Radiology, 28, 745–750. [DOI] [PubMed] [Google Scholar]
  20. Stickler GB, Belau PG, Farrell FJ, Jones JD, Pugh DG, Steinberg AG, & Ward LE (1965). Hereditary progressive arthro-ophthalmopathy. Mayo Clinic Proceedings, 40, 433–455. [PubMed] [Google Scholar]
  21. Taylor SP, Dantas TJ, Duran I, Wu SL, Lachman RS, Nelson SF, … Geno UWCM (2015). Mutations in DYNC2LI1 disrupt cilia function and cause short rib polydactyly syndrome. Nature Communications, 6, 7092–7115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Temtamy SA, Mannikko M, Abdel-Salam GM, Hassan NA, Ala-Kokko L, & Afifi HH (2006). Oto-spondylo-metaepiphyseal dysplasia (OSMED): Clinical and radiological findings in sibs homozygous for premature stop codon mutation in the COL11A2 gene. American Journal of Medical Genetics. Part A, 140, 1189–1195. [DOI] [PubMed] [Google Scholar]
  23. Van Camp G, Snoeckx RL, Hilgert N, van den Ende J, Fukuoka H, Wagatsuma M, … Usami S (2006). A new autosomal recessive form of Stickler syndrome is caused by a mutation in the COL9A1 gene. American Journal of Human Genetics, 79, 449–457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Vikkula M, Mariman EC, Lui VC, Zhidkova NI, Tiller GE, Goldring MB, … Brunner HG (1995). Autosomal dominant and recessive osteochondrodysplasias associated with the COL11A2 locus. Cell, 80, 431–437. [DOI] [PubMed] [Google Scholar]

RESOURCES