Skip to main content
PLOS One logoLink to PLOS One
. 2020 Nov 3;15(11):e0240885. doi: 10.1371/journal.pone.0240885

Whole egg consumption increases gene expression within the glutathione pathway in the liver of Zucker Diabetic Fatty rats

Joe L Webb 1,2,#, Amanda E Bries 1,2,#, Brooke Vogel 1, Claudia Carrillo 1, Lily Harvison 1, Timothy A Day 3, Michael J Kimber 3, Rudy J Valentine 4, Matthew J Rowling 1,2, Stephanie Clark 1, Elizabeth M McNeill 1,2,5, Kevin L Schalinske 1,2,*
Editor: Marcia B Aguila6
PMCID: PMC7608885  PMID: 33141822

Abstract

Nutrigenomic evidence supports the idea that Type 2 Diabetes Mellitus (T2DM) arises due to the interactions between the transcriptome, individual genetic profiles, lifestyle, and diet. Since eggs are a nutrient dense food containing bioactive ingredients that modify gene expression, our goal was to examine the role of whole egg consumption on the transcriptome during T2DM. We analyzed whether whole egg consumption in Zucker Diabetic Fatty (ZDF) rats alters microRNA and mRNA expression across the adipose, liver, kidney, and prefrontal cortex tissue. Male ZDF (fa/fa) rats (n = 12) and their lean controls (fa/+) (n = 12) were obtained at 6 wk of age. Rats had ad libitum access to water and were randomly assigned to a modified semi-purified AIN93G casein-based diet or a whole egg-based diet, both providing 20% protein (w/w). TotalRNA libraries were prepared using QuantSeq 3' mRNA-Seq and Lexogen smallRNA library prep kits and were further sequenced on an Illumina HighSeq3000. Differential gene expression was conducted using DESeq2 in R and Benjamini-Hochberg adjusted P-values controlling for false discovery rate at 5%. We identified 9 microRNAs and 583 genes that were differentially expressed in response to 8 wk of consuming whole egg-based diets. Kyto Encyclopedia of Genes and Genomes/Gene ontology pathway analyses demonstrated that 12 genes in the glutathione metabolism pathway were upregulated in the liver and kidney of ZDF rats fed whole egg. Whole egg consumption primarily altered glutathione pathways such as conjugation, methylation, glucuronidation, and detoxification of reactive oxygen species. These pathways are often negatively affected during T2DM, therefore this data provides unique insight into the nutrigenomic response of dietary whole egg consumption during the progression of T2DM.

Introduction

Type 2 Diabetes Mellitus (T2DM) is an insulin independent metabolic disease characterized by chronic hyperglycemia and concomitant insulin resistance and it is estimated that greater than 415 million adults worldwide have T2DM [1]. Oxidative stress is a potential key mediator in the pathogenesis of T2DM and may underlie the progressive development of hyperglycemia and insulin resistance [2]. More specifically, reports demonstrate that glutathione (a major intracellular antioxidant) enzymes are diminished in the liver and brain of T2DM animal models [3]. Sekhar and colleagues examined the ability of patients with uncontrolled and controlled T2DM to synthesize glutathione via measuring isotopically labelled glycine [4]. They reported that patients with uncontrolled T2DM were severely deficient in the ability to maintain glutathione metabolism in cardiac tissue [5], which may be, in part, due to hyperglycemia decreasing L-cysteine concentrations [6] and the reduced flux of methionine to cysteine [7]. Because of the deleterious effects of hyperglycemia on organ function, it is important to consider the global transcriptomic effects of T2DM. Similar to humans, the Zucker Diabetic Fatty (ZDF) rat model of T2DM also displays increased oxidative stress [8], whereby endogenous protective antioxidants like glutathione are similarly downregulated in ZDF rats [9]. The gene expression profiles in animal models of T2DM, such as the ZDF rat, is consistent with gene expression profiles of humans with T2DM [8], making this a suitable model to explore the global gene expression effects of diet in the ZDF rat.

Dietary treatments with bioactive foods such as cocoa or Shenyuan granules [9, 10] in ZDF rats have been shown to reduce oxidative stress or attenuate renal injury in the presence of T2DM-related nephropathy [11]. Consumption of eggs as a bioactive food during T2DM in humans remains controversial [1215], but eggs have been shown to display antioxidative properties, which may be beneficial during the progression of T2DM [16]. Additionally, our laboratory has consistently reported that long-term whole egg (WE) consumption improves metabolic parameters during T2DM such as the maintenance of circulating vitamin D concentrations, decreased weight gain, and nephroprotection via reduced proteinuria in male ZDF rats [17, 18]. These are important findings, as vitamin D deficiency, increased adiposity, and kidney failure have collectively been suggested to exacerbate oxidative stress during T2DM [19].

While the literature surrounding the effects of dietary WE on insulin resistance during T2DM is inconclusive in both rodent [20] and human population studies [21], there are no studies to date examining the molecular mechanisms underlying how WE consumption affects the transcriptome across multiple tissues. Longitudinal, prospective, and comprehensive meta-analyses have been performed to assess the independent risk factors of increased dietary egg consumption on chronic diseases [22, 23]. Because of the highly controversial science of whole egg consumption on increased cardiovascular disease in patients with T2DM, it is important to examine the possible underlying molecular targets and drivers of whole egg consumption on disease. Ultimately, analyzing the transcriptomic impact of egg consumption would provide us with a better understanding of the nutrigenomic actions that dietary egg consumption contributes to T2DM, and bridge the gap in our understanding of how whole eggs may affect the physiological progression of T2DM. Therefore, the objective of this study was to determine the influence of WE consumption on gene and microRNA expression profiles in a ZDF rat model of progressive T2DM. We examined the transcriptomes from the adipose, liver, kidney, and prefrontal cortex (PFC) tissues to determine how WE consumption alters gene expression and examined whether these changes correspond to altered microRNA expression profiles in T2DM.

Results and discussion

Whole eggs have predominantly been criticized for their associated risk of developing chronic diseases [24], yet the benefits of WE consumption have also been reported [13]. For instance, several groups have suggested that WE provide antioxidant properties [13, 25], either through antioxidant peptides in the egg yolk [11] or other reactive oxygen species-reducing nutrients [26]. Other studies examining the role of quail egg consumption in rat models of T2DM have demonstrated upregulation of glutathione metabolism in alloxan-induced T2DM in Wistar rats [25] and improved oxidative stress profiles in streptozotocin-injected rats [27]. Raza and colleagues [27] identified that in diabetic rat liver glutathione content and glutathione S-transferase (GST) activity were decreased 65% while also observing that brain glutathione and GST activity were increased two-fold as a result of a T2DM phenotype.

Total RNASeq differential expression

When comparing the WE versus casein (CAS) in ZDF rats and their lean controls, differential expression analyses of the mRNAseq data resulted in 583 differentially expressed genes (DEGs) across four tissues in both genotypes (Table 1). S1 Table contains the results from DESeq2 with the results for each gene across all four tissues with data on individual genes. S2 Table contains raw mRNA read counts for each tissue and rat across both genotypes. Among the lean controls, 13 genes were differentially expressed in the adipose tissue, 32 in the liver, and 6 in the kidney. Notably, none of the genes were differentially expressed in the PFC between dietary treatments in the lean rats. In the ZDF rats, dietary WE consumption resulted in 532 total DEGs across all tissues where 50 genes were differentially expressed in adipose tissue, 474 in the liver, 6 in the kidney and 2 genes in the PFC following multiple testing correction using the false discovery rate (FDR) threshold of 5%. We demonstrated that consuming WE-based diets for 8 wk resulted in significant alterations in oxidative stress pathways, as well as glutathione metabolism pathways. While there were tissue-specific changes in gene expression, glutathione metabolism was altered in the kidney and liver among ZDF rats, and in the kidney of lean controls were significantly upregulated. Overall, these data highlight how consumption of WE-based diets can provide beneficial effects through modifying gene expression of oxidative reduction targets.

Table 1. Differentially expressed genes in the liver, kidney, adipose and PFC tissues stratified according to each genotype1-3.

Genotype Tissue Ensembl_ID (ENSRNO) Symbol Gene Name L2FC P-value3
ZDF Adipose Downregulated G00000011039 Gch1 GTP cyclohydrolase 1 -2.71 2.1E-05
G00000040108 RGD1565355 similar to fatty acid translocase/CD36 -2.65 2.7E-07
G00000011024 Zdhhc20 zinc finger DHHC-type palmitoyltransferase 20 -2.49 1.2E-04
G00000006946 Arhgap9 Rho GTPase activating protein 9 -2.49 2.6E-06
G00000006715 Ccr1 C-C motif chemokine receptor 1 -2.39 7.4E-06
G00000032546 Dot1l DOT1 like histone lysine methyltransferase -2.12 1.9E-06
G00000034230 Fcrl1 Fc receptor-like 1 -2.09 6.9E-05
G00000019283 P2ry2 purinergic receptor P2Y2 -2.07 1.2E-04
G00000022975 Nfam1 NFAT activating protein with ITAM motif 1 -1.92 3.1E-04
G00000013917 Igsf10 immunoglobulin superfamily, member 10 -1.91 2.4E-05
G00000049115 Ccr5 C-C motif chemokine receptor 5 -1.89 4.3E-07
G00000015895 B4galt6 beta-1,4-galactosyltransferase 6 -1.84 5.1E-05
G00000020479 Pik3c2a phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha -1.83 2.2E-04
G00000061379 C7 complement C7 -1.82 1.8E-04
G00000011927 Sdc3 syndecan 3 -1.82 2.3E-04
G00000026644 Glipr1 GLI pathogenesis-related 1 -1.77 6.4E-05
G00000011946 Ptn pleiotrophin -1.74 4.8E-05
G00000013922 Dok2 docking protein 2 -1.61 2.7E-04
G00000013526 Rassf4 Ras association domain family member 4 -1.60 3.1E-06
G00000001989 Alcam activated leukocyte cell adhesion molecule -1.57 1.5E-05
G00000016643 Lpcat2 lysophosphatidylcholine acyltransferase 2 -1.52 2.9E-04
G00000003835 Slc43a2 solute carrier family 43 member 2 -1.52 1.6E-04
G00000019077 Lipa lipase A, lysosomal acid type -1.51 3.8E-05
G00000009347 Arhgap25 Rho GTPase activating protein 25 -1.49 2.1E-04
G00000000257 Smpd3 sphingomyelin phosphodiesterase 3 -1.47 2.8E-04
G00000012616 Ppt1 palmitoyl-protein thioesterase 1 -1.41 2.7E-04
G00000009331 Hck HCK proto-oncogene, Src family tyrosine kinase -1.30 4.6E-05
G00000010183 Gask1b golgi associated kinase 1B -1.26 2.7E-04
G00000017022 Cerk ceramide kinase -1.25 3.2E-04
G00000008465 Tmem176b transmembrane protein 176B -1.23 2.4E-04
G00000010208 Timp1 TIMP metallopeptidase inhibitor 1 -1.20 1.8E-04
ZDF Adipose Upregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000015072 Ptgr1 prostaglandin reductase 1 1.15 2.2E-04
G00000010389 Ndrg2 NDRG family member 2 1.30 2.0E-04
G00000037446 Pxmp2 peroxisomal membrane protein 2 1.30 2.3E-04
G00000002896 Prdx6 peroxiredoxin 6 1.37 3.1E-04
G00000019328 Phgdh phosphoglycerate dehydrogenase 1.45 3.4E-04
G00000021316 Tmem98 transmembrane protein 98 1.48 2.1E-04
G00000046858 MGC109340 similar to Microsomal signal peptidase 23 kDa subunit (SPase 22 kDa subunit) (SPC22/23) 1.52 9.7E-05
G00000017012 Coq7 coenzyme Q7, hydroxylase 1.56 4.5E-05
G00000021524 Mrap melanocortin 2 receptor accessory protein 1.69 1.6E-04
G00000017226 Slc2a4 solute carrier family 2 member 4 1.87 1.8E-04
G00000002579 Parm1 prostate androgen-regulated mucin-like protein 1 1.89 7.0E-06
G00000001001 Retn resistin 1.95 3.0E-05
G00000008615 Mal2 mal, T-cell differentiation protein 2 2.09 1.6E-04
G00000019412 Rhbg Rh family B glycoprotein 2.12 1.3E-05
G00000009715 Me1 malic enzyme 1 2.13 2.0E-06
G00000012404 Thrsp thyroid hormone responsive 2.43 2.4E-06
G00000019914 Tlcd3b TLC domain containing 3B 2.47 4.8E-10
G00000045636 Fasn fatty acid synthase 3.25 1.7E-11
G00000049911 LOC102556347 carbonyl reductase [NADPH] 1-like 4.33 6.0E-18
Lean Adipose Downregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000016700 Tcf21 transcription factor 21 -2.82 3.2E-06
Lean Adipose Upregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000013733 Ppp4r1 protein phosphatase 4, regulatory subunit 1 2.68 2.4E-05
G00000009536 Pgp phosphoglycolate phosphatase 2.69 3.4E-05
G00000031789 Rangap1 RAN GTPase activating protein 1 2.97 3.9E-05
G00000005082 Irf6 interferon regulatory factor 6 3.25 1.3E-05
G00000031934 Enah ENAH, actin regulator 3.26 2.4E-05
G00000011296 Cenpn centromere protein N 3.34 2.8E-05
G00000056550 Epb41l4b erythrocyte membrane protein band 4.1 like 4B 3.51 1.9E-05
G00000021589 Nexmif neurite extension and migration factor 4.43 2.9E-05
G00000008713 Slc41a2 solute carrier family 41 member 2 4.51 4.8E-07
G00000033262 Reep6 receptor accessory protein 6 4.72 1.0E-05
G00000003098 Prom1 prominin 1 5.25 2.6E-06
G00000015403 Cd52 CD52 molecule 7.66 2.5E-07
ZDF PFC Downregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000033932 AY172581.22–201 AY172581.22–201 -5.21 1.1E-05
G00000032112 AY172581.14 AY172581.14 -4.73 1.5E-05
ZDF PFC Upregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
None
Lean PFC Downregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
None
Lean PFC Upregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
None
ZDF Kidney Downregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000020204 Srp19 signal recognition particle 19 -1.72 3.3E-05
G00000004794 Rtn1 reticulon 1 -2.01 5.1E-05
G00000055471 Ywhah tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta -1.29 5.5E-05
G00000003357 Col3a1 collagen type III alpha 1 chain -1.46 6.4E-05
ZDF Kidney Upregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000018237 Gstp1 glutathione S-transferase pi 1 2.04 5.2E-07
G00000018940 CNT1 solute carrier family 28 member 1 1.65 7.8E-05
Lean Kidney Downregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000020151 Cdh1 cadherin 1 -1.08 1.4E-05
G00000013062 Cyp24a1 cytochrome P450, family 24, subfamily a, polypeptide 1 -1.30 4.3E-06
G00000012956 Tgm2 transglutaminase 2 -1.34 3.5E-05
G00000004019 Phlda1 pleckstrin homology-like domain, family A, member 1 -2.30 2.7E-08
Lean Kidney Upregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000029726 Gstm1 glutathione S-transferase mu 1 1.40 1.5E-05
G00000053811 Arg2 arginase 2 1.51 3.5E-05
G00000000576 Anapc16 anaphase promoting complex subunit 16 2.11 3.3E-05
ZDF Liver Downregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000014320 Inhba inhibin subunit beta A -4.77 3.2E-12
G00000007923 Cgref1 cell growth regulator with EF hand domain 1 -3.74 4.4E-09
G00000004307 Tor3a torsin family 3 -3.55 6.1E-18
G00000034190 Ighm immunoglobulin heavy constant mu -3.38 1.4E-16
G00000003802 Pttg1 PTTG1 regulator of sister chromatid separation -3.35 1.2E-05
G00000007060 Plin2 perilipin 2 -3.31 6.8E-28
G00000045636 Fasn fatty acid synthase -3.31 1.5E-10
G00000022256 Cxcl10 C-X-C motif chemokine ligand 10 -3.30 4.4E-04
G00000009019 Slc6a6 solute carrier family 6 member 6 -3.09 6.0E-11
G00000025691 Pla2g7 phospholipase A2 group VII -3.03 4.5E-06
G00000020035 Cyp17a1 cytochrome P450 -3.00 2.1E-09
G00000020480 Fads1 fatty acid desaturase 1 -2.93 1.5E-13
G00000000658 Acacb acetyl-CoA carboxylase beta -2.91 4.0E-18
G00000030154 Cyp4a2 cytochrome P450 -2.88 5.0E-04
G00000021802 Isg15 ISG15 ubiquitin-like modifier -2.72 2.4E-03
G00000001052 Slc25a30 solute carrier family 25 -2.58 1.8E-09
G00000001963 Mx2 MX dynamin like GTPase 2 -2.56 2.1E-03
G00000040151 Sdr16c6 short chain dehydrogenase/reductase family 16C -2.55 6.3E-04
G00000017914 Cavin3 caveolae associated protein 3 -2.51 1.4E-14
G00000006859 Insig1 insulin induced gene 1 -2.50 3.4E-13
G00000006204 Slc30a3 solute carrier family 30 member 3 -2.47 3.0E-07
G00000016353 Nim1k NIM1 serine/threonine protein kinase -2.40 3.6E-08
G00000016011 Plekhg1 pleckstrin homology and RhoGEF domain containing G1 -2.40 7.8E-05
G00000028137 Mki67 marker of proliferation Ki-67 -2.38 1.5E-04
G00000014476 Evl Enah/Vasp-like -2.37 3.4E-04
G00000008022 Apaf1 apoptotic peptidase activating factor 1 -2.36 7.1E-05
G00000053891 Phf11 PHD finger protein 11 -2.34 6.4E-08
G00000010819 Hspa4l heat shock protein family A (Hsp70) member 4 like -2.32 6.9E-06
G00000021150 Plcb3 phospholipase C beta 3 -2.31 3.1E-05
G00000001414 Serpine1 serpin family E member 1 -2.27 1.2E-04
G00000016924 Acly ATP citrate lyase -2.25 5.5E-17
G00000045560 Gvin1 GTPase -2.25 2.1E-06
G00000020503 Cbln3 cerebellin 3 precursor -2.22 1.4E-06
G00000052444 Samd9 sterile alpha motif domain containing 9 -2.22 3.3E-04
G00000005209 Spred1 sprouty-related -2.21 1.7E-05
G00000010888 Ankrd33b ankyrin repeat domain 33B -2.20 2.1E-06
G00000047218 Clic5 chloride intracellular channel 5 -2.20 1.7E-03
G00000009481 Ddhd1 DDHD domain containing 1 -2.19 2.0E-04
G00000022242 Cxcl9 C-X-C motif chemokine ligand 9 -2.16 1.3E-05
G00000008807 Rp1 RP1 -2.08 4.7E-05
G00000014426 Lox lysyl oxidase -2.07 1.9E-03
G00000015498 Il17rb interleukin 17 receptor B -2.07 2.3E-04
G00000051965 Smad4 SMAD family member 4 -2.07 8.7E-04
G00000017512 Aldh3b1 aldehyde dehydrogenase 3 family -2.05 1.0E-04
G00000057092 Slfn4 schlafen family member 4 -2.05 6.2E-06
G00000012685 Adck1 aarF domain containing kinase 1 -2.04 1.8E-03
G00000011268 Chd5 chromodomain helicase DNA binding protein 5 -2.02 2.3E-03
G00000032374 Paqr9 progestin and adipoQ receptor family member 9 -2.01 3.3E-14
G00000020272 Elapor1 endosome-lysosome associated apoptosis and autophagy regulator 1 -1.97 1.0E-04
G00000061118 LOC102551095 uncharacterized LOC102551095 -1.96 9.6E-05
G00000061527 Gck glucokinase -1.93 4.4E-07
G00000053460 Acot3 acyl-CoA thioesterase 3 -1.91 1.4E-04
G00000005043 Cpeb2 cytoplasmic polyadenylation element binding protein 2 -1.91 2.0E-03
G00000017332 Dapk2 death-associated protein kinase 2 -1.87 3.8E-04
G00000034013 Acaca acetyl-CoA carboxylase alpha -1.86 4.5E-05
G00000017611 Tnp1 transition protein 1 -1.86 2.0E-03
G00000012603 Sestd1 SEC14 and spectrin domain containing 1 -1.85 1.2E-03
G00000025558 Palm2 paralemmin 2 -1.84 5.7E-06
G00000018461 Pdgfrb platelet derived growth factor receptor beta -1.82 1.0E-03
G00000016123 Rnf144b ring finger protein 144B -1.80 5.5E-17
G00000013111 Mettl3 methyltransferase-like 3 -1.78 6.7E-04
G00000045679 Apoa1 apolipoprotein A1 -1.78 1.1E-11
G00000001926 Cldn1 claudin 1 -1.78 1.8E-06
G00000005600 Nr4a2 nuclear receptor subfamily 4 -1.77 4.2E-04
G00000012148 Trio trio Rho guanine nucleotide exchange factor -1.76 7.0E-04
G00000004626 Slc34a2 solute carrier family 34 member 2 -1.76 8.7E-05
G00000009360 Sh3bp1 SH3-domain binding protein 1 -1.74 2.2E-03
G00000010890 Bmp1 bone morphogenetic protein 1 -1.71 1.8E-07
G00000011820 Acp3 acid phosphatase 3 -1.69 1.1E-04
G00000007591 Slc45a3 solute carrier family 45 -1.68 8.9E-05
G00000006170 Bach2 BTB domain and CNC homolog 2 -1.68 1.2E-03
G00000028895 Rtp4 receptor (chemosensory) transporter protein 4 -1.66 5.3E-05
G00000002773 Rgs4 regulator of G-protein signaling 4 -1.65 5.0E-04
G00000007234 Cyp51 cytochrome P450 -1.64 1.2E-09
G00000020918 Ccnd1 cyclin D1 -1.64 7.0E-09
G00000028941 Zbed3 zinc finger -1.63 8.4E-06
G00000012681 Lgals9 galectin 9 -1.63 2.8E-13
G00000001640 Tomm70 translocase of outer mitochondrial membrane 70 -1.63 2.6E-03
G00000009117 Otub2 OTU deubiquitinase -1.62 1.9E-04
G00000005726 Pclo piccolo (presynaptic cytomatrix protein) -1.62 6.2E-04
G00000051171 G6pc glucose-6-phosphatase -1.61 1.6E-04
G00000016552 Hmgcs1 3-hydroxy-3-methylglutaryl-CoA synthase 1 -1.60 4.4E-15
G00000004577 Fez2 fasciculation and elongation protein zeta 2 -1.60 1.9E-04
G00000000547 Tspyl4 TSPY-like 4 -1.59 5.0E-04
G00000017120 Abhd2 abhydrolase domain containing 2 -1.59 1.9E-07
G00000015906 Tgif1 TGFB-induced factor homeobox 1 -1.56 1.1E-03
G00000008144 Irf1 interferon regulatory factor 1 -1.54 2.4E-06
G00000007319 Trib3 tribbles pseudokinase 3 -1.54 8.5E-06
G00000018467 Mitd1 microtubule interacting and trafficking domain containing 1 -1.52 1.9E-03
G00000023238 Dgkd diacylglycerol kinase -1.52 1.2E-05
G00000020776 Dhcr7 7-dehydrocholesterol reductase -1.51 1.1E-05
G00000033824 Gpd2 glycerol-3-phosphate dehydrogenase 2 -1.51 5.5E-04
G00000003442 Adora1 adenosine A1 receptor -1.50 2.3E-06
G00000025689 Abhd1 abhydrolase domain containing 1 -1.50 2.1E-07
G00000018198 Dapk1 death associated protein kinase 1 -1.48 5.3E-04
G00000029668 Wfdc21 WAP four-disulfide core domain 21 -1.45 1.6E-04
G00000006280 Pcsk9 proprotein convertase subtilisin/kexin type 9 -1.44 4.7E-07
G00000008215 Trim47 tripartite motif-containing 47 -1.44 1.3E-04
G00000014013 Map4k4 mitogen-activated protein kinase kinase kinase kinase 4 -1.43 1.1E-05
G00000018627 Plekhb1 pleckstrin homology domain containing B1 -1.43 8.9E-05
G00000007713 Tmcc3 transmembrane and coiled-coil domain family 3 -1.43 2.6E-05
G00000000987 Ptcd1 pentatricopeptide repeat domain 1 -1.43 1.0E-03
G00000014702 Elovl2 ELOVL fatty acid elongase 2 -1.43 2.8E-11
G00000037595 Gpbp1l1 GC-rich promoter binding protein 1-like 1 -1.41 2.3E-04
G00000001205 Agpat3 1-acylglycerol-3-phosphate O-acyltransferase 3 -1.41 3.8E-09
G00000019776 Sh3gl3 SH3 domain containing GRB2 like 3 -1.40 4.1E-05
G00000012622 Mmp15 matrix metallopeptidase 15 -1.40 1.9E-03
G00000023856 Agxt alanine—glyoxylate and serine—pyruvate aminotransferase -1.39 7.5E-11
G00000042560 Bag4 BCL2-associated athanogene 4 -1.38 1.2E-03
G00000013841 Dcaf1 DDB1 and CUL4 associated factor 1 -1.38 2.1E-03
G00000019995 Dnajc18 DnaJ heat shock protein family (Hsp40) member C18 -1.37 2.4E-04
G00000019996 Slc16a1 solute carrier family 16 member 1 -1.36 1.6E-04
G00000023226 S100a10 S100 calcium binding protein A10 -1.35 2.2E-04
G00000006227 Ifih1 interferon induced with helicase C domain 1 -1.35 7.5E-04
G00000019005 Pde8a phosphodiesterase 8A -1.34 1.5E-03
G00000021259 Prnp prion protein -1.33 1.7E-03
G00000055909 Apoa4 apolipoprotein A4 -1.33 2.6E-10
G00000008012 Abcb4 ATP binding cassette subfamily B member 4 -1.33 4.1E-10
G00000021405 Cyp2c7 cytochrome P450 -1.32 1.0E-08
G00000012181 Lpl lipoprotein lipase -1.31 5.3E-05
G00000056041 AABR07062570 -1.30 2.5E-03
G00000016815 Tmem135 transmembrane protein 135 -1.29 4.1E-05
G00000019422 Egr1 early growth response 1 -1.29 1.1E-05
G00000054077 Aabr07024870 -1.29 1.4E-03
G00000008194 Znfx1 zinc finger -1.28 5.5E-04
G00000009076 Ttpal alpha tocopherol transfer protein like -1.27 1.7E-03
G00000005825 Lyz2 lysozyme 2 -1.26 2.7E-05
G00000032293 Polg DNA polymerase gamma -1.26 2.9E-04
G00000008586 Aldh1l2 aldehyde dehydrogenase 1 family -1.26 3.5E-04
G00000010805 Fabp4 fatty acid binding protein 4 -1.25 2.5E-03
G00000016044 Mab21l3 mab-21 like 3 -1.25 1.0E-04
G00000000459 Psmb9 proteasome 20S subunit beta 9 -1.25 7.4E-04
G00000015124 Gpam glycerol-3-phosphate acyltransferase -1.25 1.4E-03
G00000020871 Ltbp4 latent transforming growth factor beta binding protein 4 -1.22 2.1E-03
G00000016516 Mbp myelin basic protein -1.22 1.2E-04
G00000007324 Plxna2 plexin A2 -1.22 2.4E-07
G00000001821 Adipoq adiponectin -1.21 2.7E-03
G00000020573 Efna1 ephrin A1 -1.19 1.7E-04
G00000004606 Meis1 Meis homeobox 1 -1.19 8.3E-04
G00000001647 Ets2 ETS proto-oncogene 2 -1.17 9.1E-09
G00000059043 Itch itchy E3 ubiquitin protein ligase -1.17 1.4E-03
G00000006787 Dhcr24 24-dehydrocholesterol reductase -1.16 1.9E-12
G00000015121 N4bp1 Nedd4 binding protein 1 -1.15 3.0E-04
G00000042771 Apol3 apolipoprotein L -1.14 7.6E-08
G00000023664 Lepr leptin receptor -1.12 2.5E-03
G00000000451 RT1-Ba RT1 class II -1.12 1.1E-03
G00000012782 Cemip2 cell migration inducing hyaluronidase 2 -1.11 1.0E-05
G00000014766 Galt galactose-1-phosphate uridylyltransferase -1.11 1.7E-05
G00000014718 Acsl3 acyl-CoA synthetase long-chain family member 3 -1.11 1.4E-03
G00000017428 Map1b microtubule-associated protein 1B -1.10 1.7E-03
G00000018517 Trim21 tripartite motif-containing 21 -1.09 2.0E-03
G00000001426 Prkrip1 PRKR interacting protein 1 -1.09 2.2E-03
G00000028448 Elovl1 ELOVL fatty acid elongase 1 -1.08 2.2E-03
G00000005695 Mgp matrix Gla protein -1.07 1.2E-03
G00000017558 Tubb2a tubulin -1.07 7.2E-04
G00000012876 Slc6a13 solute carrier family 6 member 13 -1.07 7.1E-05
G00000018960 Syne1 spectrin repeat containing nuclear envelope protein 1 -1.07 7.3E-05
G00000017993 Abcb10 ATP binding cassette subfamily B member 10 -1.05 8.6E-05
G00000007545 Angptl4 angiopoietin-like 4 -1.04 4.1E-07
G00000007990 Adipor2 adiponectin receptor 2 -1.04 1.1E-04
G00000020134 Upf1 UPF1 -1.03 5.1E-04
G00000027434 Fitm2 fat storage-inducing transmembrane protein 2 -1.02 1.7E-05
G00000048315 Eif2ak2 eukaryotic translation initiation factor 2-alpha kinase 2 -1.02 6.7E-05
G00000005642 Frs2 fibroblast growth factor receptor substrate 2 -1.02 7.7E-04
G00000014604 Sigmar1 sigma non-opioid intracellular receptor 1 -1.01 4.9E-09
G00000002175 Clock clock circadian regulator -1.01 2.4E-04
G00000042785 Sesn2 sestrin 2 -1.00 1.7E-05
G00000023463 Parp9 poly (ADP-ribose) polymerase family -0.99 3.5E-04
G00000043377 Fdps farnesyl diphosphate synthase -0.99 1.6E-03
G00000000593 Rev3l REV3 like -0.98 2.0E-03
G00000019283 P2ry2 purinergic receptor P2Y2 -0.98 1.0E-03
G00000024061 Rarb retinoic acid receptor -0.98 2.7E-03
G00000017220 Tcirg1 T-cell immune regulator 1 -0.98 3.3E-04
G00000021032 Sphk2 sphingosine kinase 2 -0.97 2.3E-05
G00000001585 Nrip1 nuclear receptor interacting protein 1 -0.97 1.1E-03
G00000003882 Cep350 centrosomal protein 350 -0.96 5.2E-04
G00000005292 Trip11 thyroid hormone receptor interactor 11 -0.96 2.4E-06
G00000046889 Dbi diazepam binding inhibitor -0.96 2.3E-05
G00000000664 Tpst2 tyrosylprotein sulfotransferase 2 -0.95 2.1E-03
G00000014900 Crem cAMP responsive element modulator -0.95 2.0E-03
G00000024115 C6 complement C6 -0.93 2.9E-04
G00000030225 Clpx caseinolytic mitochondrial matrix peptidase chaperone subunit X -0.92 3.8E-05
G00000038012 Commd6 COMM domain containing 6 -0.91 1.8E-04
G00000007302 Fbn1 fibrillin 1 -0.91 1.4E-03
G00000018420 Slc22a7 solute carrier family 22 member 7 -0.90 4.1E-04
G00000002635 Dexi Dexi homolog -0.89 1.6E-06
G00000007728 Gsdmd gasdermin D -0.89 2.3E-03
G00000026942 RGD1311595 similar to KIAA2026 protein -0.88 2.9E-05
G00000034066 Hspa8 heat shock protein family A (Hsp70) member 8 -0.87 3.0E-04
G00000019372 Pc pyruvate carboxylase -0.87 8.5E-06
G00000000177 Plpp2 phospholipid phosphatase 2 -0.87 9.6E-04
G00000056703 Atrx ATRX -0.86 2.0E-04
G00000016219 Vnn1 vanin 1 -0.86 1.5E-04
G00000014338 Slc25a25 solute carrier family 25 member 25 -0.86 6.6E-04
G00000013391 Sorbs2 sorbin and SH3 domain containing 2 -0.84 9.9E-06
G00000016692 Hsdl2 hydroxysteroid dehydrogenase like 2 -0.83 1.3E-04
G00000024145 Trim65 tripartite motif-containing 65 -0.83 5.9E-05
G00000010947 Mmp14 matrix metallopeptidase 14 -0.83 1.7E-03
G00000018584 Ptma prothymosin alpha -0.83 1.5E-05
G00000008274 Xpc XPC complex subunit -0.83 3.6E-04
G00000011261 Ttc14 tetratricopeptide repeat domain 14 -0.83 2.7E-03
G00000047386 Smg1 SMG1 -0.82 2.7E-03
G00000007400 Srebf2 sterol regulatory element binding transcription factor 2 -0.82 4.0E-04
G00000028801 Gsap gamma-secretase activating protein -0.82 2.1E-03
G00000007700 Inhbc inhibin subunit beta C -0.81 5.3E-04
G00000013178 Cmip c-Maf-inducing protein -0.81 6.6E-04
G00000032394 Tymp thymidine phosphorylase -0.80 5.0E-04
G00000031709 Ppfibp1 PPFIA binding protein 1 -0.79 6.6E-04
G00000003020 Slc25a47 solute carrier family 25 -0.79 1.5E-03
G00000019450 Etf1 eukaryotic translation termination factor 1 -0.78 1.6E-03
G00000010497 RGD1305807 hypothetical LOC298077 -0.77 1.7E-05
G00000000184 Tmprss6 transmembrane serine protease 6 -0.75 3.7E-04
G00000004709 Foxn3 forkhead box N3 -0.73 2.2E-04
G00000007681 Brd3 bromodomain containing 3 -0.72 2.1E-03
G00000033593 Osbpl9 oxysterol binding protein-like 9 -0.72 7.9E-04
G00000002212 Hsd17b13 hydroxysteroid (17-beta) dehydrogenase 13 -0.70 5.2E-06
G00000053550 Itga1 integrin subunit alpha 1 -0.68 1.6E-03
G00000030700 COX3 cytochrome c oxidase subunit 3 -0.67 2.8E-04
G00000020425 Stim1 stromal interaction molecule 1 -0.66 1.0E-03
G00000057814 Nsdhl NAD(P) dependent steroid dehydrogenase-like -0.66 2.0E-05
G00000056371 Pik3ca phosphatidylinositol-4 -0.66 1.5E-03
G00000016266 Mphosph10 M-phase phosphoprotein 10 -0.65 2.2E-03
G00000015441 Il4r interleukin 4 receptor -0.65 1.8E-03
G00000009102 Fermt2 fermitin family member 2 -0.62 2.2E-03
G00000005015 Rabep1 rabaptin -0.62 1.8E-03
G00000020151 Cdh1 cadherin 1 -0.60 2.4E-03
G00000013135 Ptpn12 protein tyrosine phosphatase -0.58 2.7E-04
G00000057623 Copb1 COPI coat complex subunit beta 1 -0.53 4.7E-04
G00000011140 Prxl2a peroxiredoxin like 2A -0.51 2.0E-03
G00000018849 Tcerg1 transcription elongation regulator 1 -0.51 2.0E-03
G00000008305 Sc5d sterol-C5-desaturase -0.47 2.0E-03
G00000009263 Ifi27 interferon -0.47 2.2E-03
G00000004345 Daam1 dishevelled associated activator of morphogenesis 1 -0.46 2.7E-03
G00000016963 Trip12 thyroid hormone receptor interactor 12 -0.43 1.7E-03
ZDF Liver Upregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000003119 Gc GC 0.45 1.1E-03
G00000000610 Cisd1 CDGSH iron sulfur domain 1 0.46 7.7E-04
G00000019629 Lamp1 lysosomal-associated membrane protein 1 0.50 8.8E-05
G00000000701 Iscu iron-sulfur cluster assembly enzyme 0.51 4.0E-05
G00000037850 Mtarc2 mitochondrial amidoxime reducing component 2 0.51 6.0E-04
G00000019048 Sod2 superoxide dismutase 2 0.54 2.8E-04
G00000007967 Sdhb succinate dehydrogenase complex iron sulfur subunit B 0.54 1.8E-03
G00000013928 Dsp desmoplakin 0.54 1.5E-03
G00000016794 Phyhd1 phytanoyl-CoA dioxygenase domain containing 1 0.55 2.0E-03
G00000019626 Slc27a5 solute carrier family 27 member 5 0.55 8.8E-05
G00000028368 Etnk2 ethanolamine kinase 2 0.55 1.4E-03
G00000011535 Gcsh glycine cleavage system protein H 0.56 9.9E-04
G00000008921 Dynll2 dynein light chain LC8-type 2 0.56 1.5E-03
G00000030449 Gsta4 glutathione S-transferase alpha 4 0.56 1.1E-03
G00000018604 Tufm Tu translation elongation factor 0.59 2.2E-03
G00000017672 Akr1c14 aldo-keto reductase family 1 0.59 3.1E-04
G00000020994 Slc25a39 solute carrier family 25 0.59 7.3E-04
G00000047708 Gstz1 glutathione S-transferase zeta 1 0.59 1.1E-04
G00000013704 Cps1 carbamoyl-phosphate synthase 1 0.60 5.4E-04
G00000043404 Uroc1 urocanate hydratase 1 0.60 1.6E-05
G00000007395 Baat bile acid CoA:amino acid N-acyltransferase 0.60 5.3E-04
G00000017577 Bphl biphenyl hydrolase like 0.60 6.8E-04
G00000007069 Adhfe1 alcohol dehydrogenase 0.62 4.9E-04
G00000023538 Aldh5a1 aldehyde dehydrogenase 5 family 0.62 4.9E-04
G00000006653 Slc38a4 solute carrier family 38 0.62 1.2E-04
G00000001333 Azgp1 alpha-2-glycoprotein 1 0.62 8.6E-06
G00000016339 Uox urate oxidase 0.63 2.8E-05
G00000061876 Tas1r2 taste 1 receptor member 2 0.63 2.4E-04
G00000006916 Sardh sarcosine dehydrogenase 0.63 8.6E-05
G00000029549 Eci3 enoyl-Coenzyme A delta isomerase 3 0.63 8.9E-04
G00000048723 Pros1 protein S 0.64 4.9E-04
G00000009005 Slco2a1 solute carrier organic anion transporter family 0.64 2.7E-05
G00000007839 Slc16a7 solute carrier family 16 member 7 0.64 8.2E-04
G00000010389 Ndrg2 NDRG family member 2 0.65 5.7E-04
G00000014165 Ssr1 signal sequence receptor subunit 1 0.65 1.0E-04
G00000029735 Pid1 phosphotyrosine interaction domain containing 1 0.65 1.9E-03
G00000033466 Apon apolipoprotein N 0.65 1.1E-03
G00000000158 Cdo1 cysteine dioxygenase type 1 0.65 6.6E-06
G00000008364 Cat catalase 0.67 1.1E-03
G00000061883 Aqp9 aquaporin 9 0.68 1.3E-03
G00000021916 Slc16a12 solute carrier family 16 0.68 2.5E-03
G00000007743 Mgst1 microsomal glutathione S-transferase 1 0.68 1.8E-05
G00000003653 Fh fumarate hydratase 0.68 1.6E-03
G00000013223 Fah fumarylacetoacetate hydrolase 0.69 2.4E-04
G00000014700 Ttc36 tetratricopeptide repeat domain 36 0.69 8.4E-05
G00000030862 Atp6v1h ATPase H+ transporting V1 subunit H 0.69 4.9E-04
G00000030667 Ppm1b protein phosphatase 0.71 4.7E-06
G00000004139 Ndel1 nudE neurodevelopment protein 1-like 1 0.72 3.8E-05
G00000007927 Mettl7b methyltransferase like 7B 0.72 5.0E-05
G00000004147 Abca8a ATP-binding cassette 0.73 1.4E-03
G00000029726 Gstm1 glutathione S-transferase mu 1 0.74 1.3E-03
G00000003370 Otc ornithine carbamoyltransferase 0.74 6.8E-06
G00000013039 Add1 adducin 1 0.74 4.2E-04
G00000014727 Fahd1 fumarylacetoacetate hydrolase domain containing 1 0.75 4.2E-04
G00000059463 Slc39a1 solute carrier family 39 member 1 0.76 1.6E-03
G00000004302 Pah phenylalanine hydroxylase 0.76 3.4E-07
G00000029651 Rdh16 retinol dehydrogenase 16 0.76 8.2E-04
G00000028746 Gsto1 glutathione S-transferase omega 1 0.77 3.2E-04
G00000018426 NEWGENE_2134 apolipoprotein C1 0.77 1.3E-06
G00000001053 Tmed2 transmembrane p24 trafficking protein 2 0.77 6.7E-04
G00000016173 Cyp1a2 cytochrome P450 0.77 6.7E-04
G00000004089 Enpp2 ectonucleotide pyrophosphatase/phosphodiesterase 2 0.78 3.5E-04
G00000042274 Fbxo31 F-box protein 31 0.78 2.3E-03
G00000000186 Tst thiosulfate sulfurtransferase 0.78 8.6E-05
G00000048812 Gpx1 glutathione peroxidase 1 0.79 5.0E-04
G00000047986 Sult2a1 sulfotransferase family 2A member 1 0.79 2.5E-03
G00000006345 Sec61b SEC61 translocon subunit beta 0.79 6.2E-04
G00000009779 Krt8 keratin 8 0.79 2.2E-03
G00000006623 Cd302 CD302 molecule 0.80 1.5E-04
G00000005987 Suox sulfite oxidase 0.81 1.1E-03
G00000061890 Ust5r integral membrane transport protein UST5r 0.81 2.3E-04
G00000020879 Nags N-acetylglutamate synthase 0.81 3.3E-04
G00000008902 Pon1 paraoxonase 1 0.82 9.7E-07
G00000018904 Dtymk deoxythymidylate kinase 0.82 2.1E-03
G00000023116 Agmo alkylglycerol monooxygenase 0.82 4.0E-05
G00000047816 Ccs copper chaperone for superoxide dismutase 0.84 1.3E-04
G00000012142 Glyat glycine-N-acyltransferase 0.84 5.6E-07
G00000021206 Plaat3 phospholipase A and acyltransferase 3 0.84 7.5E-04
G00000012962 Nudt16 nudix hydrolase 16 0.85 1.9E-04
G00000050315 Dcxr dicarbonyl and L-xylulose reductase 0.86 2.9E-06
G00000000024 Hebp1 heme binding protein 1 0.86 2.7E-04
G00000000386 Pbld1 phenazine biosynthesis-like protein domain containing 1 0.87 1.3E-05
G00000007378 Acox2 acyl-CoA oxidase 2 0.87 7.0E-05
G00000003307 Gcdh glutaryl-CoA dehydrogenase 0.87 2.2E-08
G00000002205 Ociad1 OCIA domain containing 1 0.87 1.4E-03
G00000014645 Aldh7a1 aldehyde dehydrogenase 7 family 0.88 8.2E-08
G00000008638 Angptl3 angiopoietin-like 3 0.88 2.9E-09
G00000011351 Mat1a methionine adenosyltransferase 1A 0.89 3.6E-05
G00000009421 Ivd isovaleryl-CoA dehydrogenase 0.89 1.9E-09
G00000036894 Cisd3 CDGSH iron sulfur domain 3 0.89 4.0E-04
G00000014128 Ecsit ECSIT signaling integrator 0.90 1.6E-03
G00000017619 Aldh1a1 aldehyde dehydrogenase 1 family 0.90 3.1E-05
G00000018662 Amacr alpha-methylacyl-CoA racemase 0.90 3.9E-07
G00000020000 Tmem219 transmembrane protein 219 0.90 5.2E-04
G00000001957 Sult1e1 sulfotransferase family 1E member 1 0.90 2.8E-06
G00000051860 Rnase4 ribonuclease A family member 4 0.91 1.3E-09
G00000014160 Tcp1 t-complex 1 0.91 2.2E-04
G00000048114 Echdc3 enoyl CoA hydratase domain containing 3 0.91 2.7E-07
G00000003291 Creg1 cellular repressor of E1A-stimulated genes 1 0.92 1.3E-07
G00000008837 Ass1 argininosuccinate synthase 1 0.92 7.7E-04
G00000018159 Anxa4 annexin A4 0.92 2.3E-04
G00000010993 Dpm1 dolichyl-phosphate mannosyltransferase subunit 1 0.92 9.1E-04
G00000019982 Ethe1 ETHE1 0.92 2.4E-05
G00000023177 Esrp2 epithelial splicing regulatory protein 2 0.93 9.8E-07
G00000013409 Gclm glutamate cysteine ligase 0.93 3.0E-04
G00000001806 Fetub fetuin B 0.93 2.9E-04
G00000017291 Sord sorbitol dehydrogenase 0.94 7.2E-09
G00000053362 Gabarapl1 GABA type A receptor associated protein like 1 0.94 1.4E-07
G00000021174 Macrod1 mono-ADP ribosylhydrolase 1 0.95 7.1E-05
G00000014268 Abca2 ATP binding cassette subfamily A member 2 0.95 9.8E-04
G00000049771 Gstt1 glutathione S-transferase theta 1 0.96 8.4E-05
G00000011226 Timm8a1 translocase of inner mitochondrial membrane 8A1 0.96 4.5E-06
G00000005175 Sgpp1 sphingosine-1-phosphate phosphatase 1 0.97 2.0E-03
G00000049464 Cyp2c13 cytochrome P450 0.97 6.0E-10
G00000002210 Hsd17b11 hydroxysteroid (17-beta) dehydrogenase 11 0.97 4.4E-10
G00000012786 Pgrmc1 progesterone receptor membrane component 1 0.99 1.2E-07
G00000004327 Ddc dopa decarboxylase 0.99 4.8E-05
G00000046357 Adh5 alcohol dehydrogenase 5 (class III) 0.99 1.2E-11
G00000054049 Prelid2 PRELI domain containing 2 0.99 7.6E-04
G00000004442 Dglucy D-glutamate cyclase 0.99 1.6E-03
G00000014876 Lpin2 lipin 2 1.00 3.9E-04
G00000012911 Erlin1 ER lipid raft associated 1 1.00 6.8E-04
G00000055314 Msrb1 methionine sulfoxide reductase B1 1.00 1.1E-07
G00000006619 Dnajc9 DnaJ heat shock protein family (Hsp40) member C9 1.01 6.5E-04
G00000018937 Gstm7 glutathione S-transferase 1.01 1.6E-04
G00000027016 Cobll1 cordon-bleu WH2 repeat protein-like 1 1.01 1.4E-04
G00000046007 Cldn3 claudin 3 1.02 2.8E-04
G00000033609 Irx1 iroquois homeobox 1 1.02 2.0E-03
G00000017777 Ahcy adenosylhomocysteinase 1.02 1.5E-05
G00000019180 Acsl4 acyl-CoA synthetase long-chain family member 4 1.02 1.0E-08
G00000022932 Serhl2 serine hydrolase-like 2 1.03 1.5E-04
G00000016484 Gstk1 glutathione S-transferase kappa 1 1.03 1.5E-07
G00000003620 Fmo3 flavin containing dimethylaniline monoxygenase 3 1.04 1.7E-05
G00000032895 Cyp4f4 cytochrome P450 1.04 5.0E-08
G00000032737 F7 coagulation factor VII 1.05 2.1E-04
G00000023816 Aph1a aph-1 homolog A 1.05 1.6E-03
G00000015205 Cyb5a cytochrome b5 type A 1.06 9.6E-07
G00000008079 Ugp2 UDP-glucose pyrophosphorylase 2 1.06 4.1E-08
G00000011559 Cnn3 calponin 3 1.07 5.6E-05
G00000013484 Gsta1 glutathione S-transferase alpha-1 1.07 4.2E-10
G00000050595 Mup5 major urinary protein 5 1.07 1.5E-04
G00000026775 Pmpca peptidase 1.08 3.9E-04
G00000001338 Hpd 4-hydroxyphenylpyruvate dioxygenase 1.08 7.7E-06
G00000001618 Ripk4 receptor-interacting serine-threonine kinase 4 1.09 2.3E-03
G00000000768 Ubd ubiquitin D 1.10 2.4E-05
G00000007508 Lrtm2 leucine-rich repeats and transmembrane domains 2 1.10 1.8E-08
G00000031769 Chchd7 coiled-coil-helix-coiled-coil-helix domain containing 7 1.10 4.4E-04
G00000013291 Cyp2c23 cytochrome P450 1.10 4.4E-07
G00000017188 Cyp27a1 cytochrome P450 1.11 1.7E-08
G00000058327 1.13 7.4E-04
G00000025079 Fam126b family with sequence similarity 126 1.13 4.7E-04
G00000061215 Crym crystallin 1.14 2.1E-04
G00000017752 Mccc2 methylcrotonoyl-CoA carboxylase 2 1.16 1.8E-05
G00000016166 Pdlim1 PDZ and LIM domain 1 1.16 7.7E-07
G00000010079 Ca3 carbonic anhydrase 3 1.17 4.7E-10
G00000013728 Polg2 DNA polymerase gamma 2 1.17 6.2E-04
G00000062298 Rpl13a ribosomal protein L13A 1.19 2.6E-03
G00000013751 Plpbp pyridoxal phosphate binding protein 1.19 2.3E-06
G00000001442 Por cytochrome p450 oxidoreductase 1.19 1.2E-09
G00000042253 Ecd ecdysoneless cell cycle regulator 1.20 6.0E-04
G00000020254 Per2 period circadian regulator 2 1.20 3.1E-04
G00000007949 Rgn regucalcin 1.21 8.8E-08
G00000003253 Qdpr quinoid dihydropteridine reductase 1.21 3.4E-09
G00000003515 Ephx1 epoxide hydrolase 1 1.22 7.9E-07
G00000011039 Gch1 GTP cyclohydrolase 1 1.23 2.8E-07
G00000038746 Bco2 beta-carotene oxygenase 2 1.24 6.3E-07
G00000005861 Hsd11b1 hydroxysteroid 11-beta dehydrogenase 1 1.24 4.3E-09
G00000000588 Slc16a10 solute carrier family 16 member 10 1.24 1.6E-05
G00000020202 Asrgl1 asparaginase and isoaspartyl peptidase 1 1.25 2.7E-03
G00000017826 Mtrr 5-methyltetrahydrofolate-homocysteine methyltransferase reductase 1.26 1.6E-03
G00000033700 Bud23 BUD23 1.27 1.7E-03
G00000000281 Prodh1 proline dehydrogenase 1 1.28 2.1E-11
G00000042084 Acsm2 acyl-CoA synthetase medium-chain family member 2 1.30 3.4E-09
G00000006972 Zfp189 zinc finger protein 189 1.30 1.5E-03
G00000027784 Tsku tsukushi 1.32 7.2E-04
G00000012387 Glyatl2 glycine-N-acyltransferase-like 2 1.33 7.3E-07
G00000011714 Sat2 spermidine/spermine N1-acetyltransferase family member 2 1.33 6.9E-05
G00000045799 Rup2 urinary protein 2 1.34 7.8E-04
G00000021924 Cyp2c22 cytochrome P450 1.35 9.3E-08
G00000018494 Ppp1r3c protein phosphatase 1 1.36 4.1E-11
G00000004693 Pbx1 PBX homeobox 1 1.36 1.4E-03
G00000001258 Snx8 sorting nexin 8 1.37 2.0E-04
G00000020698 Rnd2 Rho family GTPase 2 1.37 6.0E-05
G00000051227 1.38 6.2E-04
G00000052810 Cyp2c11 cytochrome P450 1.39 2.0E-11
G00000012436 Adh6 alcohol dehydrogenase 6 (class V) 1.41 4.4E-15
G00000015936 Gng5 G protein subunit gamma 5 1.41 2.6E-03
G00000018413 Per3 period circadian regulator 3 1.42 1.6E-04
G00000016967 Hfe homeostatic iron regulator 1.42 2.9E-07
G00000001376 Mettl7a methyltransferase like 7A 1.43 3.1E-04
G00000056940 Cited2 Cbp/p300-interacting transactivator 1.44 1.5E-11
G00000015002 Abhd15 abhydrolase domain containing 15 1.44 1.5E-04
G00000032959 Adh7 alcohol dehydrogenase 7 (class IV) 1.45 7.6E-09
G00000050232 LOC680406 similar to Urinary protein 2 precursor (RUP-2) 1.46 1.5E-09
G00000020700 Rnaseh2c ribonuclease H2 1.48 7.7E-04
G00000011635 Ces2e carboxylesterase 2E 1.49 2.9E-08
G00000015354 Aox1 aldehyde oxidase 1 1.54 2.6E-12
G00000061450 Homer2 homer scaffold protein 2 1.54 2.5E-05
G00000009629 Car2 carbonic anhydrase 2 1.55 2.9E-05
G00000042111 Sult1c2a sulfotransferase family 1.55 2.3E-03
G00000057072 Slc12a3 solute carrier family 12 member 3 1.55 3.1E-04
G00000004009 Xpnpep2 X-prolyl aminopeptidase 2 1.57 1.1E-08
G00000013313 Nceh1 neutral cholesterol ester hydrolase 1 1.57 8.8E-07
G00000015438 LOC501233 LRRGT00080 1.58 1.2E-13
G00000015076 Cyp26b1 cytochrome P450 1.62 6.3E-04
G00000016456 Il33 interleukin 33 1.65 4.2E-18
G00000001766 Tfrc transferrin receptor 1.67 1.1E-04
G00000011718 C1rl complement C1r subcomponent like 1.68 1.2E-06
G00000013949 Idh2 isocitrate dehydrogenase (NADP(+)) 2 1.68 2.3E-16
G00000018740 Ugt1a6 UDP glucuronosyltransferase family 1 member A6 1.69 6.1E-14
G00000016807 Oat ornithine aminotransferase 1.72 1.2E-05
G00000025418 Armc9 armadillo repeat containing 9 1.74 4.5E-04
G00000023778 Gcnt2 glucosaminyl (N-acetyl) transferase 2 (I blood group) 1.77 6.8E-05
G00000056596 Alas1 5'-aminolevulinate synthase 1 1.80 2.3E-15
G00000046643 Cyp3a9 cytochrome P450 1.82 5.3E-04
G00000003260 Nr1i3 nuclear receptor subfamily 1 1.84 6.4E-05
G00000001158 Abcg1 ATP binding cassette subfamily G member 1 1.86 3.0E-05
G00000020250 Pcgf6 polycomb group ring finger 6 1.88 9.2E-04
G00000006420 Rbm38 RNA binding motif protein 38 1.89 2.0E-04
G00000012458 Cyp2e1 cytochrome P450 1.91 1.3E-19
G00000002258 Tmem150c transmembrane protein 150C 1.94 9.3E-05
G00000013982 Hsd17b2 hydroxysteroid (17-beta) dehydrogenase 2 1.94 5.1E-04
G00000021027 Dbp D-box binding PAR bZIP transcription factor 1.94 3.2E-05
G00000004437 Map2k6 mitogen-activated protein kinase kinase 6 2.07 1.1E-08
G00000032246 Acsm3 acyl-CoA synthetase medium-chain family member 3 2.19 2.3E-16
G00000014490 Bdh2 3-hydroxybutyrate dehydrogenase 2 2.21 2.5E-14
G00000036687 Alyref Aly/REF export factor 2.23 8.9E-04
G00000015519 Ces1d carboxylesterase 1D 2.24 6.9E-32
G00000009598 Ncaph2 non-SMC condensin II complex 2.41 3.8E-05
G00000043131 LOC100360095 urinary protein 1-like 2.43 4.9E-19
G00000034191 Fmo1 flavin containing dimethylaniline monoxygenase 1 2.46 2.8E-25
G00000005985 Kcnma1 potassium calcium-activated channel subfamily M alpha 1 2.82 1.6E-04
G00000011250 Inmt indolethylamine N-methyltransferase 2.90 3.9E-21
G00000058904 Tex13b testis expressed 13B 3.10 5.9E-15
G00000012772 Nqo1 NAD(P)H quinone dehydrogenase 1 3.11 1.5E-12
G00000001388 Sds serine dehydratase 3.29 1.7E-09
G00000056847 Gsta3 glutathione S-transferase alpha 3 3.40 3.1E-21
G00000001242 Gstt3 glutathione S-transferase 3.66 1.2E-85
G00000051912 Acnat2 acyl-coenzyme A amino acid N-acyltransferase 2 3.74 8.9E-05
G00000009488 Cyp7a1 cytochrome P450 family 7 subfamily A member 1 4.19 1.4E-18
Lean Liver Downregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000029668 Wfdc21 WAP four-disulfide core domain 21 -2.72 1.3E-04
G00000020480 Fads1 fatty acid desaturase 1 -2.53 4.0E-08
G00000006859 Insig1 insulin induced gene 1 -2.32 3.2E-05
G00000057557 Prlr prolactin receptor -2.27 2.3E-04
G00000055909 Apoa4 apolipoprotein A4 -1.93 2.3E-04
G00000030154 Cyp4a2 cytochrome P450 -1.75 2.2E-08
G00000019776 Sh3gl3 SH3 domain containing GRB2 like 3 -1.62 8.9E-05
G00000046889 Dbi diazepam binding inhibitor -1.61 1.1E-05
G00000014702 Elovl2 ELOVL fatty acid elongase 2 -1.60 1.8E-05
G00000032297 Msmo1 methylsterol monooxygenase 1 -1.56 3.6E-05
G00000007234 Cyp51 cytochrome P450 -1.56 4.9E-05
G00000020989 Tm7sf2 transmembrane 7 superfamily member 2 -1.45 6.6E-05
Lean Liver Upregulated Ensembl_ID (ENSRNO) Gene Symbol Gene Name L2FC P-value
G00000001376 Mettl7a methyltransferase like 7A 1.16 1.7E-04
G00000048114 Echdc3 enoyl CoA hydratase domain containing 3 1.17 1.2E-04
G00000023116 Agmo alkylglycerol monooxygenase 1.21 1.7E-04
G00000002643 Ugdh UDP-glucose 6-dehydrogenase 1.29 7.6E-05
G00000015354 Aox1 aldehyde oxidase 1 1.33 1.2E-04
G00000004089 Enpp2 ectonucleotide pyrophosphatase/phosphodiesterase 2 1.34 9.6E-05
G00000034191 Fmo1 flavin containing dimethylaniline monoxygenase 1 1.37 1.7E-04
G00000013291 Cyp2c23 cytochrome P450 1.47 1.1E-04
G00000003809 Sat1 spermidine/spermine N1-acetyl transferase 1 1.58 3.9E-05
G00000018740 Ugt1a6 UDP glucuronosyltransferase family 1 member A6 1.80 2.6E-05
G00000015519 Ces1d carboxylesterase 1D 1.94 5.6E-10
G00000033570 Arhgap8 Rho GTPase activating protein 8 2.03 1.5E-04
G00000051912 Acnat2 acyl-coenzyme A amino acid N-acyltransferase 2 2.05 1.1E-04
G00000001158 Abcg1 ATP binding cassette subfamily G member 1 2.21 1.1E-04
G00000001388 Sds serine dehydratase 2.29 8.0E-06
G00000047613 AABR07048463.1 AABR07048463.1 2.34 1.4E-06
G00000013552 Scd stearoyl-CoA desaturase 2.36 4.8E-06
G00000001242 Gstt3 glutathione S-transferase 2.93 1.4E-09
G00000021924 Cyp2c22 cytochrome P450 3.22 5.2E-15
G00000009488 Cyp7a1 cytochrome P450 family 7 subfamily A member 1 3.36 1.5E-09

1All genes were analyzed using DESeq2 for differential analysis.

2Abbreviations used: ZDF, Zucker Diabetic Fatty; L2FC, log2 fold change; PFC, prefrontal cortex.

3 Benjamini-Hochberg adjusted P-values controlling for false discovery rate at 5%, where P< 0.05 was considered significant.

We previously demonstrated that WE consumption for 8 wk is effective at improving serum vitamin D status and providing nephroprotective benefits [17, 18]; however, despite our gene expression findings in this study we still have yet to elucidate the mechanism underlying how WE consumption leads to decreased weight gain [28, 29]. We also identified that ZDF rats fed WE upregulated 11 genes involved in glutathione metabolism in the liver and kidney. In the PFC, WE consumption had differing effects whereby in the lean PFC, WE consumption did not change the transcriptome, whereas in the ZDF rats WE consumption strongly downregulated the expression of 2, AY172581 exon transcripts. These exon transcripts have yet to be characterized and future proteomic studies may reveal their biological importance. Across both genotypes, the most significantly altered genes were involved in the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways of: glutathione metabolism, metabolic pathways, steroid biosynthesis, and cholesterol metabolism. After controlling for the genetic background differences of our ZDF rats, a combined analysis indicated that 428 unique genes were differentially expressed across these tissues as a product of WE consumption. Moreover, 13 different glutathione metabolism genes were significantly upregulated across the liver and kidney in both genotypes suggesting that increased whole egg consumption, may increase glutathione metabolism independent of T2DM, and attenuate the decreased glutathione metabolism during diabetes.

To visualize the global differences in the transcriptomes based on dietary treatment, we performed principal component analysis (PCA) and generated volcano plots for genes that exhibited ≥1.5-fold change, respectively. Fig 1displays the samples in a three-dimensional principal component space, whereby samples are colored in red or black to distinguish either WE or CAS, respectively. In the mRNA samples, rats on the same dietary treatment (i.e. black or red) clustered together, while animals belonging to different dietary treatments separated, indicating distinctly different patterns across global mRNA expression. These results were further visualized using volcano plots for each tissue as presented in Fig 2. These volcano plots demonstrate the degree to which genes were upregulated or downregulated across each tissue. For instance, volcano plots indicate a relatively equal number of upregulated and downregulated genes in the lean PFC following WE consumption, whereas WE consumption primarily resulted in downregulated gene expression in the ZDF PFC.

Fig 1. Principle component analysis.

Fig 1

Samples in the first three principle component space are colored in red or black for either WE or CAS, respectively. Each panel displays PCA results using microRNA data or mRNA data are colored by dietary treatment groups with A) ZDF microRNA, B) ZDF mRNA, C) lean microRNA, D) lean mRNA.

Fig 2. Volcano plots.

Fig 2

Genes upregulated (green) or downregulated (red) by WE consumption, correspond to a 1.5 decrease or increase in log fold changes. Each panel corresponds to a tissue in a given genotype: A) lean adipose; B) lean PFC; C) lean kidney; D) lean liver; E) ZDF adipose; F) ZDF PFC; G) ZDF kidney; and H) ZDF liver.

During T2DM, reports indicate that genes within the oxidative stress-related pathways upregulated [26]. Evans et al. suggested that oxidative stress was driven by the hyperglycemic environment concomitant with increased concentrations of free fatty acids in the plasma [26]. Corbett et al. [30] reported that protective antioxidant genes such as glutathione peroxidase are downregulated during T2DM, and both glutathione s-transferases (GSTs) and glutathione-dependent enzymes are important in the regulation of pathophysiological alterations in numerous chronic diseases, especially T2DM [30]. Previous work has shown that dietary intervention with direct glutathione supplementation was protective against diabetic nephropathy in an insulin dependent streptozotocin-induced T1DM model [27]. This current study provides new transcriptomic evidence supporting our previous report demonstrating that WE consumption protects against diabetic nephropathy, where WE consumption leads to altered gene expression in the kidney. In this study, we noted that the strongest alterations in glutathione metabolism were in the liver, potentially because hepatic glutathione is produced at much higher concentrations (10 mM), whereas intracellular glutathione concentrations are approximately 1–2 mM [31]. This body of previous work is important in relation to our findings that several GSTs and glutathione-dependent enzymes are significantly altered during WE consumption in lean controls and during diabetes in the kidneys and livers across both genotypes. Future mechanistic studies identifying the beneficial impact of these two enzymes in chronic diseases like T2DM are warranted.

Outside of the glutathione pathways, we also observed that there were significant differences in early growth response-1 (Egr-1) gene expression following WE consumption. Egr-1 has been implicated in the onset of insulin-resistance, as previous studies in insulin-resistant T2DM mice identified that loss of function in Egr-1 restores insulin sensitivity via increased phosphorylation of the insulin receptor substrate-1 tyrosine kinase [32]. Notably, we observed a 30% decrease in hepatic Egr-1 expression in the ZDF rats fed WE. This is an interesting finding as research by Garnett et al. [33] determined that exposing beta cells to hyperglycemic conditions resulted in a temporal and dose-dependent increase in Egr-1 transcription and translation. Furthermore, Egr-1 null mice are known for their inability of displaying diabetic and obese phenotypes [34] owing to their increased energy expenditure. These data suggest that consumption of WE may lead to altered Egr-1 expression which may play a key role in regulating energy expenditure.

We also demonstrated that WE consumption resulted in tissue-specific alterations in gene expression and that there were distinct transcriptomic differences between genotypes. WE consumption did not influence gene expression in the PFC of lean animals, while 2 genes were significantly altered in the ZDF PFC. There were more stark differences when comparing the liver tissues between the two genotypes, where more than 400 genes were altered in ZDF livers that were not altered in the liver of lean controls. It has been shown that T2DM impacts a variety of tissues [1] but previous studies have provided very little evidence of how T2DM alters the nutrigenomic responses to foods in specific tissues. It is still unknown which specific egg components lead to phenotypic differences in gene expression and future studies should focus on identifying the specific egg constituents that mediate these gene expression differences. These collective findings are likely mediated through the alteration of several genes; therefore, we aimed to further examine microRNA changes involved in the underlying progression of T2DM during WE consumption.

MicroRNA sequencing differential expression

We examined if endogenously expressed microRNA profiles in the adipose, liver, kidney, and prefrontal cortex tissues would be altered following 8 wk consumption of dietary WE. Differential expression analyses of the ZDF microRNA data resulted in 1 differentially expressed microRNA in the adipose tissue, none in the liver, none in the kidney and 2 in the PFC that surpassed multiple testing correction. Among the lean rats, there were 2 marginally differentially expressed microRNAs in the adipose tissue, 4 in the liver, none in the kidney and none in the PFC that survived multiple testing correction. Table 2presents the differentially expressed microRNAs in the adipose, liver, kidney, and PFC tissues across both genotypes. S3 Table contains results from DESeq2 with the results for each microRNA across all four tissues and raw microRNA read counts are contained in S4 Table.

Table 2. Differentially expressed microRNAs in WE vs CAS-based diets in ZDF rats and their lean controls1-3.

Genotype Tissue MicroRNA L2FC Non adjusted
p-value
P-value3
ZDF Adipose Downregulated rno-miR-221-3p -1.60 9.53E-05 0.007
ZDF PFC Upregulated rno-miR-29a-3p 0.59 0.0001 0.022
ZDF PFC Upregulated rno-miR-151-5p 0.89 0.0005 0.036
Lean Adipose Downregulated rno-miR-125a-5p -1.48 0.0022 0.069
Lean Adipose Downregulated rno-miR-125b-5p -1.78 0.0029 0.069
Lean Liver Upregulated rno-miR-9a-5p 1.89 9.08E-05 0.0063
Lean Liver Upregulated rno-miR-181a-5p 1.10 0.0007 0.024
Lean Liver Upregulated rno-miR-10b-5p 1.37 0.0011 0.024
Lean Liver Downregulated rno-miR-192-5p -0.57 0.0013 0.024

1All miRNAs were analyzed using DESeq2 for differential analysis.

2Abbreviations used: ZDF, Zucker Diabetic Fatty; WE, whole egg; CAS, casein; L2FC, log2 fold change; and PFC, prefrontal cortex.

3Benjamini-Hochberg adjusted P-values controlling for false discovery rate at 5%, where P< 0.05 was considered significant.

Based on the microRNA sequencing analysis, 9 microRNAs were differentially expressed following multiple testing correction. Several of these microRNAs have been previously correlated with gestational diabetes or show to be altered in the plasma of individuals with diabetes. Very few studies to date have examined the tissue-specific changes of endogenous microRNA expression in response to dietary patterns and this is the first study to demonstrate that endogenous microRNA expression in the liver, adipose, and PFC can be altered following 8 wks of WE consumption. Future studies should focus on identifying if similar foods such as quail eggs alter microRNA expression in these tissues and determine the smallest effective dosage of egg required to recapitulate these changes in microRNAs.

Mapping between microRNAs and target genes

Next, we sought to determine if these significantly altered microRNAs were responsible for the tissue-specific differential expression of their predicted target genes. MicroRNA mapping analyses of the differentially expressed microRNAs and their target genes demonstrates that in each of the tissues with differentially expressed microRNAs, key target genes of these microRNAs were altered. For instance, in the lean liver microRNA-181a-3p was upregulated and two of its mRNA target genes were differentially expressed, Cytochrome P450 Family 7 Subfamily A Member 1 (Cyp7a1) and stearoyl-CoA desaturase (Scd). Similarly, in the lean adipose, microRNA-125b-5p was downregulated while its target gene phosphoglycolate phosphatase (Pgp) was upregulated. The microRNAs in the PFC and kidney tissue did not map to any differentially expressed genes. Table 3summarizes the mapping between microRNAs and their gene targets.

Table 3. Differentially expressed microRNAs and their corresponding target genes that were differentially regulated by dietary WE consumption1-3.

MicroRNA Tissue Gene Name L2FC Non-adj
p-value
Human Symbol Ensembl Rat ID (RNOG) Rat Symbol Gene Name
miR-
125b-5p
(down regulated)
lean adipose Pgp 2.69 0.00003 PGP 00000009536 Pgp phosphoglycolate phosphatase
rno-miR-
181a-5p
(up regulated)
lean
liver
CYP7A1 3.36 0.000000001 Cyp7a1 00000009488 Cyp7a1 Cytochrome P450 Family 7 Subfamily A Member 1
rno-miR-
181a-5p
(up regulated)
lean
liver
Scd 2.35 0.0000048 Scd 00000013552 SCD stearoyl-CoA desaturase

1All miRNAs were analyzed using DESeq2 for differential analysis.

2Abbreviations used: miR, microRNAS; rno, rattus norvegicus; WE, whole egg; and L2FC, log2 fold change.

3Gene targets for Rattus Norvegicus and humans were determined by DRSC Integrative Ortholog Prediction Tool.

While examining the relationship between significantly altered microRNAs and their target genes, we identified that in the livers of lean rats fed WE, the upregulated microRNA-181a-5p affected target genes involved in steroid hormone biosynthesis such as Cyp7a1 and Scd. Notably, only Cyp7a1 was upregulated in the liver of ZDF rats fed the WE-based diet while both Scd and Cyp7a1 were upregulated in the livers of lean control rats. In rodent models of diabetes, liver expression of Cyp7a1 has been shown to be decreased and thought to play a key role in regulating whole body energy homeostasis [35]. Similarly, transgenic mice overexpressing Cyp7a1 were shown to become resistant to weight gain and fatty liver disease [35]. Experiments examining the role of Scd in rat hepatocytes has demonstrated that Scd expression regulates hepatic insulin resistance during diabetes [36], but very few studies have determined the expression of Scd genes in the context of dietary consumption. Based on the data, WE consumption more strongly upregulated hepatic expression of Cyp7a1 in ZDF animals than in the lean controls and this might suggest that WE consumption can prevent or reverse the loss of hepatic Cyp7a1 expression due to diabetes.

In our lean rats, we also identified that microRNA-125b-5p was downregulated in adipose tissue where its gene target Pgp was strongly upregulated. Pgp is known to hydrolyze glycerol-3-phosphate into glycerol, and overexpression experiments in rodents showed that upregulation of Pgp leads to a reduction in body weight gain and improves hepatic glucose regulation [37]. Additionally, we observed the upregulation of liver microRNA-9a-5p, which has been correlated with gestational diabetes in humans [38]. While the gene targets of microRNA-9a-5p were not differentially expressed in the liver, future studies should look into whether endogenous microRNA expression fluctuates in response to consuming other eggs, such as quail eggs, or egg yolk alone.

KEGG and GO functional enrichment analysis

To further examine the molecular function of the identified DEGs, KEGG pathway analysis indicated that the most prevalent pathways influenced by dietary WE across multiple tissues in the ZDF rats were: glutathione metabolism; oxidation-reduction; metabolism of xenobiotics; steroid hormone biosynthesis; and fatty acid synthesis pathways. In the livers of lean control rats, the most significantly expressed pathways included metabolic pathways and retinol metabolism. All the differentially expressed genes that map to KEGG and gene ontology (GO) pathways analyses are presented in S5 Table.

To further investigate the specific genes involved in the glutathione metabolism pathways, genes were categorized into the corresponding reactions identified by Reactome.org in Fig 3. Glutathione metabolism functions in antioxidant defense, signal transduction, cytokine production, and other cellular processes such as detoxification. The role of GST, GSTK, GSTO dimers, and GPX1 which function in glutathione conjugation, glucuronidation, methylation, and detoxification of reactive oxygen species, respectively, are detailed within Fig 3. These reactions within glutathione metabolism are essential for recycling of glutathione disulfide or the conjugation of GSH that can be utilized in redox reactions.

Fig 3. Differentially expressed genes involved in glutathione metabolism.

Fig 3

This figure was adapted from D’Eustachio, P., and Jassal, B. from the Reactome [39]. Glutathione metabolism reactions can be categorized into glutathione conjugation, glucuronidation, methylation, or detoxification of reactive oxygen species. All genes are listed within each reaction category followed by their corresponding log2fold change in parentheses for each given tissue. Abbreviations used: ZDF, Zucker Diabetic fatty rat; GSSG, glutathione disulfide; GSH, glutathione; AS3MT, arsenite 3-methyltransferase; AdoMet, S-adenosyl methionine; AdoHcy, S-adenosyl homocysteine; CDNB, 1-chloro-2, 4-dinitrobenzene; DNPSG, S-(2,4-dinitrophenyl)glutathione; glu, glutamate; cys, cysteine; gly, glycine; gGluCys, gamma-glutamyl-L-cysteine; GST, glutathione s-transferase; and GPX, glutathione peroxidase.

KEGG pathway analysis highlighted that in addition to an upregulation of glutathione metabolism pathways, several of the same gene products mediate metabolism of xenobiotics, a pathway upregulated in our rats fed WE-based diets. Xenobiotic metabolism has previously been shown to be downregulated during insulin dependent T1DM [27], where in this study these pathways were upregulated in response to feeding WE-based diets. These observed effects appear to be tissue specific, as these alterations were the most prominent in ZDF liver, whereas one gene, glutathione s-transferase p (Gstp1), was differentially upregulated in the kidney of ZDF rats while glutathione s-transferase mu 1 (Gstm1) was upregulated in the lean kidney. These findings support the previous observation that WE consumption affects obese phenotypes differently than a lean phenotype [17], in part, due to the different transcriptomic responses to dietary WE. We previously hypothesized that these differences in response to WE consumption were not due to satiety, because there was increased food intake in the WE group [18]; the present study identifies a potential molecular response to egg partially explaining these previous findings. Other suggested mechanisms that might explain differences between obese and lean genotypes include thermogenesis [40], altered methylation patterns [41], intestinal microbiome alterations [42], and changes in energy expenditure [43]. While there have been numerous studies highlighting differences in the microbiota between obese and lean phenotypes in rats [42] and humans [40], one recent study examining WE consumption concluded that it did not influence the intestinal microbiome in postmenopausal women [44]. Taken together, these observations support the idea that phenotypic alterations during T2DM may depend strongly on obesity status and energy expenditures on a molecular level, potentially in response to changes in the transcriptome.

qPCR analyses

Finally, we examined the relationship between our qPCR data for several genes to validate the results from the Quantseq analysis. Confirmatory analysis with qPCR demonstrated that across the genes selected, the qPCR data highly correlates with the mRNA Quantseq results (R2 = 0.72; S1 Fig) indicating strong similarities between these two methods.

Strengths and limitations

The strengths and limitations of this study should be addressed to better understand how these results fit into the larger context of the current literature. It is estimated that in 2019, people in the United States consumed on average, 5.6 eggs per week [45]. The dose of egg used in this study would equate to roughly 14 eggs per day for a human. While our study demonstrated that consuming a large dose of WE may alter gene expression of various metabolic pathways, particularly during T2DM, this quantity of egg would not be a standard dietary practice in humans. We do recognize that our whole egg dosage was high, but the goal was to examine whether there was a transcriptomic response from consuming dietary whole egg in a T2DM model. It is worth noting that our laboratory has previously reported in ZDF rats that even smaller dosages, such as the human equivalent of <2 eggs/day, significantly reduced weight gain in the ZDF rat and therefore may be effective in identifying oxidative stress outcomes from long-term dietary whole egg consumption [18]. After the examination of the transcriptome following our high WE-based diet, it is warranted to examine these specific genes in a follow-up intervention study. Future studies will focus on titrating down the egg dosages to discern the smallest dosage to elicit similar transcriptomic responses to egg consumption that will be more translatable to human consumption patterns. Overall, our findings are significant as we are the first to report that whole hen egg consumption promotes glutathione metabolism expression during T2DM and alters the transcriptome of multiple tissues using next-generation sequencing. Additionally, we provide evidence supporting the idea that egg consumption modifies endogenous microRNA expression in a tissue-specific manner.

In summary, we examined whether feeding WE modifies expression of microRNAs or gene expression profiles across multiple tissues in a diabetic versus a lean rat model. Across all tissues examined with next generation sequencing, we identified that 9 microRNAs were differentially expressed in response to consuming WE. Additionally, we have shown that these microRNAs were related to tissue-specific changes in gene expression, and that 8 wk of consuming diets high in whole egg modified 583 genes across the PFC, kidney, liver, and adipose tissue. KEGG/GO analyses identified that glutathione metabolism was highly upregulated in response to feeding WE and qPCR results validated the sequencing results. These data suggest that high WE consumption may provide beneficial effects during T2DM by improving glutathione metabolism gene expression across multiple tissues and decreasing gene expression in oxidative stress pathways.

Materials and methods

The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus [46] and are accessible through GEO Series accession number GSE157491 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE157491). All protocols used within this study have been made publicly available at protocols.io. Protocols have been zipped into one file and can be accessed at dx.doi.org/10.17504/protocols.io.bjgakjse.

Animal housing and experimental design

This animal study was approved by the Institutional Animal Care and Use Committee (IACUC) at Iowa State University. All animal care was performed according to Laboratory Animal Resources Guidelines at Iowa State University. Male ZDF (fa/fa) rats (n = 12) and their lean controls (fa/+; n = 12) were obtained at 6-wk of age (Charles River, Wilmington, MA). Rats were dual-caged and acclimated for 72 h in conventional cages in a temperature-controlled room (25°C) with a 12-h light-dark cycle. Rats were randomly assigned to an experimental diet (Table 4) consisting of either a casein (CAS)-based diet, or a WE-based diet containing dried WE powder (Rose Acre Farms).

Table 4. Composition of the CAS and WE based diets fed to lean and ZDF rats for 8 wk1.

CAS WE
Ingredient (g/kg)
Casein 200 -
Whole Egg2 - 435
Cornstarch 417 365
Corn Oil 183 -
Glucose Monohydrate 150 150
Mineral Mix 35 35
Vitamin Mix 10 10
Choline Bitartrate 2 2
L-methionine 3 3
Biotin (1%) - 0.4
Macronutrients (% total kcal)3
Protein 17 17
Carbohydrate 48 48
Fat 35 35
Caloric Content 4,715 4,715

1All ingredients were purchased from Envigo except for dried whole egg (Rose Acre Farms, Guthrie Center, IA), as well as l-methionine and choline bitartrate (Sigma-Aldrich). Abbreviations used: CAS, casein-based diet, WE, whole egg-based diet.

2 Total protein and lipid content provided by 435 g of dried WE was 46% (200 g) and 42% (183 g), respectively.

3 To formulate all diets such that protein was provided at 20% (w/w).

Both diets provided 20% protein (w/w) from either vitamin-free CAS or WE powder. To match the diets for total lipid content (18.3%), corn oil was added to the control diet. Both diets were prepared in-house weekly by mixing all ingredients into a powdered form and administered daily in a standard amount for both lean and ZDF rats. For the remainder of the study, rats were fed ad libitum for 8 wk and at the end of the experimental period, rats were anesthetized with a dissociative agent combination of ketamine:xylaxine (90:10 mg/kg body weight) via an intraperitoneal injection of 1μL/g body weight. Two methods of animal euthanasia were performed according to the American Veterinary Medical Association guidelines for the Euthanasia of Animals: 2020 edition [47]. Cardiac exsanguination of whole blood on the anesthetized rat was performed and serum was subsequently stored at −80°C for downstream analysis. The second method of exsanguination was the procurement of organs. Following cardiac puncture, tissues were immediately excised, weighed, and snap frozen in liquid nitrogen for storage at −80°C in RNALater.

RNA extraction and analysis

Tissue samples (20 mg) were rapidly thawed on ice and largeRNA and smallRNA fractions were extracted from the same isolate using the RNA SPLIT Kit (Lexogen) according to the manufacturer’s instructions. Briefly, samples were homogenized in an isolation buffer and phase separated using a phenol/chloroform extraction followed by a spin column-based purification procedure. All samples were aliquoted and stored at −80°C for downstream analysis. Following extraction, sample concentrations for the largeRNA fraction were analyzed using a Qubit 2.0 fluorometer (Thermo Fisher) using the Qubit™ Broad Range RNA Assay Kit. RNA integrity was assessed using the Bioanalyzer 2100 (Agilent Technologies) and samples with low RNA integrity number (RIN) values <5 were discarded and re-extracted. SmallRNA concentrations were measured using a Qubit 2.0 fluorometer (Thermo Fisher) using the Qubit™ microRNA Assay Kit.

TotalRNA and smallRNA sequencing

Libraries for totalRNA were prepared using an automated protocol according to the manufacturer’s instructions for half reactions on the QuantSeq 3' mRNA-Seq Library Prep Kit (Lexogen) using a MANTIS® Liquid Handler pipetting robot (Formulatrix). All totalRNA samples were multiplexed together across two lanes on an Illumina High-Seq 3000. SmallRNA Libraries were prepared manually using the SmallRNA-Seq Library Prep Kit (Lexogen). Briefly, 100 ng of enriched smallRNA was used as input and 3’ and 5’ adapters were ligated followed by column purifications. Subsequently, the ligation products were reverse transcribed and double stranded cDNA libraries were generated. Finally, individual sample barcodes for multiplexing were introduced via 17 cycles of PCR. All libraries were assessed on the Bioanalyzer 2100 (Agilent) to examine if adapter dimers formed during PCR. All libraries were further prepared using a bead purification module (Lexogen) and pooled into a single sample at 2 nM (20 μL reaction) for sequencing.

Sequencing quality control and adapter trimming

For both totalRNA and smallRNA samples, the resulting FASTQ files were analyzed using Fast-QC [48] and sequencing adapters were trimmed using on BBDUK [49] with an example of the trimming procedure: bbduk.sh in = reads.fq out = clean.fq maq = 10 ref = /bbmap/resources/adapters.fa. For smallRNA samples, reads were additionally trimmed using the literal flag to remove the Lexogen specific sequence “5’-TGGAATTCTCGGGTGC CAAGGAACTCCAGTCAC– 3’” following similar trimming procedures. Briefly, any read segments that matched Illumina Truseq or Nextera adapters, along with reads containing integrity scores <10 were trimmed out.

Alignment and read quantification

For totalRNA, reads were mapped to the Ensembl release 94 of the Rattus Norvegicus RNO_6.0 genome using RNA STAR [50]. TotalRNA read counts were generated during the read alignment using the—genecounts function in STAR. For smallRNA samples, reference fasta files from www.RNACentral.org were downloaded for microRNA, piwiRNA, snRNA, nRNA, rRNA, and tRNA. Indexes were generated using Bowtie [50] and alignment was conducted using the smallrnaseq python tool [51]. Read counts for all reference indices and IsomiRs were generated using the smallrnaseq python tool.

Data filtering and normalization

Following read count generation, Quantseq gene expression data was merged into a single data frame for analysis in R (version 3.6.0). Genes were discarded from the analysis if there were <3 samples without a single read for that given gene. TotalRNA data initially generated read counts for 32,883 genes and over 50% of the trimmed reads from each sample mapped to the RNO_6 version 94 genome. Prior to normalization, remaining gene counts across all four tissues contained between 8,700–12,000 genes for analysis. The microRNA data originally generated read counts for over 350 microRNAs and the formal analysis was conducted on 60–150 targets across each tissue. For totalRNA and smallRNA fractions, all samples were normalized using the Trimmed Mean of M values (TMM) method [52]. Briefly, TMM accounts for variable depth between samples by normalizing them according to the weighted trimmed mean of the log expression ratios across all samples prior to analysis.

Differential expression analysis

All differential expression analyses were conducted using R (version 3.6.0). Differential expression was conducted using DESeq2 from Bioconductor. DESeq-DataSetFromMatrix generated p-values and Benjamini-Hochberg [53] adjusted P-values controlling false discovery rate (FDR) at 5%. Significance was determined at adj P<0.05.

Heatmaps, principal component analysis, and volcano plots

Principal Component Analysis (PCA) was used to visualize sample relatedness across treatments and tissues. Subsequent hierarchical clustering grouped samples according to transcriptomic relatedness, while volcano plots were constructed to visualize samples with absolute log-fold changes >1.5. All figures were generated with MatplotLib in Python version 3.2.0rc1.

KEGG/GO pathway analysis

Biological pathways for each DEG were generated using the KEGG pathway analysis and GO analysis conducted via the Database for Annotation, Visualization, and Integrated Discovery (DAVID) v6.7 software tool.

qPCR validation analyses

TotalRNA from each tissue was aliquoted and frozen at -80C, and 2 μg of total RNA was reverse-transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Catalog # 4368813). cDNA was diluted to 250 ng/μL and qPCR reactions were performed using 250 ng of total cDNA with primers at 300 nM concentration in 10 μL FastStart Sybr Green Master (Roche) according to the manufacturer’s instructions. Briefly, the thermocycling protocol followed a pre-incubation at 95°C for 10 minutes, followed by 45 cycles of 3-Step amplification: 1) denature at 95°C for 20 seconds; 2) anneal and extend at 60°C for 20 seconds; and 3) elongate at 72°C for 20 seconds. All qPCR reactions were conducted in a Roche LightCycler 96 Real-Time PCR System. Primers sequences for qPCR are as follows: Fatty Acid Synthase FWD: GGCGAGTCTATGCCACTATTC, REV: GCTGATACAGAGAACGGATGAG; Indolethylamine N-methyltransferase FWD: CTGGAGAAGGAGACGGTAGAA, REV: CGGGCAACCACGAAGTATAA; Cytochrome P450, family 2, subfamily c, polypeptide 22 FWD: AGAGAGAGAGAGAGAGAGAGAGA, REV: GAGACCCTCTGCATCTCAATAC; 18S Ribosomal Subunit FWD: AAGACGAACCAGAGCGAAAG, REV:TCGGAACTACGACGGTATCT; Cytochrome P450, family 51 FWD: CCTTCCAGTGGTGCTCTTATT, REV: CTAAGCCACTACCCAAAGACTATAC. In all qPCR experiments, 18s RNA expression was used to normalize gene expression within each tissue sample that was processed in triplicate. All data were analyzed using the Livak Delta-Delta CT method [54].

MicroRNA bioinformatic analysis

All microRNA fastq files were processed using the smallrnaseq [51] package in python. Smallrnaseq automates standard bioinformatic processes for quantification and analysis of small non-coding RNA species such as microRNA quantification and novel microRNA prediction. Briefly, smallrnaseq uses bowtie to align fastq files to user defined reference fasta sequences and all reference sequences were downloaded from www.RNAcentral.org (version 14). Following alignment to the Rattus Norvegicus genome and reference tRNA, rRNA, microRNA, lncRNA, and snRNA files, novel microRNA predictions are conducted using microRNADeep2. Additionally, differential expression was automated using the DEseq2 package in R.

Supporting information

S1 Fig. qPCR correlation with mRNA sequencing.

Log fold change comparisons between qPCR and mRNA sequencing of several genes suggesting strong relationship between these two methods.

(TIF)

S1 Table. mRNA raw read counts.

Raw microRNA counts used in the analysis for comparing dietary treatment groups.

(XLSX)

S2 Table. mRNA DeSEQ2 summary statistics.

Summary statistics for the mRNA data from the DeSEQ2 analysis in R.

(XLSX)

S3 Table. MicroRNA DeSEQ2 summary statistics.

Summary statistics for the microRNA data from the DeSEQ2 analysis in R.

(XLSX)

S4 Table. Raw microRNA read counts.

Raw microRNA read counts used in the analyses.

(XLSX)

S5 Table. KEGG/GO analysis.

Gene ontology pathways that were upregulated/downregulated for each set of differentially expressed genes within each tissue using the DAVID database.

(XLSX)

Acknowledgments

We would like to thank Dr. Peng Liu, Department of Statistics, for aiding in planning this project, and the ISU DNA facility staff members Kevin Calvalin, Tanya Murtha and Dr. Mike Baker for their assistance sequencing our samples. Additionally, the authors would like to thank the undergraduate research assistants that helped conduct the experiments and work with the rats.

Data Availability

All relevant data are within the paper and its Supporting Information files. Next-generation sequencing data are publicly available in the Gene Expression Omnibus GEO database under accession number GSE157491, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE157491

Funding Statement

This study was supported by the College of Human Sciences Intramural Collaborative Grant (SC, KS, MR, TD, MK, RV, EM) and the Presidential Interdisciplinary Research Seed Grant Program (KS, SC, MR, TD, MK, RV, EM) at Iowa State University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Zheng Y, Ley SH, Hu FB. Global aetiology and epidemiology of type 2 diabetes mellitus and its complications. Nature Reviews Endocrinology. Nature Publishing Group; 2018. pp. 88–98. 10.1038/nrendo.2017.151 [DOI] [PubMed] [Google Scholar]
  • 2.Folli F, Corradi D, Fanti P, Davalli A, Paez A, Giaccari A, et al. The Role of Oxidative Stress in the Pathogenesis of Type 2 Diabetes Mellitus Micro- and Macrovascular Complications: Avenues for a Mechanistic-Based Therapeutic Approach. Curr Diabetes Rev. 2012;7: 313–324. 10.2174/157339911797415585 [DOI] [PubMed] [Google Scholar]
  • 3.Raza H, John A, Howarth FC. Increased Oxidative Stress and Mitochondrial Dysfunction in Zucker Diabetic Rat Liver and Brain. Cell Physiol Biochem. 2015;35: 1241–1251. 10.1159/000373947 [DOI] [PubMed] [Google Scholar]
  • 4.Sekhar R V., Mckay S V., Patel SG, Guthikonda AP, Reddy VT, Balasubramanyam A, et al. Glutathione synthesis is diminished in patients with uncontrolled diabetes and restored by dietary supplementation with cysteine and glycine. Diabetes Care. 2011;34: 162–167. 10.2337/dc10-1006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Raza H, John A, Howarth FC. Alterations in glutathione redox metabolism, oxidative stress, and mitochondrial function in the left ventricle of elderly zucker diabetic fatty rat heart. Int J Mol Sci. 2012;13: 16241–16254. 10.3390/ijms131216241 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kanikarla-Marie P, Micinski D, Jain SK. Hyperglycemia (high-glucose) decreases l-cysteine and glutathione levels in cultured monocytes and blood of Zucker diabetic rats. Mol Cell Biochem. 2019;459: 151–156. 10.1007/s11010-019-03558-z [DOI] [PubMed] [Google Scholar]
  • 7.Tessari P. Effects of insulin on whole-body and regional amino acid metabolism. Diabetes Metab Rev. 1994;10: 253–285. 10.1002/dmr.5610100304 [DOI] [PubMed] [Google Scholar]
  • 8.Patel D, Rooney R, Groom S. Gene Expression Profiles for the Zucker Fatty Rat Versus Zucker Diabetic Fatty Rat are Highly Consistent with Those Observed in Human Patients. Available: www.criver.com
  • 9.Cordero-Herrera I, Martín MÁ, Goya L, Ramos S. Cocoa intake ameliorates hepatic oxidative stress in young Zucker diabetic fatty rats. Food Res Int. 2015;69: 194–201. 10.1016/j.foodres.2014.12.039 [DOI] [PubMed] [Google Scholar]
  • 10.Zou XR, Zhan LR, Chen L, Long QH, Yuan J, Wang L, et al. Influence of the klotho/FGF23/egr1 signaling pathway on calciumphosphorus metabolism in diabetic nephropathy and the intervention of shenyuan granules. J Biol Regul Homeost Agents. 2019;33: 1695–1702. 10.23812/19-207-A [DOI] [PubMed] [Google Scholar]
  • 11.Yousr M, Howell N. Antioxidant and ACE inhibitory bioactive peptides purified from egg yolk proteins. Int J Mol Sci. 2015;16: 29161–29178. 10.3390/ijms161226155 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fuller NR, Caterson ID, Sainsbury A, Denyer G, Fong M, Gerofi J, et al. The effect of a high-egg diet on cardiovascular risk factors in people with type 2 diabetes: the Diabetes and Egg (DIABEGG) study—a 3-mo randomized controlled trial. Am J Clin Nutr. 2015;101: 705–713. 10.3945/ajcn.114.096925 [DOI] [PubMed] [Google Scholar]
  • 13.Fuller NR, Sainsbury A, Caterson ID, Markovi TP. Egg consumption and human cardio-metabolic health in people with and without diabetes. Nutrients. MDPI AG; 2015. pp. 7399–7420. 10.3390/nu7095344 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Djoussé L, Khawaja OA, Gaziano JM. Egg consumption and risk of type 2 diabetes: a meta-analysis of prospective studies1. Am J Clin Nutr. 2016;103: 474–480. 10.3945/ajcn.115.119933 [DOI] [PubMed] [Google Scholar]
  • 15.Virtanen JK, Mursu J, Tuomainen T-P, Virtanen HE, Voutilainen S. Egg consumption and risk of incident type 2 diabetes in men: the Kuopio Ischaemic Heart Disease Risk Factor Study. Am J Clin Nutr. 2015;101: 1088–1096. 10.3945/ajcn.114.104109 [DOI] [PubMed] [Google Scholar]
  • 16.Garcés-Rimón M, González C, Uranga JA, López-Miranda V, López-Fandiño R, Miguel M. Pepsin Egg White Hydrolysate Ameliorates Obesity-Related Oxidative Stress, Inflammation and Steatosis in Zucker Fatty Rats. Peterson J, editor. PLoS One. 2016;11: e0151193 10.1371/journal.pone.0151193 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Saande CJ, Jones SK, Rowling MJ, Schalinske KL. Whole Egg Consumption Exerts a Nephroprotective Effect in an Acute Rodent Model of Type 1 Diabetes. J Agric Food Chem. 2018;66: 866–870. 10.1021/acs.jafc.7b04774 [DOI] [PubMed] [Google Scholar]
  • 18.Saande CJ, Webb JL, Curry PE, Rowling MJ, Schalinske KL. Dietary Whole Egg Reduces Body Weight Gain in a Dose-Dependent Manner in Zucker Diabetic Fatty Rats. J Nutr. 2019;149: 1766–1775. 10.1093/jn/nxz143 [DOI] [PubMed] [Google Scholar]
  • 19.Dhas Y, Mishra N, Banerjee J. Vitamin D Deficiency and Oxidative Stress in Type 2 Diabetic Population of India. Cardiovasc Hematol Agents Med Chem. 2017;14: 82–89. 10.2174/1871525714666160426150233 [DOI] [PubMed] [Google Scholar]
  • 20.Saande CJ, Steffes MA, Webb JL, Valentine RJ, Rowling MJ, Schalinske KL. Whole Egg Consumption Impairs Insulin Sensitivity in a Rat Model of Obesity and Type 2 Diabetes. Curr Dev Nutr. 2019;3 10.1093/cdn/nzz099 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Pourafshar S, Akhavan NS, George KS, Foley EM, Johnson SA, Keshavarz B, et al. Egg consumption may improve factors associated with glycemic control and insulin sensitivity in adults with pre- and type II diabetes. Food Funct. 2018;9: 4469–4479. 10.1039/c8fo00194d [DOI] [PubMed] [Google Scholar]
  • 22.Dehghan M, Mente A, Rangarajan S, Mohan V, Lear S, Swaminathan S, et al. Association of egg intake with blood lipids, cardiovascular disease, and mortality in 177,000 people in 50 countries. Am J Clin Nutr. 2020;111: 795–803. 10.1093/ajcn/nqz348 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Geiker NRW, Lytken Larsen M, Dyerberg J, Stender S, Astrup A. Egg consumption, cardiovascular diseases and type 2 diabetes. European Journal of Clinical Nutrition. Nature Publishing Group; 2018. pp. 44–56. 10.1038/ejcn.2017.153 [DOI] [PubMed] [Google Scholar]
  • 24.Tran NL, Barraj L, Heilman J, Scrafford C. Egg consumption and cardiovascular disease among diabetic individuals: a systematic review of the literature. Diabetes, Metab Syndr Obes Targets Ther. 2014;7: 121 10.2147/DMSO.S58668 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Aba P, Igwebuike D, Onah J. Effects of Various Concentrations of Quail Egg Solution on Glycemia and Antioxidant Parameters of Alloxan-induced Diabetic Rats. J Adv Med Pharm Sci. 2016;5: 1–7. 10.9734/jamps/2016/22723 [DOI] [Google Scholar]
  • 26.Evans JL, Goldfine ID, Maddux BA, Grodsky GM. Are oxidative stress—Activated signaling pathways mediators of insulin resistance and β-cell dysfunction? Diabetes. American Diabetes Association; 2003. pp. 1–8. 10.2337/diabetes.52.1.1 [DOI] [PubMed] [Google Scholar]
  • 27.Raza H, Ahmed I, John A, Sharma AK. Modulation of xenobiotic metabolism and oxidative stress in chronic streptozotocin-induced diabetic rats fed withMomordica charantia fruit extract. J Biochem Mol Toxicol. 2000;14: 131–139. 10.1002/(sici)1099-0461(2000)14:3<131::aid-jbt2>3.0.co;2-q [DOI] [PubMed] [Google Scholar]
  • 28.Quigley JD. Effects of Spray-Dried Whole Egg and Biotin in Calf Milk Replacer. J Dairy Sci. American Dairy Science Association; 2002. 10.3168/jds.S0022-0302(02)74068-X [DOI] [PubMed] [Google Scholar]
  • 29.Chen X, Du Y, Boni GF, Liu X, Kuang J, Geng Z. Consuming egg yolk decreases body weight and increases serum HDL and brain expression of TrkB in male SD rats. J Sci Food Agric. 2019;99: 3879–3885. 10.1002/jsfa.9610 [DOI] [PubMed] [Google Scholar]
  • 30.Corbett SW, Stern JS, Keesey RE. Energy expenditure in rats with diet-induced obesity. Am J Clin Nutr. 1986;44: 173–180. 10.1093/ajcn/44.2.173 [DOI] [PubMed] [Google Scholar]
  • 31.Montero D, Tachibana C, Rahr Winther J, Appenzeller-Herzog C. Intracellular glutathione pools are heterogeneously concentrated. Redox Biol. 2013;1: 508–513. 10.1016/j.redox.2013.10.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Shen N, Yu X, Pan FY, Gao X, Xue B, Li CJ. An early response transcription factor, Egr-1, enhances insulin resistance in type 2 diabetes with chronic hyperinsulinism. J Biol Chem. 2011;286: 14508–14515. 10.1074/jbc.M110.190165 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Garnett KE, Chapman P, Chambers JA, Waddell ID, Boam DSW. Differential gene expression between Zucker Fatty rats ad Zucker Diabetic Fatty rats: A potential role for the immediate-early gene Egr-1 in regulation of beta cell proliferation. J Mol Endocrinol. 2005;35: 13–25. 10.1677/jme.1.01792 [DOI] [PubMed] [Google Scholar]
  • 34.Zhang J, Zhang Y, Sun T, Guo F, Huang S, Chandalia M, et al. Dietary obesity-induced Egr-1 in adipocytes facilitates energy storage via suppression of FOXC2. Sci Rep. 2013;3: 1–10. 10.1038/srep01476 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Li Tiangang, Owsley Erika, Matozel Michelle, Hsu Peter, Chiang John Y.L.. Transgenic expression of CYP7A1 in the liver prevents high fat diet-induced obesity and insulin resistance in mice | The FASEB Journal. Pharmacol Ther. 2010. [cited 18 Jun 2020]. Available: https://www.fasebj.org/doi/abs/10.1096/fasebj.24.1_supplement.570.4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Gutiérrez-Juárez R, Pocai A, Mulas C, Ono H, Bhanot S, Monia BP, et al. Critical role of stearoyl-CoA desaturase—1 (SCD1) in the onset of diet-induced hepatic insulin resistance. J Clin Invest. 2006;116: 1686–1695. 10.1172/JCI26991 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Mugabo Y, Zhao S, Seifried A, Gezzar S, Al-Mass A, Zhang D, et al. Identification of a mammalian glycerol-3-phosphate phosphatase: Role in metabolism and signaling in pancreatic β-cells and hepatocytes. Proc Natl Acad Sci U S A. 2016;113: E430–E439. 10.1073/pnas.1514375113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Zhang M, Zhu X. miR-9-5p plays an important role in gestational diabetes mellitus (GDM) progression by targeting HK-2. Int J Clin Exp Med. 2018. Available: www.ijcem.com/ 29874342 [Google Scholar]
  • 39.Jassal B, Matthews L, Viteri G, Gong C, Lorente P, Fabregat A, et al. The reactome pathway knowledgebase. Nucleic Acids Res. 2020;48 10.1093/nar/gkz1031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Karst H, Steiniger J, Noack R, Steglich HD. Diet-induced thermogenesis in man: Thermic effects of single proteins, carbohydrates and fats depending on their energy amount. Ann Nutr Metab. 1984;28: 245–252. 10.1159/000176811 [DOI] [PubMed] [Google Scholar]
  • 41.Kvaløy K, Page CM, Holmen TL. Epigenome-wide methylation differences in a group of lean and obese women–A HUNT Study. Sci Rep. 2018;8: 1–9. 10.1038/s41598-017-17765-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Chen J, He X, Huang J. Diet Effects in Gut Microbiome and Obesity. J Food Sci. 2014;79: R442–51. 10.1111/1750-3841.12397 [DOI] [PubMed] [Google Scholar]
  • 43.Corbett SW, Stern JS, Keesey RE. Energy expenditure in rats with diet-induced obesity. Am J Clin Nutr. 1986;44: 173–80. 10.1093/ajcn/44.2.173 [DOI] [PubMed] [Google Scholar]
  • 44.Zhu C, Sawrey-Kubicek L, Bardagjy AS, Houts H, Tang X, Sacchi R, et al. Whole egg consumption increases plasma choline and betaine without affecting TMAO levels or gut microbiome in overweight postmenopausal women. Nutr Res. 2020. [cited 27 Apr 2020]. 10.1016/j.nutres.2020.04.002 [DOI] [PubMed] [Google Scholar]
  • 45.M. Shahbandeh, Statistica 2020. Per capita consumption of eggs in the U.S. 2020 | Statista. In: Statistica.com [Internet]. 28 Jan 2020 [cited 7 Aug 2020]. Available: https://www.statista.com/statistics/183678/per-capita-consumption-of-eggs-in-the-us-since-2000/
  • 46.Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002;30: 207–210. 10.1093/nar/30.1.207 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Leary S, Johnson CL. AVMA GUIDELINES FOR THE EUTHANASIA OF ANIMALS: 2020 EDITION AVMA Guidelines for the Euthanasia of Animals: 2020 Edition* Members of the Panel on Euthanasia AVMA Staff Consultants. 2020.
  • 48.Andrews S. FASTQC. A quality control tool for high throughput sequence data. 2010 [cited 6 Apr 2020]. Available: https://www.bibsonomy.org/person/1f230a919c34360709aa298734d63dca3/author/0
  • 49.Bushnell B, Rood J, Singer E. BBMerge–Accurate paired shotgun read merging via overlap. PLoS One. 2017. 10.1371/journal.pone.0185056 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9: 357–359. 10.1038/nmeth.1923 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Farrell D. smallrnaseq: short non coding RNA-seq analysis with Python. Bioarxiv. 2017; 110585 10.1101/110585 [DOI] [Google Scholar]
  • 52.Robinson MD, Oshlack A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol. 2010;11: R25 10.1186/gb-2010-11-3-r25 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Benjamini, Yoav; Hochberg Y. Controlling the False Discovery Rate—a Practical and Powerful Approach to Multiple Testing. Journal of the Royal Statistical Society Series B-Methodological 1995. pdf. J R Stat Soc Ser B. 1995. 10.2307/2346101 [DOI] [Google Scholar]
  • 54.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25: 402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. qPCR correlation with mRNA sequencing.

Log fold change comparisons between qPCR and mRNA sequencing of several genes suggesting strong relationship between these two methods.

(TIF)

S1 Table. mRNA raw read counts.

Raw microRNA counts used in the analysis for comparing dietary treatment groups.

(XLSX)

S2 Table. mRNA DeSEQ2 summary statistics.

Summary statistics for the mRNA data from the DeSEQ2 analysis in R.

(XLSX)

S3 Table. MicroRNA DeSEQ2 summary statistics.

Summary statistics for the microRNA data from the DeSEQ2 analysis in R.

(XLSX)

S4 Table. Raw microRNA read counts.

Raw microRNA read counts used in the analyses.

(XLSX)

S5 Table. KEGG/GO analysis.

Gene ontology pathways that were upregulated/downregulated for each set of differentially expressed genes within each tissue using the DAVID database.

(XLSX)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files. Next-generation sequencing data are publicly available in the Gene Expression Omnibus GEO database under accession number GSE157491, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE157491


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES