IL-6 effector function of group-2 innate lymphoid cells (ILC2) is NOD2 dependent

Abstract

Cutaneous group 2 innate lymphoid cells (ILC2) are spatially and epigenetically poised to respond to barrier compromise and associated immunological threats. ILC2, lacking rearranged antigen-specific receptors, are primarily activated by damage-associated cytokines and respond with type-2 cytokine production. To investigate ILC2 potential for direct sensing of skin pathogens and allergens, we performed RNA-sequencing of ILC2 derived from in vivo challenged human skin or blood. We detected expression of NOD2 and TLR2 by skin and blood ILC2. Stimulation of ILC2 with TLR2-agonist alone induced IL-5 and IL-13 expression, but also elicited IL-6 expression in combination with Staphylococcus aureus muramyl dipeptide (MDP). Heat-killed skin-resident bacteria provoked an IL-6 profile in ILC2 in vitro that was strikingly impaired in ILC2 derived from patients with NOD2 mutations. In addition, we show NOD2 signaling can stimulate autophagy in ILC2, which was also impaired in patients with NOD2 mutations. Here we have identified a role for ILC2 NOD2 signaling in the differential regulation of ILC2-derived IL-6, and have reported a previously unrecognized pathway of direct ILC2 bacterial sensing.

Introduction

Innate lymphoid cells (ILC) have typical lymphocyte morphology, originate from the common lymphoid progenitor (1) and mirror the T-helper subsets in transcription factor dependence and cytokine production. Human ILC2 have been identified in the blood, skin, nasal, gut and lung tissue (2). ILC2 constitute approximately 0.1% of blood lymphocytes but are principally tissue-resident professional cytokine-producing cells, enriched in number and functional potential in barrier and mucosal tissues (3). Unlike T cells, ILC lack antigen-specific rearranged receptors and are thought to be primarily activated by innate alarmin-like signals. ILC2 are identifiable by a lack of cell surface markers for known lineages and are positively defined by IL-7Rα and Chemoattractant receptor-homologous molecule expressed on TH2 cells (CRTH2) expression (4). CRTH2 is the receptor for the lipid mediator and ILC2-activating factor prostaglandin D2 (PGD2), which is released primarily from activated/degranulating mast cells during infection and allergy (5). ILC2 are also characterized by cell surface expression of the receptors for the alarmin cytokines IL-25, IL-33 and TSLP (6). Indeed, ILC2 type-2 cytokine production is thought to be predominantly activated by these type-2 inducer cytokines and inflammatory lipid mediators such as PGD2 and Leukotriene E4 (LTE4). IL-33 is among the most potent of ILC2 inducer-cytokines (6), and is released passively from the nucleus of epithelial cells upon necrosis; however, there is evidence that IL-33 is produced by a number of hematopoietic cells and other non-hematopoietic cells. Analysis of human skin biopsies and murine studies have established that skin trauma induces IL-33-dependent ILC2 proliferation, migration, and production of the epithelial growth factor amphiregulin (7–9). Notably, abrogation of these ILC2 responses impaired efficient wound closure. In addition to passive release upon epithelial damage, type-2 inducer cytokines and skin-specific ILC2-activating cytokines (e.g. IL-18) are produced by keratinocytes following TLR sensing of atopic dermatitis (AD) skin-colonizing S. aureus (10). ILC2-derived IL-13 and IL-5 have been shown to be crucial for protective responses to Nippostrongylous brassiliensis (11) and pathogenic in the development of allergic asthma (12) and atopic dermatitis (AD)-like lesions (8). Additionally, it is increasingly understood that ILC2 can produce an array of non-classical type-2 cytokines, including GM-CSF and IL-8, through which ILC2 can orchestrate innate and adaptive immune responses (5).

ILC2 are the predominant ILC population in the skin. Cutaneous ILC2 are spatially and epigenetically poised to respond to barrier compromise and associated immunological threats. In contrast, CD4⁺ T cells must undergo significant chromatin remodeling upon activation, highlighting the unique position of ILC2 as sentinels and early effectors mediating responses to cutaneous and mucosal barrier breach (13). As well as being resident in healthy human skin, we and others have shown previously that ILC2 are increased in abundance and are activated within AD lesional skin (8, 9, 14). Notably, ILC2 in AD lesions display elevated IL-25R, IL-33R and TSLPR levels. In murine models of dermatitis (8, 15, 16), ILC2 are increased in frequency and produce IL-4, IL-5 and IL-13, key effectors of AD immunopathology (14, 17). ILC2 dysregulation in AD may in part be mediated by loss of E-cadherin-KLRG1-dependent inhibition of cutaneous ILC2 (8), possibly due to filaggrin deficiency (18).

In addition to sensing the microenvironment via the cytokine/proinflammatory milieu, there is evidence ILC2 can be activated by a diverse range of direct innate signals. Cutaneous NKp30+ILC2 sense increased expression of B7H6 in AD lesions and tumors, inducing type-2 cytokine production (9). ILC are reported to express a variety of TLRs (19–21), however the resulting effector cytokine production may in part depend on a cytokine co-stimulus (22). We have shown previously that ILC2 TLR2 and TLR4 signaling not only induces cytokine production, but can induce Phospholipase A2 Group IVA (PLA2G4A) activity, which was suggested to contribute to ILC2 antigen presentation in the skin (23). Human cutaneous ILC2 have been shown to express the antigen presentation molecules MHCII and CD1a (23, 24), which facilitate dialogue with T cells. However, the exact nature of the role of ILC2 pattern recognition receptor (PRR) signaling is not fully elucidated and may be important for interactions with commensal and pathogenic microflora of the skin. ILC interactions with the microbiome have been documented within skin follicles. Skin ILC-derived TNF and lymphotoxins act on sebaceous glands to regulate production of sebum anti-microbial palmitoleic acid and bacterial commensals (25).

NOD2 is an intracellular PRR (26) that senses bacterial cytosolic peptidoglycan motifs, the most basic of which, common to gram-positive and negative bacteria, is MDP. After recognition of MDP, NOD2 activates MAPK (27) and NF-κB (28) via well-characterized pathways leading to inflammatory and antimicrobial responses. NOD2 plays a key role in host defense through the recognition of pathogenic bacteria and ssRNA viruses (29), induction of autophagy (30), and homeostasis with commensal bacteria (31). In this study, we use a human skin challenge model to investigate the role of PRR signaling to induce ILC2 cytokine production, with findings that show a previously unappreciated mechanism for ILC2 in cutaneous bacterial surveillance.

Results

Human blood and skin ILC2 can express NOD2

ILC2 have been shown to regulate cutaneous barrier protection through orchestration of wound re-epithelialization (7) and allergic immunity in response to innocuous allergens of the skin (8). To analyze the phenotype of cutaneous ILC2 upon in vivo human allergic challenge, skin suction blisters were formed after intradermal injection of house dust mite (HDM) allergen on the arm of a healthy HDM-sensitive index participant. Twenty-four hours later, ILC2 were isolated by fluorescence guided cell sorting, and gene expression was analyzed by RNA sequencing (23) (fig. S1A). The main advantage of the skin suction blister model is that cells are isolated directly from the skin without the need for enzymatic processing, which risks exogenous modulation of gene expression. T cells and blood-derived ILC2 were isolated and analyzed in parallel to aid in the identification of ILC2-specific gene expression. To assess the capacity for ILC2 to sense the cutaneous microenvironment, we analyzed our RNA-seq data set for PRR expression. We found that blister and blood ILC2 express a broad range of PRRs (Fig. 1A). Indeed, TLR2 was highly expressed by blister infiltrating ILC2, as we reported previously (23). We were surprised to detect that both skin and blood ILC2 expressed the gene encoding intracellular PRR NOD2. Further analysis of the data set identified several NOD2 signaling-associated genes expressed by skin-infiltrating and blood ILC2 (Fig. 1B). We went on to validate the RNA-seq skin suction blister result in multiple donors and under steady state conditions. We isolated human blood ILC2 to confirm the expression of NOD2 by real-time PCR and found that NOD2 could be upregulated by ILC2 stimulation with IL-33 (Fig. 1C). ILC2 NOD2 expression was greater than observed in T cells and was not induced by stimulation of T cells with IL-33 or PMA/ionomycin, as suggested in the RNA-seq data set. We confirmed expression of NOD2 protein by human ILC2 using flow cytometry, in both blood and skin biopsy samples (Fig. 1D-F and fig. S2A). NOD2 expression was assessed in blood and skin ILC2 ex vivo and cultured blood-derived ILC2 (fig. S2A). NOD2 was found to be most highly expressed within skin ILC2 (Fig. 1E and fig. S2A), and the expansion and culturing process did not dramatically alter blood ILC2 NOD2 expression. It is of interest that NOD2+ ILC2 were enriched in the skin, where ligand exposure would be most likely. This prompted investigation of the cutaneous localization of NOD2+ ILC2 within the skin. Skin biopsies were subjected to dispase treatment to separate epidermis and dermis, which were then digested enzymatically to determine the NOD2+ ILC2 frequency within these compartments, where we found enrichment of NOD2+ ILC2 within the epidermis (Fig. 1F). Human blood and skin samples were analyzed ex vivo for NOD2 expression by ILC subsets. We found NOD2 expression in all three subsets, however expression was highest in ILC2 (fig. S2B). We therefore focused this study on ILC2 as the predominant ILC population in the skin and a key pathway of AD inflammation. ILC2 NOD2 protein cellular expression was enhanced by stimulation with IL-33 and PGD2 (Fig. 1G), in human blood ILC2 that had been isolated by flow cytometry (fig. S1B-C) and expanded in vitro for use in functional experiments. PGD2 and IL-33 were used in combination to attempt maximal stimulation of ILC2, with IL-33 being the most potent cytokine activator of ILC2, and the PGD₂ receptor, CRTH₂, being the population defining marker for isolation of human ILC2. These observations suggest the presence of the PRR NOD2 within ILC2.

Figure 1. Human ILC2 express pattern recognition receptor NOD2.

A. PRR and B. NOD2 binding partner gene expression of skin blister and blood-derived ILC2 and T cells, as indicated, determined by RNA-Seq and measured in Reads Per Kilobase of transcript per Million mapped reads (RPKM) following 24 hour in vivo HDM blister challenge on the arm of a HDM-sensitive healthy index participant (n=1). C. RT-PCR analysis of NOD2 gene expression by ILC2 or T cells following stimulation with IL-33 (50ng/ml) and/or PGD₂ (100nM), or PMA (15ng/ml) and ionomycin (7.5ng/ml) (PI) (n=4-7, one-way ANOVA with Tukey’s, data representative of 3 independent experiments). Gene expression normalized to GAPDH. D. NOD2 protein expression in human blood ILC2 measured by flow cytometry. Pale grey fill: FMO isotype control. Darker grey fill: blood-derived ILC2 donor NOD2 expression (n=4). E. Summary of ILC2 NOD2 expression by human PBMC and skin biopsy samples, analyzed by flow cytometry (n=4-8, data representative of at least 4 independent experiments). F. Summary of NOD2 expression by ILC2 derived from human skin localized within the epidermis and dermis, analyzed by flow cytometry (n=7, data representative of 4 independent experiments). G. Flow cytometry analysis of NOD2 protein expression intensity by ILC2 following stimulation with IL-33 (50ng/ml) and/or PGD₂ (100nM) as measured by MFI (n=4, t-test, data representative of 3 independent experiments). *, P < 0.05; **, P < 0.01; ****, P < 0.0001.

ILC2 are capable of NOD2 pattern recognition receptor signaling

To further investigate ILC2 NOD2 signaling, we explored the uptake of MDP by ILC2. Analysis of our RNA-seq dataset for known MDP transporters revealed blood and blister ILC2 expression of SLC15A3 and SLC15A4, suggesting the capacity for MDP to be taken up by endocytosis (32–34) (Fig. 2A). Human blood ILC2 were isolated, expanded and cultured with fluorescent MDP (MDP-Rhodamine) or unconjugated Rhodamine B control (5μg/ml for 3 hours) and uptake visualized by flow cytometry (Fig. 2B and fig. S1D) and confocal microscopy (Fig. 2C and fig. S3). ILC2 were stimulated 1 hour prior to addition of MDP-Rhodamine, and we found that TLR2 signaling could increase MDP uptake, which supports previous findings suggesting a synergistic function of MDP and Pam₃CSK₄ (35). To determine the functional significance of ILC2 PRR expression, we isolated and expanded ILC2 from human blood and stimulated with a panel of PRR (TLR and NLR) ligands/agonists. TLR2 (agonist: Pam₃CSK₄) and TLR4 (agonist: LPS) stimulation elicited strong cytokine responses and induced IL-13 and IL-5 upregulation. Interestingly, the same PRR signals induced IL-6 production, a cytokine that is less well understood in ILC2-mediated biology. Strikingly, among the cytokines analyzed, IL-6 only was upregulated by MDP stimulation of NOD2 (Fig. 2D). These data suggest ILC2 are capable of functional PRR responses, notably NOD2 signaling.

Figure 2. ILC2 are capable of functional NOD2 signaling.

A. MDP transporter gene expression of skin blister and blood derived ILC2 and T cells determined by RNA-Seq and measured in RPKM following 24 hour in vivo HDM blister challenge of a HDM-sensitive healthy index participant (n=1). B. MDP-rhodamine (MDP-Rho, 5μg/ml, or Rhodamine B control) uptake measured following 3 hour coculture with ILC2, with/without prior stimulation (1 hour) with Pam₃CSK₄ (10μg/ml) or IL-33 (50ng/ml) measured by flow cytometry (n=9, paired one-way ANOVA with Dunnett’s, data representative of 3 independent experiments) or C. confocal microscopy (data quantified for n=2 donors, 2 images (5x5 tiles) per donor, one-way ANOVA with Dunnett’s). D. RT-PCR analysis of cytokine gene expression by ILC2 following 6 hour stimulation with panel of PRR agonists. Gene expression normalized to GAPDH (n=6, one-way ANOVA with Dunnett’s multiple comparison test, data representative of at least 4 independent experiments). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

NOD2 signaling induces IL-6 effector cytokine production

NOD2 often acts in concert with other PRRs, in particular TLR2 (35–37). NOD2 and TLR2 both recognize conserved components of the peptidoglycan found in bacterial cell walls and are thought to act synergistically. NOD2 stimulation alone typically results in weak responses yet is greatly enhanced by concomitant TLR2 signaling, which is thought to upregulate NOD2 gene expression (38). Expression of TLR2 was detected on ILC2, so we assessed the effect of NOD2 costimulation with Pam₃CSK₄ on ILC2 cytokine expression. We observed that Pam₃CSK₄ stimulation increased IL-13 and IL-5 gene expression, but MDP with Pam₃CSK₄ had the most profound effect on IL-6 expression (fig. S4A). We assessed the effect of TLR2 stimulation on NOD2 gene expression and found that combinations of Pam₃CSK₄ and MDP induced upregulation of NOD2 expression (fig. S4B and Fig. 3A). This finding is interesting given our observation that Pam₃CSK₄ could increase MDP uptake by ILC2. Following MDP sensing, NOD2 recruits RIPK2 via CARD domain interaction. Given the importance of RIPK2 in the NOD2 signaling pathway, we next sought to determine the effect of ponatinib, a specific RIPK2 inhibitor that functions by blocking RIPK2 autophosphorylation and ubiquitination, on ILC2 stimulation. We found that ponatinib ablated the stimulatory effect of MDP/ Pam₃CSK₄ on ILC2-derived IL-6 but not IL-13, suggesting the primary stimulatory factor inducing IL-13 was Pam₃CSK₄ (Fig. 3A). In addition to IL-6 production, we assessed the capacity for NOD2 signaling to induce the production of ILC2-derived IL-8 and found that this was dramatically inhibited by ponatinib (Fig. 3A).

Figure 3. ILC2 NOD2 signaling induces an IL-6 effector cytokine bias.

A. The effect of NOD2 signaling inhibition by ponatinib (25nM, 1 hour) on 6 hour stimulation with MDP (1 μg/ml) and/or Pam₃CSK₄ (10μg/ml) on ILC2 cytokine gene expression, measured by real-time PCR analysis. Gene expression normalized to GAPDH. (n=8, one-way ANOVA with Tukey’s multiple comparison test, data representative of at least 4 independent experiments). B. Real-time PCR analysis of cytokine gene expression by ILC2 following 6 hour stimulation with IL-33 (50ng/ml) and PGD₂ (100nM). Gene expression normalized to GAPDH. (n=3-7, one-way ANOVA with Dunnett’s multiple comparison test, data representative of at least 4 independent experiments). C-D. Induction of ILC2 cytokine expression measured by (C.) real-time PCR following 6 hour stimulation or D. ELISA following 5 day stimulation with MDP (1μg/ml), Pam₃CSK₄ (10μg/ml), and/or IL-33 (50ng/ml) and PGD₂ (100nM). (n=4 or 10 respectively, one-way ANOVA with Tukey’s multiple comparison test, data representative of at least 4 independent experiments). E. ILC2 cytokine protein production assessed ex vivo by intracellular flow cytometry after 24 hour stimulation of PBMC (left) and skin biopsy-derived mononuclear cells (right) with MDP (1μg/ml), Pam₃CSK₄ (10μg/ml), IL-33 (50ng/ml) or PGD₂ (100nM). (n=5-7, one-way ANOVA with Dunnett’s multiple comparison test, data representative of at least 4 independent experiments). F. The effect of NOD2 signaling inhibition by ponatinib (25nM, 1 hour) on 24 hour stimulation with MDP (1μg/ml) and/or Pam₃CSK₄ (10μg/ml) on ILC2 cytokine gene expression measured by intracellular flow cytometry. Expressed as fold changed. (n=5-6, one-way ANOVA with Sidak’s multiple comparison test, data representative of at least 4 independent experiments). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Classical cytokine activation of ILC2, by IL-33 or PGD₂, induced IL-13, IL-5, and IL-8 production but did not affect ILC2 production of IL-6 (Fig. 3B). We stimulated human blood-derived ILC2 with IL-33, PGD₂, MDP and/or Pam₃CSK₄ to assess a possible role for ILC2 PRR signaling as a costimulus to classical cytokine/alarmin signaling, which could direct or bias the effector cytokine response. Elevated IL-6 expression and secretion were detected by RT-PCR after 6 hours, and ELISA analysis of culture supernatant after 5 days of IL-33 and MDP/ Pam₃CSK₄ costimulation (Fig. 3C-D).

To confirm NOD2-induced IL-6 production was not an artefact of in vitro cultured ILC2, we performed stimulation of blood and skin-biopsy mononuclear cells ex vivo without population isolation and expansion and assessed the response of ILC2 by flow cytometry. Ex vivo blood and skin ILC2 produced IL-6 and IL-8 in response to MDP/ Pam₃CSK₄, and IL-13 in response to IL-33 and PGD₂ (Fig. 3E). We confirmed NOD2-dependent production of IL-6 resulting from MDP/ Pam₃CSK₄ stimulation of in vitro isolated and cultured blood ILC2, which was lost upon pre-incubation with ponatinib (Fig. 3F). In contrast, although IL-13 production was induced by MDP/ Pam₃CSK₄, it was not significantly reduced by ponatinib, suggesting Pam₃CSK₄ rather than MDP as the main stimulatory factor (Fig. 3F). IL-6 is a well-established product of NOD2/TLR2 signaling for macrophages and mononuclear cells (35, 38), and these findings indicate that NOD2 can selectively induce ILC2-derived IL-6.

ILC2 are capable of sensing skin-resident bacteria via NOD2 inducing IL-6 production

TLR2, TLR4, and NOD2 are important components of the recognition of PAMPs/pathogens. We sought to determine the role of ILC2 PRR signaling in bacterial surveillance. Commensal bacteria are a part of a healthy skin barrier, which can be dysregulated by disease, as observed with the increased skin density of S. aureus in at least 70% of AD cases (39). We used heat-killed bacterial preparations of skin-associated bacteria to assess the potential for ILC2 sensing of the cutaneous microbiota including S. aureus, S. epidermidis, and Pseudomonas aeruginosa. S. aureus is associated with skin infections, AD, and more serious systemic infections and non-healing wounds. S. epidermidis is a benign commensal in most instances but seen as an opportunistic pathogen. P. aeruginosa an opportunistic pathogen sometimes colonizing burns and surgical wounds. We observed IL-6, but not IL-13, production upon stimulation of purified ILC2 with bacterial preparations of S. aureus and S. epidermidis, which was significantly reduced by inhibition of NOD2 signaling with ponatinib (p= 0.0044 and 0.0018 respectively). A similar but non-significant trend was observed for P. aeruginosa (Fig. 4A). IL-8 production appeared to show a similar trend to the IL-6 response. Blood (Fig. 4B) and skin-biopsy (Fig. 4C) ILC2 were stimulated ex vivo within the mononuclear cell population with heat-killed bacteria and this analysis revealed a similar bias in ILC2 effector cytokine production. Skin-associated heat-killed bacteria induced IL-6 and IL-8 but not IL-13 (Fig. 4A-C). Interestingly, concurrent staining of ILC2 cytokine production revealed almost mutually exclusive expression of IL-6 and IL-13 upon bacterial preparation stimulation (fig. S5A-B). We confirmed NOD2-dependent production of IL-6 protein upon bacterial stimulation using in vitro cultured purified ILC2, which was lost upon prior incubation with ponatinib (Fig. 4D). In contrast, IL-13 production could be induced by bacterial preparations, but it was not significantly reduced by ponatinib, suggesting a NOD2-independent stimulatory factor (Fig. 4D). These results suggest ILC2 may utilize NOD2 signaling to sense skin resident bacteria and induce an altered cytokine response.

Figure 4. ILC2 sense bacterial components directly via NOD2.

A. The effect of NOD2 signaling inhibition by ponatinib (25nM, 1 hour) on 6 hour stimulation with heat-killed preparations of SA (S. aureus 10⁸cells/ml), SE (S. epidermidis 10⁸cells/ml) or PA (P. aeruginosa 10⁸cells/ml) on ILC2 cytokine gene expression measured by real-time PCR analysis. Gene expression normalized to GAPDH. (n=5-7, one-way ANOVA with Tukey’s multiple comparison test, data representative of at least 4 independent experiments). B-C. Summary of ILC2 cytokine protein production assessed ex vivo by intracellular flow cytometry after 24 hour stimulation of PBMC (B.) and skin biopsy-derived mononuclear cells (C.) with heat-killed preparations of SA, SE or PA (n=5-7, one-way ANOVA with Dunnett’s multiple comparison test, data representative of at least 4 independent experiments). D. The effect of ponatinib (25nM) 1 hour prior to 24 hour stimulation with heat-killed preparations of SA, SE or PA on ILC2 cytokine gene expression measured by intracellular flow cytometry. Expressed as fold change, (n=5-6, one-way ANOVA with Sidak’s multiple comparison test, data representative of at least 4 independent experiments). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

ILC2 IL-6 effector response to bacterial components is ablated in patients with NOD2 mutations

NOD2 signaling is associated with inflammatory disorders, including being the strongest associated IBD susceptibility gene. Notably, the NOD2 polymorphism R702W has also been associated with AD (40). We sought to determine whether NOD2 signaling defects reduced the ILC2 capacity to sense skin-colonizing bacteria. We stimulated PBMC derived from patients with NOD2 loss of function homozygous mutations with heat-killed bacterial preparations as well as the bacterial components Pam₃CSK₄ and MDP and assessed effector cytokine production by flow cytometry compared to healthy donors with wild-type NOD2. We found IL-6 production was diminished in ILC2 derived from patients with NOD2 mutations relative to wild-type healthy control samples. In healthy donors, MDP, Pam₃CSK₄ and heat-killed bacteria induced IL-6 production. In patients with NOD2 mutations, the IL-6 response was ablated (Fig. 5A and fig. S5C). In contrast, IL-13 production was unaffected by NOD2 mutation status (Fig. 5B and Fig. S5C). Interestingly, the skin homing marker CLA was upregulated by blood ILC2 within the PBMC population upon NOD2 stimulation, with MDP and Pam₃CSK₄, or addition of IL-33 and PGD₂. This increase in CLA expression was lost upon NOD2 stimulation of ILC2 derived from patients with NOD2 mutations (fig. S6A). We genotyped our small cohort of AD patients for NOD2 SNPs to further investigate the clinical relevance of these findings to cutaneous expression of NOD2. We observed the AD-associated R702W mutation at a high frequency, heterozygous in three out of eleven genotyped AD patients and zero out of seven genotyped healthy volunteers (fig. S6B-C), and these data confirm the findings of Macaluso et. al. (40). NOD2 mutations are not present in all AD patients, so we investigated the effector cytokine response of ILC2 derived from wild-type-NOD2 AD patients. ILC2 were analyzed ex vivo within the PBMC population (Fig. 6A-B) following isolation, expansion and culture (Fig. 6C). We saw that wild-type NOD2 AD ILC2 were more responsive to NOD2 signaling and produced IL-6 at a higher basal level (Fig. 6C). Additionally, AD ILC2 produced IL-13 at a higher basal level ex vivo, suggestive of a highly proinflammatory state. ILC2 derived from patients with the R702W heterozygous mutation responded to NOD2 stimuli with significantly less IL-6 than wild-type NOD2 AD ILC2 (fig. S6D), and NOD2 was found to be expressed at a higher level by AD blood-derived ILC2 compared with healthy volunteer ILC2 (Fig. 6D). Taken together, analysis of ILC2 derived from patients with NOD2 mutations and AD has informed our understanding of a NOD2 induced cytokine bias in ILC2 with potential implications for AD immunopathology.

Figure 5. NOD2 mutation reduces ILC2 capacity to produce IL-6.

Induction of ILC2-derived IL-6 (A.) and IL-13 (B.) following 24 hour stimulation with MDP (1μg/ml), Pam₃CSK₄ (10μg/ml), IL-33 (50ng/ml) or PGD₂ (100nM), heat-killed preparations of SA (S. aureus), SE (S. epidermidis) or PA (P. aeruginosa) measured by intracellular flow cytometry in PBMC from healthy volunteers with wild-type NOD2 gene expression (WT NOD2) or patients with loss of function NOD2 mutations (NOD2 SNPs). (n=4-8, one-way ANOVA with Sidak’s multiple comparison test, data representative of at least 6 independent experiments). ***, P < 0.001; ****, P < 0.0001.

Figure 6. Atopic dermatitis patient derived ILC2 exhibit enhanced NOD2 dependent IL-6 production.

A. Induction of ILC2-derived IL-6 (A.) and IL-13 (B.) following 24 hour stimulation with MDP (1μg/ml), Pam₃CSK₄ (10μg/ml), heat-killed preparations of SA (S. aureus), SE (S. epidermidis) or IL-33 (50ng/ml) and PGD₂ (100nM), measured by intracellular flow cytometry in PBMC from healthy volunteers (HC) or patients with atopic dermatitis (AD). (n=4, one-way ANOVA with Sidak’s multiple comparison test, data representative of 3 independent experiments. C. Induction of ILC2-derived IL-6 following 24 hour stimulation with MDP (1μg/ml), Pam₃CSK₄ (10μg/ml), heat-killed preparations of SA, SE or IL-33 (50ng/ml) and PGD₂ (100nM), measured by intracellular flow cytometry in ILC2 isolated and expanded from healthy volunteers (HC) or patients with atopic dermatitis (AD) (n=3-5, one-way ANOVA with Sidak’s multiple comparison test, data representative of 3 independent experiments). D. NOD2 protein expression following 24 hour stimulation with Pam₃CSK₄ (10μg/ml) or IL-33 (50ng/ml) and PGD₂ (100nM), measured by intracellular flow cytometry in PBMC from healthy volunteers (HC) or patients with atopic dermatitis (AD). (n=7, one-way ANOVA with Tukey’s multiple comparison test, data representative of 3 independent experiments. *, P < 0.05; **, P < 0.01; ****, P < 0.0001.

NOD2 stimulation can induce ILC2 autophagy

Autophagy is a crucial mechanism of bacterial immunity and conversely can be co-opted by certain bacteria to infiltrate host cells. In addition to cytokine production, NOD2 signaling induces autophagy as a bacterial defense mechanism. Autophagy is important for skin homeostatic and inflammatory processes, including S. epidermidis and S. aureus immunity. Our ILC2 RNA-seq data set revealed expression of a number of autophagy-associated genes in blood and blister-infiltrating ILC2 (fig. S7). We detected expression of ATGL16 the NOD2 binding protein, which is crucial for assembly of the autophagic complex (fig. S7).

To investigate the role of autophagy in ILC2 bacterial sensing, we analyzed autophagic potential of ILC2 ex vivo in human PBMC and skin-biopsy derived mononuclear cells following stimulation with heat-killed bacterial preparations and PRR agonists. We used LC3-II as a surrogate for autophagy that can be measured by flow cytometry, and we observed TLR2 and NOD2 ligand-induced autophagy in skin ILC2. A similar trend was observed for blood ILC2 although significance was not reached. The most striking induction of autophagy in ILC2 was seen in response to heat-killed S. aureus and S. epidermidis (Fig. 7A-B). To confirm ILC2 intrinsic induction of autophagy by bacterial preparations/PAMPs, we purified ILC2 from human blood, expanded the cells in vitro and stimulated them with NOD2 agonists, heat-killed skin bacteria, or IL-33. We observed induction of LC3-II+ autophagosomes upon NOD2 and bacterial stimulation (Fig. 7C and fig. S8), suggesting ILC2 are capable of sensing bacteria that can trigger an autophagic response. Autophagosome formation was assessed in ILC2 derived from patients with NOD2 mutations; LC3-II induction was ablated (Fig. 7D). Given the importance of autophagy for ILC2 modulation of metabolic fuel usage and as such effector cytokine responses (41), we set out to investigate the potential functional consequences of NOD2 induced ILC2 autophagy. Using ILC2 purified and expanded from healthy volunteers, we inhibited autophagy using 3-methyladenine (3MA, 5mM, 1 hour) and then stimulated ILC2 with NOD2 ligand sources for 10 hours. We then added IL-33 and PGD₂ to the culture system to induce a robust type-2 cytokine response (50ng/ml and 100nM overnight, respectively). We assessed ILC2 IL-13 production by intracellular flow cytometry and found a NOD2-dependent increase in IL-33/PGD₂-induced IL-13 production, which was lost on autophagy inhibition. These data suggest that ILC2 intrinsic NOD2 signaling can influence the type-2 cytokine response in addition to directly inducing IL-6 production independent of type-2 inducer cytokines (Fig. 7E).

Figure 7. Bacterial stimulation of ILC2 induces autophagy via NOD2.

A. Summary of ILC2 autophagy assessed ex vivo by intracellular flow cytometry staining of LC3-II after 24 hour stimulation of PBMC and skin-biopsy derived mononuclear cells with heat-killed preparations of SA (S. aureus), SE (S. epidermidis) or PA (P. aeruginosa) and B. Representative flow cytometry plots of skin biopsy-derived ILC2. (n=5-9, one-way ANOVA with Dunnett’s multiple comparison test, data representative of at least 5 independent experiments). C. Summary of ILC2 autophagy assessed in purified human blood ILC2 by intracellular flow cytometry staining of LC3-II after 24 hour stimulation with MDP (1μg/ml), Pam₃CSK₄ (10μg/ml), IL-33 (50ng/ml) or PGD₂ (100nM), heat-killed preparations of SA, SE or PA. (n=6, one-way ANOVA with Dunnett’s multiple comparison test, data representative of 3 independent experiments). D. Induction of ILC2-LC3-following 24 hour stimulation with MDP (1μg/ml), Pam₃CSK₄ (10μg/ml), heat-killed preparations of SA, SE or PA measured by intracellular flow cytometry in PBMC from healthy volunteers with wild-type NOD2 gene expression (WT NOD2) or patients with loss of function NOD2 mutations (NOD2 SNPs) (n=3-6, one-way ANOVA with Sidak’s multiple comparison test, data representative of 3 independent experiments). E. The effect of autophagy inhibition by 3-methyladenine (5mM, 1 hour) on 6 hour stimulation with MDP (1μg/ml), Pam₃CSK₄ (10μg/ml), IL-33 (50ng/ml) or PGD₂ (100nM) on ILC2 IL-13 induction measured by flow cytometry. (n=8 donors, one-way ANOVA with Tukey’s multiple comparison test, data representative of 4 independent experiments). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Taken together, these data define a previously unappreciated role for ILC2 in the sensing of skin resident bacteria through NOD2 with resulting IL-6 effector cytokine bias and autophagic potential.

Discussion

NOD2 is expressed in the intestine by numerous cell types, including hematopoietic cells (42) (B cells (43), macrophages (44, 45), dendritic cells (46), mast cells (47), monocytes (48), eosinophils (49), and neutrophils (50)) and non-hematopoietic cells (Paneth cells (51), stem cells (52), goblet cells (53), and enterocytes (54, 55)). Within the skin, NOD2 expression is less well characterized but has been reported in keratinocytes (56, 57). Here we report the previously unrecognized expression of functional NOD2 in human ILC2. NOD2 was expressed by both circulating and cutaneous skin-infiltrating ILC2. In addition to NOD2 we detected gene expression of a number of NOD2 binding partners, some of which interact directly with NOD2 to enhance or inhibit functional activity (58). Interestingly, we noted expression of genes encoding the following negative regulators of NOD2 signaling Erbin, Centaurin B1, Angio-Associated Migratory Cell Protein, Carbamoyl-Phosphate Synthetase 2, Mitogen-Activated Protein Kinase Binding Protein 1 (JNKBP1) and Suppressor of Cytokine Signaling-3 (58–62) in blood and skin ILC2. Careful regulation of NOD2 signaling would be required in the skin, where an effective dialogue between immune cells and the microbiome is key for a heathy barrier. Indeed, uncontrolled NOD2 signaling could lead to a highly proinflammatory state in the skin and dysbiosis. Furthermore, we found evidence that IL-33 and PGD₂ could amplify the NOD2 response in ILC2 possibly through increase of NOD2 expression. Thus, the cytokine microenvironment can skew the resulting NOD2 immune cascade with potential NOD2 signaling regulation mechanisms governing ILC2-intrinsic responses.

Our findings add to the understanding of ILC2 effector cytokine regulation; we show that whereas alarmin cytokine activation of ILC2 induces IL-13 and IL-5, combined NOD2 and TLR2 signaling biases ILC2 cytokine production towards IL-6 and IL-8. Through direct sensing of PAMPs (MDP and Pam₃CSK₄), as opposed to DAMP/alarmin cytokines (IL-33/PGD₂), ILC2 induced an altered cytokine profile dominated by IL-6 and IL-8. These discrete cytokine-producing ILC2 could represent distinct populations of ILC2, or an activation state induced by microenvironmental cues. IL-8 is a well-defined effector cytokine of NOD2 signaling, and is important for protective neutrophilia induced during bacterial infection (63). NOD2 ^-/- mice are reported to have a delayed and damaging response to S. aureus with increased skin lesions and impaired bacterial clearance, which is dependent on IL-6 (56). Similarly, in a sterile wound setting, NOD2 deficiency leads to a substantial defect in wound repair associated with an initial delay in neutrophil recruitment (64). Additionally, IL-6^-/- mice have greatly increased skin inflammation following chemical irritant challenge, showing that NOD2 and IL-6 are important for efficient wound healing and response resolution. When the skin barrier is compromised, bacteria can colonize the wound and impair healing and contribute to the inflammation of skin lesions in AD. NOD2 deficiency results in increased bacterial abundance following injury and delays wound closure. NOD2^-/- mouse wounds are reportedly colonized by the opportunistic pathogenic species P. aeruginosa, and this was linked to chronic inflammation and wound infection (65–67). There is evidence that NOD2 modulates both proinflammatory and anti-inflammatory effects depending on the presence of cytokines or bacterial products in the microenvironment (68). Therefore, more information is required to understand the role of NOD2 in wound healing.

ILC interaction with the microbiome has been reported within skin follicles regulating bacterial commensalism (25). Here we show that ILC2 can detect S. aureus, S. epidermidis and P. aeruginosa via NOD2 and induce differential ILC2 production of IL-6 and IL-8, and we suggest a pathway in which ILC2 may play an important role in regulating the skin microflora and maintaining homeostasis and wound healing capacity. S. aureus, a clinically important pathogen that causes skin infection in patients with AD, has been previously demonstrated to induce autophagy (28). NOD2 recruits ATG16L1 to the plasma membrane at the site of bacterial entry for the encapsulation of the invading bacterium in an autophagosome (30). This pathway was lost in cells homozygous for Crohn’s disease (CD)-associated NOD2 loss of function mutation resulting in increased intestinal inflammation and bacterial load (69–71). Notably, ATG16L1 and NOD2 SNPs are both implicated in increased susceptibility to CD (69, 72–74). More recently, additional RIPK2-dependent mechanisms of NOD2-dependent autophagy induction have been proposed in DCs (46) and macrophages, where TLR2 and NOD2/RIPK2 deficiencies lead to defective autophagic responses to Listeria monocytogenes (75).

Here we found NOD2 agonists and heat-killed bacterial preparations induced formation of LC3-II+ autophagosomes in a NOD2-dependent manner in ILC2. We observed that autophagy was induced by the cytokines IL-33 and PGD₂ and NOD2 signaling. Mutations in autophagy related genes, including NOD2 and NLRP12, have been associated with AD. Autophagy contributes to the maintenance of the cutaneous barrier, inflammation, defense against invading pathogens (S. aureus) and keratinocyte homeostasis (76). We observed loss of MDP/Pam₃CSK₄-induced amplification of IL-33 and PGD₂-induced IL-13 production upon inhibition of autophagy (41). Furthermore, patients with NOD2 loss of function SNPs may lack protective anti-microbial ILC2-derived IL-6 and IL-8 signaling, thus exacerbating AD, as suggested by our results showing greater NOD2 expression and IL-6 production in wild-type-NOD2 AD patient ILC2.

Polymorphisms in the gene encoding NOD2 are associated with chronic inflammatory diseases, including CD (77), inflammatory skin disease Blau Syndrome (78) and early onset sarcoidosis (79). The three main NOD2 polymorphisms, R702W (40), G908R, and L1007fsinsC, are highly associated with susceptibility to CD, and NOD2 is the strongest susceptibility gene for IBD (77, 80, 81). These mutations result in NOD2 loss of function and reduced responsiveness to MDP, which enables invasion of bacteria and abnormal mucosal immunity, culminating in chronic intestinal inflammation (77, 80, 82, 83). Due to the dysbiosis, NOD2^-/- mice display increased sensitivity to dextran sulfate sodium-induced colitis and colonic adenocarcinoma (84, 85). NOD2 polymorphisms, particularly R702W, have also been linked to AD, and we found heterozygous mutations in our AD cohort, and AD is characterized by exacerbation of S. aureus-related inflammation (40, 86, 87). S. aureus infection of human keratinocytes induces NOD2 gene expression and consequently IL-17C production. Furthermore the S. aureus load was significantly reduced in keratinocytes overexpressing functional NOD2 (88).

In this study, we found that NOD2 mutation/blockade significantly reduced ILC2-derived IL-6 and autophagic responses to heat-killed skin bacterial preparations. These data however, may have implications for AD patients with NOD2 mutations, suggesting an ILC2-dependent mechanism by which NOD2 mutations can impact on AD immunopathology through altered cytokine production and autophagy. Here we highlight the heterogeneity of AD immunopathology, for which three patients in our AD cohort (n=11) displayed heterozygous R702W mutations that appeared to result in reduced ILC2 IL-6 production potential in response to NOD2 stimulation. We suggest this response may contribute to a reduction in antimicrobial and pro-wound healing effects of the NOD2 pathway characteristic of AD lesions. Conversely, in the wild-type-NOD2 group of AD patients, increased IL-6 production potential was observed with an increase in NOD2 expression, and this may contribute to the published increase in IL-6 in AD patients (89, 90) and exacerbate the proinflammatory effects of NOD2/IL-6 and IL-13 signaling resulting in damaging inflammation in the skin.

The suction blister technique offered us access to human skin ILC2 directly ex vivo without need for further processing, however it added potential limitations to the study. Suction blisters introduce physical trauma to the skin challenge, and multiple suction blisters are required to study ILC2 thus participant numbers are limiting. The scarcity of ILC2 in the skin and suction blisters lead to functional investigation of ILC2 NOD2 stimulation in purified and cultured blood ILC2. The blood volume collected from NOD2 mutation patients was not sufficient for analysis of purified NOD2 loss-of-function ILC2. Therefore we analyzed ILC2 within NOD2 mutation patient PBMCs ex vivo and used ponatinib to inhibit NOD2 signaling in purified cultured wildtype NOD2 ILC2. However, ponatinib inhibits RIPK2 signaling, which is not unique to NOD2. As such a combination of reductionist approaches was used to investigate the functional consequences of ILC2 NOD2 signaling. Human skin allergen challenge offers temporal associations with clinical and immunological findings, lending support of causality, but ILC2 intrinsic NOD2-deficient mouse models may offer further evidence in the future.

Elucidation of the roles of cutaneous ILC2 has provided us with potential new targets for therapeutic intervention. ILC2 are not unique in expression of NOD2 in the skin, and other more abundant cells play important roles in the NOD2 pathway, however, we envisage ILC2 occupying a discrete niche in the NOD2 response by combining antigen sensing power via NOD2, TLR2, MHCII and CD1a with rapid cytokine production that orchestrates the ensuing immune response. Activation of ILC2 via NOD2 has the potential not only to orchestrate the immune response by IL-6 production but to influence other NOD2 expressing cell populations and tailor the subsequent anti-bacterial and allergic immune response.

Materials and methods

Study design

The study was designed to test the hypothesis that ILC2 can sense bacterial ligands/PAMPs via NOD2 and TLR2. Adult participants were only excluded if on systemic immunosuppression or topical calcineurin inhibitors. Clinic participants were recruited sequentially; blinding and randomization were not required as there was no intervention. All study participants gave fully informed written consent (NHS National Research Ethics Service (NRES) research ethics committee (REC) 14/SC/0106 and 14/NW/1153). Variation between the functional responses of different donors is expected as cells were isolated from individuals of differing age, gender, ethnicity and medical history, although broadly defined as healthy controls. The nature of functional human ILC2 experiments requires the expansion of primary ILC2. We use flow cytometry to sort ILC2 at 100 cells per well and expand using MLR, as detailed below, and these ILC2 lines could have variable receptor expression and therefore functional responses over and as well as inter-donor variation. Sample size was determined based on previous studies of ILC2 responses in humans (8, 9, 23). All experiments were replicated as presented in the figure legends.

Antibodies and flow cytometry

For FACS surface staining the cells were labelled with the following anti-human antibodies (Biolegend sourced unless otherwise stated): CD3 (OKT3, BV650: 317324), CD19 (HIB19, PerCP: 302228), CD123 (32703, Bio-Techne, PerCP : FAB301C), CD11b (M1/70, PerCP: 101230), CD11c (BU15, PerCP: 337234), CD8 (RPA-T8, PerCP: 301030), FcεRI (CRA-1, PerCP: 334616), CD14 (HCD14, PerCP: 325632), CD4 (OKT4, PerCP: 317432), CD45 (2D1, AF700: 368514), CD56 (HCD56, BV605: 318334, PerCP : 318342), CRTH2 (BM16, Miltenyi Biotec, PE : 130-113-600), IL-7Ra (A019D5, PECy7: 351320), Live/Dead violet or Aqua (Invitrogen).

Intracellular cytokine staining was completed using the eBioscience FoxP3 Fix/Perm kit as per the manufacturer’s instructions with 10 hour Brefeldin-A (eBioscience) treatment and stained with anti-IL-13 (85BRD, Life Technologies, FITC : 11-7136-42), IL-6 (MQ2-13A5, APC: 501112), IL-8 (E8-N1, APC: 511410), NOD2 (2D9 : Bio-Techne, NB100-524), LC3b (ab51520, abcam) antibodies.

Suction blister technique

Suction blister cups were applied to the forearm skin of a healthy adult volunteer with sensitivity to HDM allergen under local ethics approval (NRES 09/ H0606/71), at a vacuum pressure of 250 mmHg. Blisters were generated over the site of a HDM intradermal injection. Blisters were formed within 30 – 90 min of suction application. Blister fluid was aspirated 24 hours later using a 30 gauge needle. Fluids were then centrifuged at 1500 rpm for 5 min at 4°C and the cells were stained with cell surface antibodies for flow cytometric isolation of ILC2 and T cells utilized for RNA sequencing analysis (23). This experiment was performed in one index donor, but to validate the RNA-seq skin suction blister result in multiple donors and under steady state conditions, samples of healthy unchallenged human skin were analysed ex vivo for expression of NOD2 by ILC2 using flow cytometry.

RNA Sequencing

Suction blister fluid and blood derived PBMCs were centrifuged at 1500 rpm for 5 minutes at 4°C to pellet the blister-infiltrating cells, which were re-suspended in PBS. Blister and blood cell populations were isolated by flow cytometry and collected directly into TRIzol LS; T cells (CD3+) and ILC2 (Lin^- CD45+ CD3^- IL-7Rα+ CRTH2+). The manufacturer’s protocol was followed for TRIzol LS mRNA extraction as far as “Phase Separation”. The RNA containing phase was then processed using Qiagen RNAeasy mini kit and contaminating DNA was removed using Ambion Turbo DNase. The total purified RNA was then processed using a NuGEN Ovation RNA-seq system V2 (Ultralow DR multiplex kit). Samples were sequenced on an Illumina HiSeq 2000. Following QC analysis with the fastQC package (http://www.bioinformatics.babraham.ac.uk/projects/fastqc), reads were aligned using STAR (63) against the human genome assembly (NCBI build37 (hg19) UCSC transcripts). Non-uniquely mapped reads and reads that were identified as PCR duplicates using Samtools (64) were discarded. Gene expression levels were quantified as read counts using the featureCounts function (65) from the Subread package (66) with default parameters. RPKM values were generated using the edgeR package (67).

Cell sorting and culture

PBMCs were isolated from healthy adult donors under local ethics approval (National Research Ethics Service 09/ H0606/71). ILC2 were isolated and cultured as previously described (7). Briefly, the lineage (CD3/CD4/CD8/CD14/CD19/CD56/CD11c/CD11b/CD123/FcεRI)^-, CD45+, IL-7Rα+, CRTH2+ ILC2 population was sorted into 96-well plates at 100 cells per well and resuspended in MLR of gamma-irradiated PBMCs from three healthy volunteers (2x10⁶ cells / ml) coupled with 100 IU / ml IL-2 and PHA. After 4 – 6 weeks the growing cells were tested by flow cytometry staining to ensure a pure population of lineage^-CRTH2⁺IL-7Rα⁺ ILC2 was obtained (fig. S1B-C).

Cytokines and TLR agonists

For stimulation studies ILC2 were incubated in culture with stimulants and/or inhibitors (Table 1.) for 6 - 120 hours at 37°C as noted in the figure legend. Cells were then centrifuged at 1500 rpm for 5 minutes at 4°C and supernatant saved for ELISA and cells used for RT-PCR analysis or flow cytometry.

Quantitative RT-PCR

mRNA extraction was performed using a TurboCapture 96 mRNA kit (Qiagen, 72251) following the manufacturer’s instructions. cDNA was prepared from the mRNA using M-MLV reverse transcriptase (Invitrogen). Taqman probes for GAPDH (Hs02786624_g1), NOD2 (Hs01550753), IL6 (Hs00174131), IL13 (Hs001743790), IL5 (Hs01548712), IL8 (hs00174103) were used to analyze gene expression of ILC2 cultures on a QuantStudio7 Flex real time PCR machine.

Analysis of immune cells within human skin biopsies

To analyze NOD2+ populations in the skin, samples of human skin were processed as described below. Samples were taken under GCP guidance with ethical approval of the NRES Committee South Central. Hairs and subcutaneous fat were removed. To analyze the cells of whole thickness skin samples, the explants were cut in to < 0.5mm pieces using scalpel in petri dishes and incubated in collagenase P (1 mg / ml Roche) containing media overnight at 37°C. After overnight digestion, the remaining tissue was homogenized with a Pasteur pipette and endonuclease deoxyribonuclease I (DNase I) 200 Kunitz unit/ml (Roche 10104159001) added for 15 minutes at room temperature then passed through a 70 μm strainer (VWR) and washed with cold 10 mM EDTA solution. After centrifugation, the pellet was resuspended in cold RPMI and passed through a 40 μm strainer ready for further analyses. To isolate the epidermis 1 cm² sections of skin were placed epidermis down in a petri dish containing 5 U / ml dispase at 4°C overnight. The epidermal layer was then peeled from the dermis with forceps and diced and digested with 0.5 % Trypsin 0.02 % EDTA at 37°C for 15 minutes. The samples were homogenized with a Pasteur pipette and strained through a 40 μM filter and washed in FCS containing media. The separated dermis was processed as above for whole thickness skin samples with 2.5 hour collagenase P digestion.

Fluorescent imaging

ILC2 were stimulated for 1 hour with Pam₃CSK₄, or IL-33 and PGD₂, as reported in the main text and figure legend, and were then incubated for 3 hours with MDP-rhodamine (Invivogen, 5μg/ml) or Rhodamine B control (Sigma, 5μg/ml) for detection of ILC2 uptake of MDP. ILC2 were then washed three times with PBS and applied to slides with cytospin and stored at -20°C. Slides were fixed with 4% PFA for 10 minutes and washed twice in PBS, then mounted using antifade mounting medium with DAPI (Vector Laboratories Ltd), coverslips were applied, and slides were refrigerated in the dark until analyzed by confocal microscopy (Zeiss LSM 780 Confocal Microscope-Inverted Microscope; 25x/0.8 Imm Korr DIC M27; room temperature; Axiocam camera; Zen software), and Fiji was used for image processing. DAPI and/or MDP-Rhodamine positive cells were counted manually using the ImageJ multipoint tool.

Genotyping of NOD2 mutations

Blood was collected from patients with Crohn’s disease and healthy volunteers, and genomic DNA was extracted. (NRES 18/WM/0237; GI 16/YH/0247 and IBD 09/H1204/30). Atopic dermatitis patient and healthy volunteer samples were collected under local ethics approval at OUH NHS dermatology clinic (NRES 14/SC/0106). Samples were subjected to physical homogenization (100 mg of 1.4-mm ceramic beads, 4,000 r.p.m.) or Qiagen lysis buffer, and DNA was isolated using a DNeasy Blood & Tissue Kit (Qiagen). gDNA was then used as the template for Taqman MGB biallelic discrimination assay to identify SNPs rs2066844 (R702W), rs2066845 (G908R), and rs2066847, a frame-shift mutation (1007fs). The genotyping assays for rs2066844 (AB ID: C_11717468_20) and rs2066845 (AB ID: C_11717466_20) were supplied by Applied Biosystems. The genotyping assay for rs2066847 was custom developed by Applied Biosystems and used forward primer, GTCCAATAACTGCATCACCTACCT; reverse primer, CAGACTTCCAGGATGGTGTCATTC) and fluorophore-labeled TaqMan MGB probes (VIC-labeled, CAGGCCCCTTGAAAG; FAM-labeled, CAGGCCCTTGAAAG). Reactions were performed according to the manufacturer’s instructions. Briefly, 10 ng of genomic DNA was mixed with 12.5ul of 2×TaqMan Universal PCR Master Mix (No AmpErase UNG) and 1.25ul of 20 × SNP Genotyping Assay, and PCR was carried out on a QuantStudio7 Flex real time PCR machine (ThermoFisher Scientific). Thermal cycling conditions were: 95° C for 10 min followed by 40 cycles of 95° C for 15 s (melting step) and 60° C for 60 s (anneal/extend step). Detection of fluorescent signal was performed according to the recommended protocols for the QuantStudio7 Flex real time PCR machine, and the results were analysed using the accompanying Sequence Detection System Software V.1.3.1 (Applied Biosystems).

Statistical analysis

The one and two-way ANOVA tests, paired and unpaired T-tests were performed using GraphPad Prism version 6.00 (GraphPad Software). Error bars represent standard deviation as indicated.

One sentence summary.

Human ILC2 express NOD2 and secrete IL-6 in response to bacterial ligands.

Data and Materials Availability

The sequencing data are available in Hardman et al 2017 (23). All other data needed to evaluate the conclusions in the paper are present in the paper or the Supplementary Materials