Gene Editing in Human Induced Pluripotent Stem Cells Using Doxycycline-Inducible CRISPR-Cas9 System

Abstract

Induced pluripotent stem cells (iPSCs) generated from patients are a valuable tool for disease modelling, drug screening, and studying the functions of cell/tissue-specific genes. However, for this research, isogenic iPSC lines are important for comparison of phenotypes in the wild type and mutant differentiated cells generated from the iPSCs. The advent of gene editing technologies to correct or generate mutations helps in the generation of isogenic iPSC lines with the same genetic background. Due to the ease of programming, CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas9-based gene editing tools have gained pace in gene manipulation studies, including investigating complex diseases like cancer. An iPSC line with drug inducible Cas9 expression from the Adeno-Associated Virus Integration Site 1 (AAVS1) safe harbor locus offers a controllable expression of Cas9 with robust gene editing. Here, we describe a stepwise protocol for the generation and characterization of such an iPSC line (AAVS1-PDi-Cas9 iPSC) with a doxycycline (dox)-inducible Cas9 expression cassette from the AAVS1 safe harbor site and efficient editing of target genes with lentiviral vectors expressing gRNAs. This approach with a tunable Cas9 expression that allows investigating gene functions in iPSCs or in the differentiated cells can serve as a versatile tool in disease modelling studies.

1. Introduction

The ability of iPSCs to differentiate to cell types of all three lineages combined with the ease of the CRISPR-Cas9 tool for gene editing provides a tremendous opportunity to study gene functions and to generate in vitro models for disease modelling and drug screening [1–3]. However, disruption of genes that are important for both maintenance of pluripotent stem cells and their differentiation to a specific lineage affects such functional studies. In this context, an inducible Cas9 expression system [4–7] helps to knock out the gene of interest at a specific time window and allows temporal control of gene editing. Importantly, the flexibility in switching off Cas9 expression evades the detrimental effects of upregulated p53 expression associated with persistent gene editing and Cas9 expression [8, 9].Previous studies utilizing transfection of plasmids co-expressing Cas9 and a fluorescent protein or an antibioticresistance gene have enabled the enrichment of the cells for gene editing. However, the transient expression of the gene editing vectors and the lack of a robust transfection protocol resulted in low gene editing efficiencies [10–12]. This was subjugated with the use of lentiviral vectors to express Cas9 and gRNAs, followed by an antibiotic selection of the transduced cells [13]. Another study used lentiviral vectors with the dox-inducible expression of Cas9, which allowed multiplexed gene targeting upon induction of Cas9 expression [13]. These lentivirus expressed CRISPR-Cas9 tools yielded a depletion in gene expression of up to 90% and were successfully employed in CRISPR-Cas9 gene editing libraries [13, 14]. However, the integrated lentiviral vectors can undergo transgene silencing in iPSCs, and such an inducible system can display leaky expression resulting in heterogeneous uncontrolled gene editing [15, 16]. This issue in pluripotent stem cells has been overcome by expressing transgenes from the AAVS1 safe harbor site that possess native insulator elements that prevent transgene silencing [17]. When transfected with the plasmids to express gRNAs in the iPSC lines containing dox-inducible Cas9 cassette from AAVS1 site, it gave an editing efficiency of nearly 60% [4, 5], and the efficiency increased to 90% [8] when the gRNAs were expressed by lentiviral vectors that allowed antibiotic-resistance-based enrichment of cells expressing both gRNAs and Cas9. We adopted this strategy for creating mutations in the disease-associated genes for creating mutant iPSCs.

In this chapter, a stepwise protocol (see Fig. 1a) for the introduction of a dox-inducible Cas9 cassette into the AAVS1 locus using TALEN plasmids is described. In addition, we have also described a strategy (see Fig. 1b) to obtain cells that express both Cas9 and gRNA for efficient gene editing. Using the AAVS1-PDi-Cas9 iPSC line, we were able to obtain stable levels of Cas9 expression and faster gene editing in a very low concentration of dox (see Fig. 2c, e).

Fig. 1.

(a) Schematic representation depicting the targeting of dox-inducible Cas9 expressing donor plasmid to the AAVS1 safe harbor locus by TALEN based gene editing. HA-L and HA-R: left and right homology arms targeted to the AAVS1 safe harbor region, Puro^R: Puromycin resistance gene, TRE3G: Tet-On 3G tetracycline-inducible promoter element and EP: Endogenous promoter in the AAVS1 locus for the expression of the puromycin resistance gene. (b) Schematic representation of editing the target genes in the AAVS1-PDi-Cas9 iPSC line. AAVS1-PDi-Cas9 iPSCs are transduced with lentiviruses that co-express gRNA and EGFP. The GFP+ cells are flow sorted and dox is added to induce Cas9 expression and gene editing. The gene-edited cells are used for disease modelling

Figure 2.

(a) Junction PCR product from the puromycin resistant AAVS1-PDi-Cas9 iPSC clones analyzed by agarose gel electrophoresis. An amplified product of 1068 bp is generated by this PCR. Lane 1: 1 kb DNA molecular weight ladder, lane 2: positive control genomic DNA obtained from another cell line carrying dox-inducible Cas9 cassette in its AAVS1 locus. Clones 1, 2 and 3 are three different iPSC clones with integration at the AAVS1 safe harbor site. (b) Western blot showing Cas9 expression in the presence of dox for all the three clones isolated. (c) Western blot showing Cas9 expression at different concentrations of dox. Lanes 1–6: Cas9 expression at 1, 0.5, 0.25, 0.125, 0.06, and 0.03 μg/mL concentration of dox, Lane 8: without dox. (d) Confocal microscopy images after staining with anti-Cas9 antibody showing the expression of Cas9 in all the cells of a AAVS1-PDi-Cas9 iPSC line. Images from four different cell clusters are shown (e) T7EI assay showing efficient gene editing of RPS24 after treating the cells with different concentrations of dox for 3 days. MW: 1 kb ladder, Lanes 1–3: gene editing at dox concentrations of 1, 0.5 and 0.25 μg/mL and Lane 4: without dox. Red arrows indicate the bands obtained after cleavage by T7EI

2. Materials

2.1. Plasmids

1. AAVS1 site editing and integration plasmids.

   • (a)
     pAAVS1-PDi-CRISPRn (Addgene ID 73500): Donor plasmid containing the elements for dox-inducible expression of Cas9 flanked with AAVS1 site homology arms [7].
   • (b)
     pAAVS1P-iCAG.copGFP (Addgene ID 66577): Donor plasmid with the copGFP gene flanked by AAVS1 site homology arms [18].
   • (c)
     pZT-AAVS1-R1 (Addgene ID 52638) and pZT-AAVS1-L1 (Addgene ID 52637): TALEN plasmids targeting the AAVS1 site [18].
2. Lentivirus generation plasmids.

   • (a)
     pLKO5.sgRNA.EFS.GFP (Addgene ID 57822): Lenti-viral plasmid for expressing gRNAs [19].
   • (b)
     psPAX2 (Addgene ID 12260): Lentivirus packaging plasmid.
   • (c)
     pMD2.G (Addgene ID 12259): VSV-G lentiviral envelope plasmid.

2.2. Feeder-Free Human iPSC Culture

1. Geltrex (Gibco).

2. Vitronectin (Gibco).

3. Human iPSC cell line (CSCRi005-A) [20].

4. mTeSR1 (STEMCELL Technologies) iPSC culture medium.

5. DMEM/F12 (Gibco).

6. CloneR (STEMCELL Technologies).

7. RevitaCell supplement 100 × (Gibco) (Prepare alx solution by adding 10 μL of RevitaCell in 1 mL of iPSC culture medium).

8. TrypLE Express (Gibco).

2.3. Transfection of iPSCs

1. Lipofectamine Stem Reagent (Thermo Fisher Scientific).

2. Opti-MEM medium (Thermo Fisher Scientific).

3. Plasmid extraction kit (NucleoSpin, Transfection-grade, Macherey-Nagel).

4. AAVS1 site editing and integration plasmids (see Subheading 2.1).

5. Puromycin (Sigma-Aldrich), prepared as a 1 mg/mL solution in sterile distilled water.

6. iPSC culture reagents (see Subheading 2.2).

2.4. Cell Sorting

1. FACSAria III cell sorter (BD Biosciences).

2. Fetal bovine serum (US Origin, Thermo Fisher Scientific).

3. iPSC culture reagents (see Subheading 2.2).

4. Cloning medium (mTeSR1 medium containing 10% CloneR).

2.5. Junction PCR

1. Gentra Puregene Cell DNA extraction kit (Qiagen).

2. RNase solution (Sigma-Aldrich).

3. Isopropanol (molecular biology grade, Sigma-Aldrich).

4. 75% ethanol, prepared from absolute ethanol (molecular biology grade, Sigma-Aldrich).

5. PCR tubes (any brand).

6. Primers: Forward-: 5′ CTGCCGTCTCTCTCCTGAGT 3′ and Reverse-: 5′ GTGGGCTTGTACTCGGTCAT 3′.

7. EmeraldAmp MAX HS PCR master mix (Takara Bio).

8. Nuclease-free water.

9. Thermal cycler (any brand in which ramping rate can be modified).

10. 1 kb DNA ladder (Thermo Fisher Scientific).

11. Tris base, acetic acid, and EDTA (TAE) buffer (Bio-Rad).

12. Agarose (any brand).

13. Ethidium bromide (Sigma-Aldrich).

14. Gel documentation system (any brand).

2.6. Western Blotting

1. RIPA (radioimmunoprecipitation assay) cell lysis buffer (Sigma-Aldrich).

2. Phenylmethylsulfonyl fluoride (Sigma-Aldrich).

3. Protease Inhibitor Cocktail (Halt protease inhibitor single-use, Thermo Fisher Scientific).

4. Protein Assay Kit II (Bio-Rad).

5. 30% Acrylamide-Bis solution 29:1 (Bio-Rad).

6. Tris Base (MP Biomedicals).

7. 0.5 M Tris-HCl buffer pH 6.8 (Bio-Rad).

8. 1.5 M Tris-HCl buffer pH 8.8 (Bio-Rad).

9. Sodium dodecyl sulfate (SDS) (MP Biomedicals), prepared as a 10% solution in distilled water.

10. Ammonium persulfate (APS) (Sigma-Aldrich), prepared as a 10% solution in distilled water.

11. N,N,N′,N′ Tetramethyl ethylenediamine (TEMED) (MP Biomedicals).

12. Glycine (MP Biomedicals).

13. Electrophoresis buffer (3.03 g of Tris Base, 14.4 g of glycine and 1 g of SDS dissolved in 1000 mL of distilled water).

14. Transfer buffer (dissolve 3.5 g Tris Base, 16.8 g of glycine in 800 mL distilled water and add 600 μL of 10% SDS solution and 240 mL methanol. Make up the volume to 1200 mL).

15. PBST: Phosphate buffered saline (PBS) (Hyclone) containing 0.1% Tween-20 (Sigma-Aldrich).

16. 2 × Laemmli buffer (Sigma-Aldrich).

17. Pre-stained protein molecular weight ladder (BLUltra protein ladder, GeneDireX, Inc.).

18. Blocking buffer (0.5 g of blotting-grade blocker (Bio-Rad) dissolved in 10 mL of PBST).

19. Polyvinylidene difluoride (PVDF) membrane (GE Healthcare Life sciences).

20. Mouse anti-Cas9 (Invitrogen, Cat. no. MA1-201).

21. Mouse anti-Actin (BD biosciences, Cat. no. BD612656).

22. Mini-Protean Tetra Cell electrophoresis module (Bio-Rad).

23. Westar Supernova chemiluminescent HRP substrate (CYANAGEN).

24. Gel documentation system (any brand).

2.7. Immunofluorescence

1. Glass bottom 35 mm dishes (Ibidi).

2. iPSC culture reagents (see Subheading 2.2).

3. Cloning medium (see Subheading 2.4).

4. Paraformaldehyde (PFA) (Sigma-Aldrich), prepared as 4% solution in PBS.

5. Permeabilization buffer (0.25% Triton X-100 in PBS).

6. Anti-Cas9 rabbit polyclonal primary antibody (Guide-it, Takara Bio, Cat. no. 632607).

7. Goat anti-Rabbit IgG Alexa flour-594 secondary antibody (Thermo Fisher Scientific).

8. ProLong Gold antifade reagent (Invitrogen).

9. Bovine serum albumin (BSA) (Sigma-Aldrich).

10. Triton X-100 (Sigma-Aldrich).

2.8. Designing gRNA

We recommend Broad Institute CRISPRko or Synthego CRISPR Design Tool to design gRNAs (Follow the criteria/steps provided in Subheading 3.7).

2.9. Cloning of gRNAs

1. Stbl3 Competent cell (Thermo Fisher Scientific).

2. BsmBI (NEB).

3. pLKO5.sgRNA.EFS.GFP plasmid (see Subheading 2.1).

4. Oligos (see Subheading 3.7 for the design of oligos).

5. T4 polynucleotide kinase (PNK) (NEB).

6. T4 DNA ligase (NEB).

7. Gel DNA extraction kit (GenepHlow, Geneaid).

8. Antarctic phosphatase (NEB).

9. Luria-Bertani (LB) broth (HIMEDIA).

10. Luria-Bertani (LB) agar (HIMEDIA).

11. Carbenicillin (VWR Life Science).

12. Super optimal broth with catabolite repression (SOC) medium (HIMEDIA).

13. Plasmid extraction mini kit (Favorgen).

14. BsmBI (NEB).

15. HindIII (NEB).

2.10. Lentivirus Production and Transduction

1. Plasmids for lentivirus generation (see Subheading 2.1).

2. HEK-293T cells (ATCC).

3. DMEM (Gibco).

4. TransIT-LT1 transfection reagent (Mirus Bio).

5. Opti-MEM I medium (Gibco).

6. Hexadimethrine bromide (Polybrene, Sigma-Aldrich), prepared as 8 mg/mL solution in sterile distilled water.

7. Lenti-X concentrator (Takara Bio).

8. Refrigerated centrifuge.

2.11. Cas9 Expression and Gene Editing

1. Doxycycline (dox) (Sigma-Aldrich), prepared as a 1 mg/mL solution in sterile distilled water.

2. iPSC culture reagents (see Subheading 2.2).

3. Concentrated lentiviruses (see Subheading 3.9).

4. T7 Endonuclease I (T7EI) (NEB).

5. Primers (sequences depend on the genomic region).

6. EmeraldAmp MAX HS PCR master mix (Takara Bio).

7. Nuclease-free water.

8. Thermal cycler (any brand in which ramping rate can be modified).

9. 1 kb DNA ladder (Thermo Fisher Scientific).

10. TAE buffer (Bio-Rad).

11. Agarose (any brand).

12. Ethidium bromide (Sigma-Aldrich).

13. Gel documentation system (any brand).

2.12. Other Required Materials

1. CO₂ incubator, 37 °C with 5% CO₂.

2. Thermo-Shaker (any brand).

3. Centrifuge tubes 15 and 50 mL (Corning).

4. Microcentrifuge tubes 1.7 mL (Axygen).

5. Round-bottom polystyrene tubes, 5 mL (Falcon).

6. 2 mL Polypropylene tubes (TPP).

7. Cell culture plates (Costar, Corning).

8. PBS (HyClone).

9. Penicillin-Streptomycin (Gibco).

10. Filter tips 10p, 200p, and 1000p.

3. Methods

3.1. Human iPSC Culture and Maintenance

The following are the steps that we standardized to culture the iPSCs in feeder-free conditions. We found that these conditions provided better cell attachment and transfection efficiency and also the culture of iPSCs as single cells.

1. Dilute Geltrex 1:100 with DMEM/F12 medium.

2. To coat 1-well of a 12-well plate, add 500 μL of diluted Geltrex and incubate at 37 °C for 1 h.

3. After 1 h, discard the coating solution and add 500 μL of mTeSR1 medium (see Note 1).

4. Thaw the cells from a cryovial containing iPSCs from half well ofa 12-well plate. Swirl the cryovial in a water bath maintained at 37 °C until a small amount of ice flake is left in the vial.

5. Add 1 mL of DMEM/F12 medium drop by drop to the cryovial containing cells.

6. Transfer the contents gently to 9 mL of DMEM/F12 medium pre-warmed at room temperature (RT).

7. Centrifuge the cells at 120 × g for 5 min at RT.

8. Discard the medium and resuspend the pellet gently in 500 μL of mTeSR1 medium. It is important to avoid multiple pipetting steps that can cause breaking of colonies to smaller pieces.

9. Transfer the whole-cell suspension to the Geltrex coated well containing 500 μL of mTeSR1 medium (see Note 2).

10. Culture the cells at 37 °C with 5% CO₂. Change medium every day.

11. Once the cells reach 80% confluency, passage the cells in 1:4 ratio using TrypleE Express.

12. Add 500 μL of TrypLE Express in each well and incubate for 4 min at 37 °C.

13. Add 500 μL of mTeSR1 medium into the wells and dislodge the remaining attached cells.

14. Transfer the cells to a 15 mL centrifuge tube and collect the cells by centrifugation at 120 × g for 5 min at RT.

15. Discard the supernatant, loosen the pellet by gentle tapping and resuspend the cells in 4 mL of mTeSR1 medium containing 1 × RevitaCell and seed the cells in four wells of a 12-well plate, pre-coated with Geltrex (see Note 3).

16. Passage the cells to expand the colonies for the generation of cry stocks of iPSCs.

3.2. Transfection and Selection of Stably Transfected iPSCs

1. Dissociate the cells following the steps 12–14 of Subheading 3.1.

2. Resuspend the cells in 1 mL of mTeSR1 medium and pipette the medium gently to make a single cell suspension and use 10 μL for cell count.

3. Seed 25,000 cells per well of a 24-well plate coated with Geltrex and containing 500 μL of mTeSR medium supplemented with 1 × RevitaCell (see Note 4).

4. After 20 h, replace the medium with fresh iPSC medium without RevitaCell and incubate for another 4 h.

5. Prepare the transfection complex containing 125 ng of each of the TALEN plasmids (pZT-AAVS1-R1 and pZT-AAVS1-L1) and 250 ng of the donor plasmid pAAVS1-PDi-CRISPRn in 50 μL Opti-MEM containing 1 μL of Lipofectamine Stem Reagent. Similarly, prepare a transfection complex containing pAAVS1P-iCAS.copGFP donor plasmid.

6. Mix the contents by pipetting 4–5 times and incubate for 10 min at RT.

7. Add the transfection complex to the cells and, after a gentle swirl, keep the plate in an incubator at 37 °C with 5% CO₂.

8. After 16–24 h, add 500 μL of fresh mTeSR1 medium in each well and culture the cells for another 24 h.

9. After 48 h, replace the medium with fresh culture medium and assess the transfection efficiency with GFP using fluorescent microscopy or flow cytometry (an efficiency of up to 60% can be obtained) (see Note 5).

10. After the cells reach 80% confluency, add puromycin at a concentration of 0.5 μg/mL for 3 days and 1 μg/mL of puromycin for 5–8 days, and stop puromycin when all the non-transfected cells are dead. Transfer the puromycin resistant colonies to a 24-well plate following the steps 12–14 of Subheading 3.1.

11. Passage the puromycin resistant colonies when they are 80% confluent. Expand the colonies to make sufficient cryo stocks (see Note 6).

3.3. Single Cell Sorting and Subcloning of iPSCs

A small percentage of cells with random integration may be present after puromycin selection. Therefore, it is important to generate subclones of the puromycin selected iPSC cells to isolate the clones with AAVS1 site-specific integration. This can be achieved by single cell sorting of the iPSCs.

1. Coat all the wells of a 96-well plate with 50 μL of Geltrex in each well and incubate the plates at 37 ° C for 1 h.

2. Aspirate the coating solution and add 100 μL of cloning medium.

3. Dissociate the iPSCs following Subheading 3.1 (steps 12–14).

4. Discard the supernatant and resuspend the cells in 1 mL of cloning medium supplemented with 5% FBS.

5. Sort the cells as single cells in the 96-well plate containing cloning medium using a flow cell sorter. Culture the cells following the manufacturer’s protocol.

6. After 10 days, dissociate the cells using TrypLE Express and seed the cells in a 24-well plate with mTeSR1 medium containing 1x RevitaCell (see Note 7).

7. When the cells reach 80% confluency, dissociate the colonies with TrypLE Express and take half the cells for DNA to perform junction PCR. Culture the rest of the cells for expansion.

3.4. Junction PCR

To validate the targeted integration of the dox-inducible Cas9 cassette at the AAVS1 locus, a junction PCR with primers to amplify the region between the endogenous AAVS1 locus and the puromycin resistance gene in the AAVS1 donor plasmid can be used [7].

1. Extract the DNA using Gentra Puregene Cell DNA extraction kit from the cells collected at step 7 of Subheading 3.3. As only a few cells are used for DNA extraction, we recommend using 150 μL of cell lysis solution. All the steps are followed as per the manufacturer’s protocol.

2. For the PCR reaction, mix 5 μL of EmeraldAmp MAX HS PCR master mix, 0.2 μM of each of the junction PCR primers (see Subheading 2.5), 150 ng of the genomic DNA, and make up the volume to 10 μL using nuclease-free water.

3. The cycling conditions for PCR are, 98 °C for 30 s, 30 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 1 min, and a final extension at 72 °C for 3 min.

4. Analyze the PCR product in a 1% agarose gel prepared in TAE buffer (see Fig. 2a).

3.5. Western Blotting

After selecting the clones positive for the junction PCR, it is important to perform western blotting to check the dox-inducible Cas9 expression and to confirm that there is no leaky expression of Cas9 in the AAVS1-PDi-Cas9 iPSCs in the absence of dox.

1. Culture the junction PCR positive iPSC clones with and without dox supplementation in one well each of a Geltrex coated 6-well plate.

2. Once the cells reach 80% confluency, harvest the cells using TrypLE Express.

3. Pellet the cells by centrifuging the cell suspension at 200 × g for 5 min.

4. Remove the supernatant and wash the pellet with 1 mL of PBS by centrifugation at 200 × g for 5 min.

5. Discard the supernatant and lyse the cells with 50 μL RIPA buffer containing 1% PMSF and protease inhibitor cocktail by incubating on ice for 30 min with tapping every 5 min (see Note 8).

6. After 30 min, centrifuge the tubes at 12,000 × g for 30 min at 4 °C.

7. Harvest the supernatant and perform protein estimation by Bradford protein assay following the manufacturer’s protocol. The lysates can be stored at this stage at −80 °C or proceed with western blotting.

8. Set up the gel casting apparatus, Mini-Protean Tetra Cell module (Bio-Rad) following the manufacturer’s instructions.

9. Prepare 10 mL of 7% resolving gel solution by mixing 5.1 mL of distilled water with 2.3 mL of 30% (29:1) acrylamide-bis solution, 2.5 mL of Tris-HCl (1.5 M, pH 8.8), 100 μL of 10% SDS, 66 μL of 10% APS, and 8 μL of TEMED.

10. Add approximately 3.25 mL of the resolving gel solution to the casting tray and cover the gel surface with isopropanol. Wait for 30–45 min for the gel to polymerize.

11. Discard the isopropanol by tilting the tray and wipe the residual isopropanol using a blotting paper.

12. Prepare 10 mL of 4% stacking solution by mixing 6 mL of distilled water with 1.32 mL of 30% (29:1) acrylamide-bis solution, 2.52 mL of Tris-HCl (0.5 M, pH 6.8), 100 μL of 10% SDS, 100 μL of 10% APS, and 8 μL of TEMED.

13. Insert the comb and wait for 30 min for the solution to polymerize.

14. Remove the comb and transfer the gel cassette to the electrophoresis module containing running buffer.

15. Mix 30 μg of protein with equal volume of 2 × Laemmli buffer containing loading dye, and incubate the samples in a boiling water bath for 5 min and chill on ice immediately.

16. Centrifuge the samples at 12,000 × g for 5 min at 4 °C and transfer the supernatant to a fresh tube.

17. Load the samples in the wells. Load 5 μL of pre-stained protein ladder in one of the wells.

18. Perform electrophoresis at 80 V for 2.5 h. Once the run is complete, remove the gel cassette.

19. Activate the PVDF membrane in methanol for 2 min and assemble the western blotting transfer apparatus in the Bio-Rad electrophoresis module containing transfer buffer.

20. Perform protein transfer at 30 V at 4 °C, overnight.

21. Remove the membrane, wash with PBST and block the membrane with 5 mL of blocking buffer for 1 h.

22. Wash the membrane with 5 mL of PBST.

23. As the Cas9 protein has a molecular weight of 160 kDa and Actin has 42 kDa, based on the pre-stained protein molecular weight marker cut the membrane into two pieces to do western blotting for Cas9 and Actin separately.

24. Incubate the membranes in 5 mL of primary antibody prepared in PBST (anti-Cas9 at 1:1000 and anti-Actin at 1:5000 dilution) for 4 h with gentle rocking at RT.

25. Wash the membrane with 5 mL of PBST thrice, 10 min each.

26. Incubate in 5 mL of secondary anti-mouse HRP antibody prepared in PBST (1:5000) for 2 h with gentle rocking at RT.

27. Repeat the washing step 25.

28. Perform chemifluorescence detection following the manufacturer’s protocol. Take images immediately using a chemifluorescence imager (see Fig. 2b).

3.6. Screening of Clones by Immunofluorescence

Rarely, after flow sorting, there may be more than one cell per well. To exclude the possibility of contaminating cells that do not carry the Cas9 cassette, we recommend performing immunofluorescence for Cas9 expression in the AAVS1-PDi-Cas9 iPSCs.

1. Coat a 35 mm glass bottom dish with Geltrex matrix and incubate the plates at 37 °C for 1 h.

2. Aspirate the coating solution and add 1 mL of cloning solution.

3. Dissociate the iPSC clones positive for Cas9 expression to single cells using TrypLE Express, steps 1 and 2 (see Subheading 3.2).

4. Count the cells and seed about 1000 cells in each dish, with each clone in iPSC medium with and without dox (see Note 9).

5. Incubate the cells overnight at 37 °C with 5% CO₂.

6. After 24 h, remove the medium and fix the cells in 4% PFA for 20 min, RT.

7. Remove PFA and wash the fixed cells with PBS.

8. Add 1 mL of permeabilization buffer and incubate the cells for 10 min, RT and Wash the cells with PBS.

9. Block the cells with 1% BSA in PBS for 1 h, RT.

10. Replace the blocking buffer with anti-Cas9 rabbit polyclonal primary antibody prepared at 1:200 dilution in blocking buffer. Incubate the plates at 4 °C overnight.

11. Next day, discard the primary antibody and wash the cells once with PBS.

12. Incubate the cells with Alexa-594 anti-rabbit secondary antibody prepared in blocking buffer at 1:400 dilution. Incubate the plates in the dark at RT for 2 h.

13. Discard the antibody solution and wash the cells with PBS.

14. Incubate the cells in PBS containing DAPI (dilution 1:500).

15. Discard the solution and mount the cells with two drops of ProLong Gold antifade reagent.

16. Image the cells under a confocal microscope or a simple fluorescent microscope (see Fig. 2d).

17. Screen at least 100 cells per clone and identify the clones which have Cas9 expression in the presence of dox in all the cells.

3.7. Designing gRNA and Cloning

We use Broad Institute CRISPRko (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design) or Synthego CRISPRdesign tool (https://www.synthego.com/products/bioinformatics/crispr-design-tool) to design gRNAs. For the best efficiency in gene editing, pick the guide sequences with high score/rank for the selected genomic region. As 5′ ‘G’ is required for efficient transcription initiation by the U6 promoter, select the gRNAs starting with ‘G’ or add ‘G’ at the beginning of the guide sequences. When an additional ‘G’ is added in the beginning of the gRNA forward oligo, a base ‘C’ should be added at 3′ end of the reverse oligo to facilitate proper annealing of the gRNA. It is important to exclude the sequences that have ≥4 ‘T’s, which are recognized as a transcription termination signal by RNA-Polymerase III.

1. Design the gRNA sequences following the criteria above.

2. Add CACCG at the 5′ end of the sense guide sequence and add AAAC at the 5′ end of the antisense guide sequence and synthesize the oligos.

3. Resuspend the synthesized oligos in nuclease-free water to obtain 100 μM concentration.

4. For the phosphorylation of oligos, mix 1 μL each of forward and reverse oligos, 1 μL of T4 DNA ligase buffer, 0.5 μL of PNK, and 6.5 μL of nuclease-free water. Incubate at 37 °C for 30 min.

5. Anneal the oligos in a thermocycler with the following program, 95 °C for 5 min and ramp down the temperature to 25 °C with 1 °C drop per minute.

6. Dilute the annealed oligos to 1:200, by mixing 2 μL of the phosphorylated annealed oligos with 398 μL of nuclease-free water.

7. Digest 5 μg of pLKO5.sgRNA.EFS.GFP plasmid with BsmBI in a 100 μL reaction volume at 37 °C for 3 h.

8. Gel-purify the linearized vector and estimate the DNA concentration.

9. Setup the ligation reaction by mixing 100 ng of the digested plasmid backbone, 2 μL of annealed oligos, 1 μL of T4 DNA ligase, 1 μL ofbuffer, and make up the volume to 10 μL using nuclease-free water. Incubate at 16 °C, overnight.

10. Proceed to transformation.

3.8. Transformation, Colony Picking and Screening

The ligated products of the desired gRNAs are transformed into Stbl3 competent cells (see Note 10).

1. In an ice bucket, thaw the competent Stbl3 cells.

2. To 50 μL of the competent cells add 2 μL of the ligated product and incubate in ice for 30 min.

3. Heat-shock the cells at 42 °C for 45 s. Place the vials immediately on ice and incubate for 2 min.

4. Add 250 μL of SOC medium and incubate the cells at 37 °C for 90 min with gentle rocking.

5. Plate 50 μL of cells on LB agar plates containing 100 μg/mL carbenicillin. Incubate the plates overnight at 37 °C.

6. Next day, pick up to three colonies using a 200 μL sterile tip and culture them in 5 mL LB broth at 37 °C, with rocking at 220 rpm, overnight.

7. Extract the plasmids using plasmid extraction mini kit (Favorgen) following the manufacturer’s protocol.

8. Digest the plasmids with the restriction digestion enzymes, BsmBI and HindIII. As the cloning destroys the BsmBI restriction site, identify the clones resistant to BsmBI digestion displaying a pattern of five fragments. If the cloning is successful, five fragments with the molecular weights of 3350, 2606, 584, 556, and 312 bp will be obtained.

9. Store the plasmids at −80 °C or proceed for transfection in HEK-293T cells to generate lentiviruses.

3.9. Lentivirus Production

Providing the gRNA through lentiviruses helps in the stable expression of gRNAs and the gene editing can be induced by Cas9 expression with dox supplementation in the medium.

1. Seed 0.8 × 10⁶ HEK-293T cells in each well of a 6-well plate in DMEM containing 10% FBS.

2. After 16 h, replace the culture medium with fresh DMEM + 10% FBS.

3. Prepare the transfection complex in a polypropylene tube by mixing 2 μg of pLKO5.sgRNA.EFS.GFP, 1 μg of pMD2G and psPAX2 in 250 μL of Opti-MEM I medium and add 7.5 μL TransIT-LT1 transfection reagent.

4. Mix the components by tapping and incubate for 20 min at RT.

5. Add the transfection complex gently as drops to each well containing HEK-293T cells.

6. After 24 h, replace the medium with fresh DMEM + 10% FBS.

7. Harvest the supernatant containing the lentiviruses after 48, 60 and 72 h (see Note 11).

8. Pool the supernatants and concentrate the lentiviruses to 100 × using Lenti-X concentrator following the manufacturer’s protocol.

3.10. Transduction of iPSCs and Sorting of the Transduced Cells

The protocol for transduction of AAVS1-PDi-Cas9 iPSCs and further processing of the cells for gene editing is described below.

1. Once the cells reach 80% confluency, dissociate the iPSCs in Geltrex coated 12-well plates (see Subheading 3.2, steps 1 and 2). Seed 50,000 cells to each well containing 1 mL of mTeSR1 medium supplemented with 1 × RevitaCell.

2. After 24 h, replace the culture medium with fresh mTeSR1 medium supplemented with 6 μg/mL polybrene.

3. After 2 h, transduce the cells with different volumes of concentrated lentiviruses (see Subheading 3.9). Culture the cells at 37 °C with 5% CO₂.

4. After 24 h, replace the culture medium with fresh mTeSR1 medium.

5. Choose the well that has the desired transduction efficiency for the experiment (see Note 12).

3.11. Flow Sorting the Transduced Cells

The presence of enhanced green fluorescent protein (EGFP) in the lentiviral vector allows enrichment of transduced cells (see Note 13). The methodology below describes the steps for FACS sorting of AAVS1-PDi-Cas9 iPSCs expressing the gRNAs.

1. After transduction, culture the cells for 2 weeks with passaging when the cells reach 80% confluency (see Note 14).

2. After 2 weeks of culture, dissociate the transduced iPSCs to single cells using TrypLE Express by following steps 1 and 2 in Subheading 3.2.

3. Discard the supernatant and resuspend the pellet in 1 mL of mTeSR1 medium containing 5% FBS and 1 × RevitaCell.

4. Sort EGFP positive cells by FACS in a 5 mL polystyrene tube containing mTesR1 and 1 × RevitaCell.

5. After sorting is complete, centrifuge the tube at 120 × g for 5 min at RT.

6. Discard the supernatant, and seed 1 × 10⁵ cells in 1-well of a Geltrex coated 12-well plate containing mTeSR1 medium supplemented with 1 × RevitaCell.

7. After 24 h, replace the culture medium with fresh medium.

8. When the cells reach 80% confluency, passage the cells in 1:4 ratio to 2-wells of a 12-well plate.

9. Take the remaining cells for flow cytometry analysis to determine the percentage of GFP expressing cells (see Note 15).

10. Freeze one of the wells and take cells in the other well for gene editing experiments.

3.12. Inducing Gene Editing

Gene editing can be initiated in the EGFP positive cells by inducing Cas9 expression with dox supplementation at the desired time point either in iPSCs or in any differentiated cells from the iPSCs. Editing of target genes in iPSCs is described below.

1. Dissociate the EGFP positive AAVS1-PDi-Cas9 iPSC colonies by treating them with TrypLE Express, for 4 min at RT.

2. For each gRNA expressing iPSC, in a 12-well plate seed the cells in the mTeSR1 medium without and with dox (1 μg/mL) supplementation.

3. Culture the cells for 4 days with daily medium change.

4. After 4 days, harvest the cells by treating with TrypLE Express and seed 50 μL of the cell suspension from both conditions in a 12-well plate as a backup.

5. Take the rest of the cells for genomic DNA extraction for the T7EI assay (see Subheading 3.13).

6. Expand the iPSCs and cryopreserve them in several vials for carrying out experiments with the gene-edited iPSCs.

3.13. T7 Endonuclease I (T7EI) Assay

T7EI enzyme recognizes and cleaves the heteroduplexes present in the PCR amplified products from the gene-edited regions.

1. Extract the genomic DNA from the dox-treated and untreated conditions.

2. Using Primer3 (Primer3web), design primers that flank the gRNA binding regions to obtain PCR products with sizes ranging from 300 to 600 bp.

3. For the PCR reaction, mix 10 μL of EmeraldAmp MAX HS PCR master mix, 0.2 μM of each of the primer, 150 ng of the genomic DNA and make up the volume to 20 μL using nuclease-free water.

4. Place the tubes in a thermocycler with the following program, 98 °C for 30 s, 30 cycles of 98 °C for 10 s and 60 °C for 30 s, 72 °C for 1 min, and a final extension at 72 °C for 3 min.

5. Confirm PCR amplification by agarose gel electrophoresis.

6. Prepare the T7EI assay reaction by mixing 1 μL of NEB Buffer 2, 200 ng of PCR product and make up the volume to 9.5 μL. In a thermocycler, set the reaction mixture in the following program, initial denaturation 95 °C, 10 min, 95–85 °C with a ramp rate of −2 °C/s, 85–25 °C with a ramp rate of −0.1 °C/s. Hold at 15 °C.

7. Remove the reaction from the thermocycler, and add 0.5 μL of T7EI in each tube. Place the tubes back in the thermocycler and incubate the reaction at 37 °C for 15 min.

8. Load the samples on a 1% agarose gel and document the results. Additional bands with lower molecular weights confirm successful editing (see Fig. 2e)(see Note 16).

4. Notes

1. As an alternative to mTeSR1 medium, mTeSR plus medium can be used, which allows the medium change on alternative days.

2. If the cells were cultured in a matrix other than Geltrex (for example, vitronectin), adapt the cells to Geltrex by three successive passaging on Geltrex coated plates and then use the cells for transfection.

3. Rock inhibitor Y-27632 (10 μm) can also be used instead of RevitaCell.

4. We recommended transfection of iPSCs to be performed with the iPSCs cultured on Geltrex coated plates as we observed the transfection efficiency drops significantly in the cells cultured on vitronectin coated plates.

5. Check the efficiency of the Lipofectamine Stem Reagent periodically with any plasmid that expresses a fluorescent protein as the efficiency of the reagent was found to decrease with the storage time.

6. TrypLE Express treatment generates single cells or smaller iPSC clumps which do not survive well. Therefore, we recommend using 1 × RevitaCell or a rock inhibitor when seeding the cells.

7. When passaged after 10 days, some of the clones might tend to differentiate, and we found that the differentiated cells disappear from culture after 2–3 passages.

8. Scale up the volume of RIPA buffer according to the number of wells used.

9. Seeding more than 1000 cells can cause an improper distribution of single cells or can create clumps, which causes difficulty in the accurate screening of Cas9 positive cells.

10. Stbl3 E. coli cells are recommended for the transformation of lentiviral plasmids due to the lower rate of recombination in the LTR sequences when these cells are used.

11. When collecting the virus-containing supernatant after 48, 60, and 72 h, the fresh medium should be added carefully along the wall of the wells to avoid peeling off of HEK-293T cells.

12. If the transduction efficiency measured by the flow cytometric analysis of the GFP is lower than 30%, the results will be representative of one copy of gRNA integrated per cell.

13. The use of lentiviral vectors expressing an antibiotic-resistance gene makes it difficult to assess transduction efficiency. The efficiency can be easily assessed by FACS using lentivirus vectors which express fluorescent proteins.

14. Flow sorting of the transduced cells after 10 days will provide the cells that have stable integration of lentiviral vectors.

15. Use the cells with the percentage of fluorescence protein more than 90% for high-efficiency gene editing.

16. We have created mutations in several genes and could obtain up to 90% gene editing using lentiviral gRNA vectors in AAVS1-PDi-Cas9 iPSC line. It is also observed that the gene editing is fast with an efficiency >50% in 2–3 days after dox supplementation, and they exhibit similar levels of editing in a range of dox concentrations (see Fig. 2e). To obtain a homogenous population of edited/mutant cells, single cell sorting can be done (see Subheading 3.3), and each clone can be expanded and characterized.