Gel-based Analysis of Protein-Nucleic Acid Interactions

Abstract

Electrophoretic mobility shift assays (EMSAs) are amongst the most frequently used and straightforward experiments for studying protein-nucleic acid interactions. EMSAs rely on the principle that protein-nucleic acid complexes have reduced electrophoretic mobility in a native gel matrix compared to free nucleic acid due to their larger size and reduced negative charge. Therefore, bands for the protein-nucleic acid complexes are shifted in a gel and can be distinguished from free nucleic acids. EMSAs remain a popular technique since they do not require specialist equipment and the complexes formed are easily visualized.

Furthermore, the technique can be adapted to enable various aspects of protein-nucleic acid interactions to be investigated, including sequence specificity, estimated binding affinity, and binding stoichiometry.

1. Introduction

Protein-nucleic acid interactions coordinate many fundamental cellular processes, including DNA replication, transcription, RNA processing, and translation. The electrophoretic mobility shift assay (EMSA), or gel shift assay, is a straightforward but sensitive method of characterizing protein-nucleic acid interactions. Although EMSAs are typically used for qualitative purposes, they can provide quantitative estimates of dissociation constants (affinity measurements), binding stoichiometry, and sequence and structural specificity [1].

Gel-based detection of protein-nucleic acid complexes was first described for the DNA binding lactose operon regulatory network [2,3]. The method anticipates that under electrophoretic conditions, larger protein-bound nucleic acids are retarded within a native gel matrix, whereas unbound nucleic acids have higher electrophoretic mobility [4]. In a vertical electrophoresis apparatus, free nucleic acid is generally found at the bottom of the gel towards the anode and the protein-bound nucleic acids are found “shifted” towards the top (Fig. 1A).

Figure 1. Overview of electrophoretic mobility shift assays (EMSAs).

(A) Gel shift assays make use of the fact that nucleic acids migrate towards the anode. Complexation with binding proteins will lead to a reduction in electrophoretic mobility based on size and charge. (B) Schizosaccharomyces pombe (Sp) poly(A) binding protein (SpPab1) incubated at the indicated concentrations with 200 nM RNA substrate containing a 5′ 20-mer ‘upstream’ region (CAGCUCCGCAUCCCUUUCCC) followed by a 3′ poly(A) tail of 30 adenosines. Higher order structures with multiple SpPab1 molecules are visualized as ‘supershifts’ [9]. (C) Semi-quantitative EMSA to estimate the dissociation constant (K_d) for the interaction between the SpPuf3 PUM domain and an RNA substrate containing a Pumilio response element (PRE). Indicated concentrations of protein were incubated with 1 nM 5′ 6-FAM labeled RNA and scanned using a Typhoon imager (GE). Solid box shows lane where roughly half the substrate is bound which equated to the estimated K_d. Supershifted complexes are uncharacterized protein:RNA oligomers or protein:protein interactions. (D) Densitomery analysis of the boxed dashed area of the gel in (C). See methods section for details.

The results of an EMSA experiment are usually analyzed by detection of the nucleic acid. Thus, the detection limit of the EMSA is defined by the method of readout. Autoradiography of radiolabeled ([³²P]) nucleic acids is the most sensitive method of detection, allowing concentrations of 0.1 nM or less to be used [4]. Radiolabeling does not introduce artificial structures which sometimes interfere with binding. On the contrary, fluorescent or chemiluminescent labels or dyes, while less sensitive, provide a safer and more convenient alternative for nucleic acid detection [5–9].

In addition to being a fast and sensitive technique, EMSAs are compatible with a wide range of nucleic acid and protein structures and sizes. Furthermore, EMSAs have been widely adapted and combined with other techniques such as Western blotting [10] and high-throughput sequencing [11] to extract additional information. Nonetheless, EMSAs have some limitations as complex formation is not in true chemical equilibrium. Furthermore, EMSAs do not provide information regarding the binding site on either the protein or nucleic acid. Thus, observations from EMSAs are most often verified using other complementary techniques, such as fluorescence polarization (chapter 12), microscale thermophoresis (chapter 9), surface plasmon resonance (chapter 23), or structural methods.

Here, we outline the materials and steps required for EMSAs. These include preparation of the native polyacrylamide gel, preparation of protein-nucleic acid samples, electrophoresis, and imaging. We further discuss several common adaptations of EMSAs, including semi-quantitative estimation of affinity, supershift assays, and competitive EMSAs.

2. Materials

RNase and DNase contamination should be avoided. Therefore, it is important to work on clean benches and to protect the samples from contamination by wearing gloves at all times (see Note 1). Furthermore, all solutions should be made up and diluted using fresh ultrapure water (MilliQ) with analytical grade reagents. Solutions can also be treated with diethylpyrocarbonate (DEPC) and autoclaved to avoid nuclease contamination (see Section 2.2). Filter-sterilize all solutions with a 0.22 μm filter to remove precipitates or particulate contaminants. Take special precautions (according to local safety procedures) when handling toxic or radioactive materials.

2.1. Native polyacrylamide gel

1. 10× TBE (Tris-Borate EDTA) stock: Weigh 108 g tris(hydroxymethyl)aminomethane (Tris) base, 9.3 g ethylenediaminetetraacetic acid (EDTA) and 55 g boric acid. Dissolve in water and top up to 1 liter. Autoclave the resulting solution (121 °C, 15 min). The solution can be stored at room temperature indefinitely, but should be discarded if there is any visible precipitation.

2. Isopropanol: supplied at ≥ 99.9% purity (HPLC grade).

3. Native polyacrylamide gel mix: 8% gel stock (see Note 2). Mix 50 ml of 10× TBE and 100 ml of 40% (w/v) 19:1 acrylamide:bis-acrylamide solution (preferably gasstabilized, see Note 3)). Make up to 500 ml with MilliQ water and degas by vacuum filtration. This solution can be made fresh or stored as an unpolymerized stock at 4 °C for several months. We routinely make an unpolymerized gel stock solution when performing multiple experiments, using the desired volume when required.

4. Ammonium persulfate (APS): 10% (w/v) solution. Weigh 5 g ammonium persulfate. Dissolve in MilliQ water and top up to 50 ml. Freeze aliquots at -20 °C (see Note 4).

5. N,N,N,N’-Tetramethyl-ethylenediamine (TEMED). Supplied as a liquid. Can be stored at room temperature, or at 4 °C to reduce vapor.

6. 1× TBE running buffer: Dilute the 10× TBE stock ten-fold in MilliQ water.

7. 10× EMSA Loading Dye: 0.025% (w/v) Orange G, 20% (v/v) glycerol (See Note 5).

8. Electrophoresis chamber: Use a vertical electrophoresis apparatus with corresponding glass plates, spacers, and well-forming combs. Clamps and/or a gel-casting stand are required for gel preparation. This protocol uses the Mini-PROTEAN Tetra cell with 1.0 mm thick backing plates and combs (Bio-Rad) (see Note 6).

9. Silanization solution: 5% (v/v) dimethyldichlorosilane (≥ 99.5%; Sigma Aldrich catalog no.: 440272) or chlorotrimethylsilane (≥ 99.5%; Sigma Aldrich catalog no.: 386529) in heptane if silanization of glassware is carried out (see Note 7).

10. Power supply: Minimum 100 V, 25 mA capacity.

11. Tapered or round gel-loading pipette tips are useful but not essential.

2.2. Protein and nucleic acid preparation

The exact requirements for reagents will depend on the properties of the proteins and nucleic acids to be studied. Optimal conditions for each EMSA experiment must therefore be determined for every study. Here, we focus on the general requirements of each sample and the ‘standard’ conditions that we have outlined in the methods.

1. Protein: The protein sample should be highly pure (ideally > 95% as assayed by SDS-PAGE) and in a buffer with conditions where the protein is known to be stable (usually around pH 7-8). The protein should either be freshly purified or flash frozen and stored at -80 °C. (See Note 8).

2. TE buffer: 10 mM Tris pH 8.0, 0.5 mM EDTA. For long term storage of nucleic-acids, see Note 9.

3. DEPC-treated water: Treat MilliQ water with 0.1% (v/v) DEPC for at least 2 hours at 37 °C. Autoclave the resulting solution (121 °C, 15 min) to inactivate trace DEPC.

4. DNA or RNA preparation. DNA samples should be highly purified and stored in either MilliQ water or TE buffer. Because of the relatively low cost and commercial availability, we use chemically-synthesized DNA. RNA samples should be highly purified. RNAs can be prepared either by in vitro transcription of a DNA template [12] or by commercial chemical synthesis. In vitro transcribed RNAs should be purified by denaturing polyacrylamide gel electrophoresis and by gel extraction, either by crush and soak [13] or electroelution [14] after excising the correct band (see Note 9).

5. 10× EMSA buffer: 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) pH 7.5, 100 mM sodium chloride (NaCl), 2 mM magnesium acetate (MgAc), 0.1 mM tris(2-carboxyethyl)phosphine (TCEP). The composition of the EMSA buffer will depend on the experiment and nature of the interaction (see Note 8).

2.3. Detection methods

Additional materials depend on the method of detection.

1. Fluorescent stain: SYBR Safe (DNA, ThermoFisher) or SYBR Green II (RNA, ThermoFisher) (see Note 10), visible with a Blue light or UV transilluminator.

2. Fluorescent label: fluorescent labels can be incorporated during chemical synthesis of DNA or RNA. Alternatively, nucleic acids can be fluorescently labeled with a homemade or commercially available kit (see Notes 11–12). An example is the 5′- or 3′-end EndTag labeling kit (Vector Laboratories) used with a conjugable fluorophore (e.g. fluorescein maleimide, Vector Laboratories catalog number SP-1502-12).

3. Radioactive label: γ-³²P dNTP/ γ-³²P rATP for end labelling, α-³²P NTPs for internal labelling. Radioactive reagents should be handled according to local safety procedures. The nucleic acid can be radioactively end-labeled by a relatively inexpensive protocol using T4 polynucleotide kinase [15].

4. Gel dryer (Bio-Rad) or similar platform.

5. Amersham Typhoon FLA Imager (GE) or similar platform with multiple lasers/filters (see Note 13) if using fluorescence or phosphorimaging and quantification.

6. Coomassie Blue stain (or equivalent) if visualization of protein bands is required.

3. Methods

Carry out all procedures at room temperature unless otherwise specified.

3.1. Preparation of polyacrylamide gel

1. Ensure that the glass plates and combs are clean. If not, clean with 70% (v/v) ethanol and allow components to thoroughly dry before continuing. For larger gel casting systems, it may be helpful to silanize the glass surface to allow easier removal of gels from the plates. To do so, wipe the silanization solution with lint-free paper over clean and dry glass plates and leave the solution to dry in a fume hood (see Note 7).

2. Assemble the gel caster according to manufacturer’s specifications (see Notes 6 and 14).

3. For a mini-gel, add 35 μl 10% APS and 3.5 μl TEMED to 7 ml of native polyacrylamide gel mix (see Note 3) in a sterile 15 ml conical bottom centrifuge tube. Mix well by gentle inversion. For more than one gel or larger gels, reagent volumes can be scaled up correspondingly.

4. Slowly pour the resulting mixture into the assembled gel casting apparatus. Immediately insert a comb between the glass plates, taking care not to introduce any air bubbles (see Notes 15 and 16).

5. Leave the gels to polymerize at room temperature for at least two hours and at most overnight (Note 17). Once polymerized, gels can be kept up for up to one week at 4°C covered with paper towels soaked in 1× TBE buffer and sealed in plastic wrap.

3.2. Sample preparation

1. In a typical experiment, the concentration of nucleic acid is kept constant and the concentration of protein is varied (see Notes 18–19). It is important to include a negative control with no protein. A positive control with a protein which is known to bind the nucleic acid can also be included.

2. Prepare 10× protein stocks in a dilution buffer (See Notes 8, 20–22) in 1.5 ml microcentrifuge tubes. This can be a dilution series (see Section 3.5) or a smaller range of concentrations (see Methods, Sections 3.6-3.7).

3. Prepare a master mix of nucleic acid, EMSA buffer and loading dye in a 1.5 ml microcentrifuge tube (See Note 23). For example, for nine 10 μl binding reactions, assemble a master mix for 10 reactions (to account for dead volume when pipetting) as follows: 10 μl 10× RNA stock, 10 μl 10× EMSA buffer, and 10 μl loading dye in 90 μl total volume. This can be scaled accordingly.

4. In 0.2 or 0.5 ml tubes, pipette 1 μl of the 10× protein stock, followed by 9 μl of the master mix. Mix by gently pipetting up and down.

5. Incubate the sample at room temperature for at least 1 hour to allow the interaction to reach equilibrium (see Note 24).

3.3. Polyacrylamide gel electrophoresis

1. Rinse the glass plates containing the completely polymerized polyacrylamide gel with MilliQ water to remove gel debris.

2. If the gel is to be run at 4 °C, prechill 1 × TBE buffer (see Note 25).

3. In a suitable electrophoretic chamber, assemble the gel plates and add 1× TBE buffer. The electrophoretic apparatus should be filled such that the upper chamber is full and the bottom of the glass plate is submerged in the bottom chamber. Reassemble the electrophoretic apparatus if any leaks occur at this stage. Buffer in the bottom chamber can be filled to cover most of the gel to act as a heat sink, minimizing gel heating. Remove the gel comb and any debris from the wells.

4. If desired, the gel can be pre-run at 100 V for at least 30 minutes (see Note 26).

5. Carefully add the samples to the center of the bottom of the wells of the gel (see Note 27). The loaded tip should be near the bottom of the well, and the sample should be slowly expelled, without introducing any air bubbles.

6. Electrophorese the sample at 100 V at the desired temperature. Ensure that the electrophoretic chamber and buffer do not exceed the desired temperature. The negatively charged nucleic acid and any stably bound proteins will move through the gel towards the anode. (see Note 28).

7. When the Orange G dye front reaches the bottom of the gel plate (~60 minutes) (see Note 29), turn off the power supply.

3.4. Gel imaging

1. Disassemble the gel apparatus. Carefully pry the gel plates apart using either a metal spatula or a plastic wedge. The gel should remain on one of the two glass plates.

2. Rinse the gel with deionized water.

3. How the gel is handled at this stage will depend on the detection method to be used (see Note 30). For colorimetric or fluorescent stains, the gel should be stained. When the nucleic acid has been directly labeled by fluorescent dyes or radioactive isotopes, no staining is required. We use fluorescent labels or fluorescent stains due to their reasonably high sensitivity.

4. If using radiolabeled nucleic acids: the resulting gels must be exposed to a phosphorimaging screen. If the sample is sufficiently radioactive and the detection method sufficiently sensitive, the gel can be covered with plastic wrap and imaged directly on the phosphorimaging screen. Alternatively, the gel can be dried prior to imaging. To do so, the gel is sandwiched between a sheet of filter paper and plastic wrap and dried in the gel dryer, with the plastic wrap facing upwards. Drying should be complete to avoid cracking of the gel. This process typically takes 2 hours to complete.

5. If using fluorescence stains: dissolve or dilute the stain in 1× TBE according to manufacturers’ instructions. For SYBR Green II (Invitrogen), for each gel, 2 μl of the stain is diluted 10,000× in 20 ml 1× TBE buffer. Carefully transfer each gel to a separate clean and opaque container containing the stain, and proceed with staining and destaining according to manufacturer’s instructions. For SYBR Green II, the gel is transferred to the diluted stain in a clean plastic container and allowed to stain for 10 minutes on a benchtop orbital shaker. The gel is then washed in 1x TBE for 10 minutes.

6. Carefully transfer the gel to an appropriate imaging stage and proceed with imaging (see Note 31) (Fig. 1B). If fluorescent detection methods are used, an appropriate combination of stimulation lasers and emission filters should be selected. For SYBR Safe and 6-FAM, we use an excitation wavelength of 473 nm and a filter of 510 nm for detection of fluorescence emission.

7. If protein staining is required after nucleic acid imaging, the gel can be carefully removed and stained by a protein-specific stain such as Coomassie Blue according to manufacturers’ instructions. An image of the protein in the gel can be overlaid on the previously obtained image of nucleic acid in an image analysis software. If the protein band and shifted nucleic acid band coincide, then the shifted band likely corresponds to a protein-nucleic acid complex.

3.5. Variation: Semi-quantitative estimation of interaction affinity

By titrating the protein against a fixed and low concentration of nucleic acid, the affinity of the protein-nucleic acid interaction can be estimated. This is carried out using densitometry of the band corresponding to free nucleic acid. The estimate is valid only if the method of detection is proportional to nucleic acid concentration. It must be noted that the observed dissociation constant is only an estimate as the measurement is not carried out under true solution equilibrium conditions (See Note 32). We therefore normally use EMSAs to qualitatively assay the differences between different protein constructs/point mutants and nucleic acid substrates.

1. Prepare a twofold dilution series of protein in sample buffer; the maximum concentration of the protein should ideally be ~100× greater than the expected dissociation constant of the interaction. To avoid pipetting errors, choose a suitable volume (~50 μl). Prepare the highest protein concentration in dilution buffer in double this volume (i.e. 100 μl). Prepare a series of tubes with 50 μl of dilution buffer. Serially dilute the protein by taking 50 μl from the tube with the higher concentration, mixing by pipetting up and down thoroughly, and drawing up 50 μl to dilute in the next tube.

2. Prepare a master mix solution (see Section 3.2). The final concentration of nucleic acid probe should be low enough to avoid ligand depletion (< 10% K_d) (see Note 33) but high enough to have good signal for detection. We typically use at least 1-10 nM fluorescently-labeled probe for a 10 μl reaction (See Note 19).

3. Assemble the reaction, allow it to reach equilibrium (see Section 3.2; see Note 24), perform the EMSA and image the gel.

4. Open the image of the gel in an image analysis software such as ImageJ [16]. Change the contrast of the gel so that the bands corresponding to free nucleic acid and protein-bound nucleic acid are clearly visible (see Note 34).

5. Box each lane and measure the intensity of the band corresponding to free nucleic acid by densitometry in the image analysis software (Fig. 1C).

6. In a graphical analysis software such as Graphpad Prism (Graphpad Software, Inc.), plot the intensity of the band against protein concentration (Fig. 1D). The axis of protein concentration can be changed to a logarithmic scale to aid visual analysis. The concentration of protein at which half of the nucleic acid is bound corresponds to the estimated dissociation constant (see Note 35).

3.6. Variation: Supershift of ternary protein-protein-nucleic acid complexes

Using EMSAs, ternary interactions can also be detected. If a prey protein (P2) interacts with a bait protein (P1)-nucleic acid complex, it will cause a further reduction in electrophoretic mobility, termed a “supershift”. The supershift assay can be used to demonstrate various aspects of the interaction. For example, the interaction of P2 with the P1-nucleic acid complex can be tested with P2 and nucleic acid alone. If P2 alone does not cause a shift in nucleic acid mobility, then it must interact with P1 only, or at a composite P1-nucleic acid binding site. P2 could alternatively disrupt the P1-nucleic acid interaction (see Note 36). Moreover, if P2 is an antibody against P1, the identity of the protein P1 can be verified. Finally, the supershift assay can also be used to assess the stoichiometry of a complex. For example, the ability of a protein to multimerize on a nucleic acid substrate can be tested by varying the length of the nucleic acid or the protein concentration.

1. Carry out a titration of P1 against the nucleic acid, as in section 3.5 above. Select a concentration of P1 where the free nucleic acid band has completely disappeared.

2. Keeping the concentration of P1 constant, titrate an increasing concentration of the putative binding protein P2 against the protein-nucleic acid complex. It is important to keep one sample with no protein as the negative control. Alternatively, if the stoichiometry of only one protein against the nucleic acid substrate is tested, titrate the protein directly against the nucleic acid. Multimerization becomes visible at higher protein concentrations (Fig. 1B).

3. Carry out the EMSA and image the gel as described in sections 3.1–3.4.

3.7. Variation: Dual-color competition EMSA

EMSAs can be carried out under competitive conditions with more than one type of nucleic acid. The additional nucleic acid (N2) can be unlabeled, or labeled differently from N1 (“two-color”), and can be used to assess the nucleic acid binding specificity of the protein (see Note 37). In this protocol, we detail a method for a dual-color RNA EMSA [17].

1. This method requires the nucleic acids to be differentially labelled (see Note 37). We routinely synthesize one substrate with a 5′-FAM ‘blue’ label and the other with a 5′-Alexa 647 ‘red’ label.

2. The protein is titrated against fixed concentrations of two nucleic acids (N1 and N2) (see Note 38). Perform a series of protein dilutions to sample a particular range of concentrations. In the experiment shown in Fig. 2, a range from 50 nM to 2 μM was used.

3. Prepare a master mix solution of two different RNA concentrations, for example 10 nM and 100 nM each RNA (20 nM and 200 nM total RNA) (see Note 39).

4. Assemble 10 μl binding reactions with the protein dilutions and master mix (see Section 3.2). Incubate the mixture for at least one hour to reach equilibrium.

5. Perform the EMSA as before (see Section 3.3).

6. Scan the gel (see Section 3.4) using the two non-overlapping excitation wavelengths and emission filters (Typhoon FLA Scanner, GE). Save each channel as a separate image file.

7. Using Adobe Photoshop or another suitable image-processing software, convert each image to 8-bit grayscale and set false color either using the duotone mode or the channel mixer in RGB. Ensure the resulting image is an RGB image and overlay as a separate, partially transparent layer on the other false color image (Fig. 2).

Figure 2. Dual color competition EMSA.

EMSAs were performed with two differentially labeled substrates (PRE: AACUGUUCCUGUAAAUACGCCAG[A]₃₀ or AU: AAUCAUCCUUAUUUAUUACCAUU[A]₃₀) to examine substrate specificity. SpPuf3 PUM domain was incubated with 5′ 6-FAM Pumilio response element (PRE) substrate and 5′ Alexa647 AU substrate at the indicated protein concentrations [17]. (A) EMSA performed with 100 nM each substrate. Scans at different excitation and emission wavelengths are shown on the left with overlaid false color image on the right. (B) The same EMSA performed in (A) but with 10 nM each substrate.

4. Notes

1. General-use laboratory benches (such as those used for plasmid and protein purifications) should be cleaned using 70% (v/v) ethanol followed by an RNase inactivating solution such as RNaseZAP™ (Invitrogen) to reduce the risk of RNase or DNase contamination. It is also possible to bake glassware and tubes to remove RNases but this is not generally necessary.

2. Depending on the required resolution and size of macromolecules, the final acrylamide concentration should be adjusted accordingly. We use 8% polyacrylamide for RNAs of ~10-50 bases. Larger proteins and longer nucleic acids should be resolved on a lower percentage polyacrylamide gel. Smaller substrates may resolve better on higher percentage gels.

3. Unpolymerized acrylamide is a potent neurotoxin and should always be handled with caution. To minimize the risk of inhalation, we use a premade 40% acrylamide:bis-acrylamide (19:1 ratio) solution as a working stock and avoid powdered acrylamide. Gas-stabilized ultrapure acrylamide:bis-acrylamide solution (such as National Diagnostics AccuGel) is readily available from commercial sources. This also minimizes the risk of degradation products, such as acrylic acid, interfering with electrophoresis.

4. Ammonium persulfate is unstable but can be stored frozen at -20 °C for six months. Alternatively, a small volume of APS can be made fresh and kept at 4 °C for up to a week.

5. A colored loading dye allows sample visualization during pipetting and gel loading, and increases the density of the sample, causing it to sink to bottom of the wells. We routinely use Orange G since Bromophenol Blue can migrate at the same position as free nucleic acid in the gel, interfering with visualization. If the dyes non-specifically bind proteins or nucleic acids, samples can be run with a loading buffer containing only glycerol and without a dye. If glycerol is incompatible with the sample, Ficoll 400 (~1-2% w/v final concentration) can be used as an alternative. In the absence of loading dye, a lane can be kept free for the addition of a dye to monitor migration.

6. The dimensions of gels cast using this system are 8.3 × 7.3 cm. For greater resolving power, larger gels can be used. Many other suitable apparatus options exist, including those that accommodate precast native PAGE gels.

7. Preparation of the silanization solution and application of the solution to glassware should be carried out under a fume hood as fumes from both the silanizing compound and the organic solvent are toxic.

8. The choice of buffer for the interaction analysis is an important consideration. Parameters to consider include: salt concentration (ionic strength), pH (accounting for buffer pKa), additional metal ions, and additives. Protein-nucleic acid interactions can be dependent on macromolecular charge, which in turn is sensitive to salt concentration and pH. We usually use solutions which approximate physiological salt concentrations and pH. Additional metal ions, such as divalent cations or potassium (for example in the case of G-quadruplex formation [18]), may be important for mediating protein-nucleic acid interactions. In some cases, EDTA in the gel and running buffer can disrupt interactions – if this is the case, EDTA can be omitted and/or additional magnesium can be included. Additives such as detergents or reducing agents may be important to solubilize macromolecules or maintain them in a near-physiological state. If proteins tend to adhere to surfaces, a low concentration of surfactant can also be added. Finally, a polyanionic additive such as tRNA or heparin can be used (start with 0.01 mg/ml) to reduce non-specific binding.

9. RNA is less stable than DNA and should not be repeatedly freeze thawed. To ensure long term stability we store our RNA stocks at -80°C aliquoted in TE buffer.

10. Where possible, non-intercalating fluorescent dyes should be used to label nucleic acids. We use SYBR Safe stain for DNA as studies have demonstrated that SYBR Safe is less mutagenic than ethidium bromide.

11. The site of the fluorescent label can be 5′, 3′ (commercial or homemade), or internal (commercial only). The choice of labeling site will depend on the characteristics of the nucleic acid; this should be chosen to minimize interference with RNA structure or protein binding.

12. If labeling is carried out after chemical synthesis or in vitro transcription of the nucleic acid, the efficiency of labeling must be assessed. This can be determined by comparing the molarity of the fluorescent label (by absorbance of the fluorophore) to the molarity of the nucleic acid (by absorbance at 260 nm). This is carried out to ensure that there is sufficient fluorescently labeled nucleic acid for later detection.

13. Typhoon FLA Imagers (GE) enable the detection of fluorescently stained, fluorescently labeled, or radioactively labeled (phosphor imaging screen) nucleic acids at high spatial resolution. The compatibility of the Typhoon lasers/emission filters and the selected fluorophore should be confirmed prior to beginning the experiment.

14. Once the gel casting apparatus has been assembled, it can be checked for leakage. Pour 7 ml of isopropanol between the glass plates and monitor the meniscus level; if the meniscus falls over time, there is a leak and the gel caster should be reassembled. Pour away the isopropanol if there are no leakages. Ensure that the plates are dry before continuing with gel polymerization.

15. The choice of comb depends on spacer width, number of samples, and sample volume. We typically use Bio-Rad Mini-PROTEAN glass plates with a 1 mm spacer and combs with either 10 or 15 wells. These correspond to maximum sample volumes of roughly 26 μl and 44 μl respectively.

16. Air bubbles introduce undesirable smears in the gel and should be avoided. In our experience, pouring the gel mixture to the top of the apparatus so that there is spill over and then inserting the comb at an angle reduces the chance of bubbles.

17. In our experience, although gels will appear to polymerize within ~10 minutes, gels run more uniformly and with sharper bands if left for at least an hour, presumably since the crosslinked matrix is more homogenous.

18. Reagents such as protein and nucleic acids are normally added from stocks at 10× concentration to minimize the contribution of buffer carryover to the EMSA reaction. If greater volumes of reagent are added, the 10× EMSA buffer can be adjusted accordingly to account for buffer carryover.

19. The nucleic acid concentration should be optimized depending on detection of the nucleic acid and the experiment type. For fluorescently labeled nucleic acids and detection by a laser scanner such as the Typhoon FLA scanner (GE), approximately 0.01 pmol fluorophore suffices for detection. Furthermore, the amount of nucleic acid should not exceed the maximum detection limit (for example, pixel saturation) on the detector. Many nucleic acid:protein interactions have K_ds less than 10 nM. In this scenario, fluorescently labeled RNAs are not optimal substrates for EMSAs because of ligand depletion (see Note 33). Instead, sub-picomolar radiolabeled nucleic acid substrates are preferred.

20. Protein concentration should be accurately determined, for example by measuring the absorbance at 280 nm (A₂₈₀) and calculating the protein concentration using a theoretical extinction coefficient. Measurements should be made under denaturing conditions and compared with the native protein to see if there is a substantial difference in the calculated concentration. If possible, a UV spectrum of the sample should be taken. Absorbance in the region beyond which proteins normally absorb (>320 nm) indicates the presence of light scattering due to aggregation or particulates, which would lead to overestimation of the absorbance at 280 nm due to unaggregated protein and hence its concentration. Samples with significant absorbance at 320-340 nm region should be centrifuged to remove any aggregates. If the sample does not contain any tryptophan residues, which are the main source of protein absorbance at 280 nm, consider using a colorimetric assay such as the Bradford method.

21. It is preferable to have a protein stock at a high concentration (> 100 μM) as long as the protein does not aggregate. This is because a greater concentration range can be sampled and the A₂₈₀ measurement is more accurate (see Note 20).

22. Protein dilution buffer composition is sample dependent (see Note 8). To minimize carryover of buffer components into the binding reaction, our default dilution buffer contains 20 mM HEPES pH 7.5, 100 mM NaCl, and 0.5 mM TCEP.

23. To minimize the adsorption of protein to plastic tubes, we use low-binding plasticware such as protein Lo-Bind tubes (Eppendorf). This also ensures that the concentration of the protein is consistent in the assays.

24. The time required to reach equilibrium will depend on the nature of the protein-nucleic acid interaction and the reaction conditions. Failing to attain equilibrium may lead to misleading results and failure to reproduce observations. At high protein concentrations, the observed rate constant is dominated by the on-rate (k_on) [19]. In practice, k_on is often 10⁵-10⁶ M^-1s^-1. At low protein concentrations, however, the observed rate constant is instead dominated by the off-rate (k_off) [19]. For a high affinity interaction with a K_d of 1-10 nM, k_off can be in the range of 0.001 to 0.0001 s^-1 and the complex has a half-life (t_1/2) of ~10 minutes to >100 minutes. Since the time taken to reach close to equilibrium is 5 × t_1/2, it can thus take hours to reach equilibrium with low protein concentrations. For an interaction with a binding affinity of 100 nM, the complex has a t_1/2 of 1-10 minutes and equilibrium should be obtained in 5-50 minutes. It is thus safe to assume that for interactions with affinities in this region, equilibrium will be reached after a 60-minute incubation. Also see Note 32.

25. Running the gel at low temperatures can be beneficial for two reasons. Firstly, heat dissipates more evenly from the gel into the surrounding cold buffer, ameliorating localized heating which causes uneven bands. Secondly, since the dissociation rate of the interaction is a function of temperature, running the gel at ~4 °C will increase the t_1/2 for the interaction and potentially lead to a better estimate of the K_d (see Note 24, Note 32).

26. We do not observe major differences between pre-run PAGE gels and loading the samples directly. However, pre-running the gel can remove excess ammonium and persulfate ions and other impurities, such as acrylic acid, that could interfere with complex formation and gel running.

27. We prefer to use tapered “gel-loading” tips to ensure that the sample is evenly distributed along the bottom of the well. Small sample volumes are advantageous as they result in sharper bands at the end of electrophoresis, but the bottom of the well must be evenly covered. For typical gels, this is approximately 5 μl.

28. While the nucleic acid alone will likely move through the polyacrylamide matrix, the mobility of protein (or protein-nucleic acid complex) through the gel will primarily depend on two factors. Firstly, the molecular weight (and shape) of the protein affects how the complex migrates through the gel. The larger the protein, the slower it will move through the polyacrylamide matrix. Secondly, because the assay is carried out near physiological pH, the isoelectric point (pI) and thus net charge of the protein will also affect its mobility. Only proteins which have a net negative charge under the experimental conditions will migrate through the gel on their own. If the protein is stably bound to nucleic acid, it is more likely to migrate through the gel due to the negative charge of nucleic acids. Since many nucleic acid binding proteins have a net positive charge at physiological pH, they are less likely to run far into gel on their own.

29. The mobility of the Orange G dye front will depend on the percentage of the polyacrylamide gel. In our experience, the Orange G dye front migrates similarly to a ten-nucleotide single-stranded nucleic acid in an 8% polyacrylamide gel. Orange G is often preferred as other commonly used dyes may co-migrate with the nucleic acid, and lead to shadows in imaging.

30. Colorimetric stains such as methylene blue or crystal violet require no special equipment, but have low sensitivity (and thus more nucleic acid and protein will be required for the assay) and require a destaining step. Fluorescent stains such as ethidium bromide or SYBR Safe (Invitrogen) are often mutagenic and require UV excitation, but have greater sensitivity and so are often preferred if the nucleic acid is not directly labeled.

    The alternative detection method is to directly label the nucleic acid. Nucleic acids can be chemically synthesized with a fluorescent label such as 6-FAM or Alexa dyes, or unlabeled nucleic acids can be labeled with in-house protocols or commercially available kits. Fluorescent labels are sensitive and their fluorescence is directly proportional to molarity, allowing semi-quantitative analysis of interactions. Alternatively, nucleic acids can be directly labeled with radioisotopes such as ³²P. Radioactive labeling is advantageous in that it does not introduce artificial structures that influence binding and is the most sensitive. However, the use of radioactive labeling requires training and precautions for radioactive safety.

31. The fragility of the gel will depend on the percentage of acrylamide used. The lower the acrylamide percentage, the more fragile the gel. To minimize the chance of gel tearing, the tools and glass plates used to manipulate the gels should be kept wet by deionized water at all times. If the gel is too fragile, it can also be stained and directly imaged on the glass plate with a suitable holder, but the background noise from the glass plate itself will likely be higher, potentially hindering further analysis.

32. Even if equilibrium has been attained in the binding reaction, this will be perturbed when applied to an electric field (i.e. during electrophoresis). In our hands, EMSAs often lead to an underestimation of the true affinity, since complexes can dissociate during electrophoresis. This will depend on the particular complex under study since there are examples of EMSA experiments that agree well with both equilibrium binding experiments and kinetic measurements. Thus, a true equilibrium binding experiment or kinetic measurements should be used in tandem with EMSA analysis.

33. The estimation of K_d requires the protein concentration added to the reaction (P_tot) to be approximately equal to the free protein concentration after equilibrium is reached (P_free). If the nucleic acid concentration is close to the K_d of the interaction, depletion of the protein will underestimate the resulting affinity. For example, if the K_d is 100 nM and the same concentration of nucleic acid probe is added to the reaction, any protein added to the reaction at and above this concentration will begin to associate, deplete the ‘free’ protein concentration, and invalidate the assumption required for K_d estimation [19].

34. Image contrast and brightness adjustments must only be made linearly and applied to an entire image or plate. Non-linear adjustments are strongly discouraged and are unsuitable for semi-quantitative analysis of protein-nucleic acid interactions, as the measured intensity is no longer proportional to the molarity of nucleic acid.

35. There are multiple ways of fitting the data. If the data are not plotted logarithmically, they can be fitted with a single site binding equation (a form of the Langmuir isotherm) or a quadratic binding function. If plotted logarithmically, the data can also be fitted with a four-parameter logistic function. All of these equations will contain terms that correspond to the dissociation constant, where binding is half maximal.

36. To test whether P2, a protein known to bind to the P1-N1 protein-nucleic acid complex, competes with P1 binding to nucleic acid N1, carry out a titration of P1 against the nucleic acid as in section 3.5 above. Select a concentration of P1 where the free nucleic acid band has completely disappeared. Titrate P2 against fixed concentrations of P1 and N1. A lack of supershift indicates that P2 cannot bind simultaneously to a P1-N1 complex. If the band corresponding to free N1 appears, then P2 interaction with P1 precludes P1 binding to N1. If a small shift in electrophoretic mobility occurs, then it may indicate that the P2-N1 interaction is mutually exclusive with the P1-N1 interaction.

37. Because two different nucleic acids are used in the assay, they must be differentially labeled. For example, the two nucleic acids can be labeled with different fluorophores with non-overlapping excitation and emission spectra. Theoretically, this assay could be performed with 3 differentially labeled substrates: Alexa Fluor 405, Alexa Fluor 568, and Alexa Fluor 790. Alternatively, one nucleic acid can be labeled with a fluorophore or radioactive isotope (“hot”), and the other nucleic acid kept unlabeled (“cold”). This latter protocol can be used if there is no way of scanning each channel separately.

38. Alternatively, a fixed concentration of P1 and labeled N1 can be used, and the concentration of nucleic acid N2 can be titrated. As the concentration of N2 is increased, P1 may be titrated away from the P1-N1 complex. Labeled N1 can thus be detected as a free nucleic acid band.

39. The nucleic acid concentration used will depend on the particular experiment. We often perform these assays with relatively high nucleic acid concentrations to mirror that used in activity assays. In Figure 2, the two different concentrations illustrate how the differences in specific binding depend on both probe and protein concentration.