Generation of feeder-independent transgene-free iPSC lines from a young-onset Parkinson’s disease (YOPD) patient with a homozygous PLA2G6: c.2222G>A (p. Arg741Gln) mutation (NCBSi003-A) and unaffected heterozygous parent (NCBSi004-A)

Abstract

Phospholipase A2 group 6 (PLA2G6, iPLA2β or PARK14) gene encodes a calcium-independent group 6 phospholipase A2 enzyme and is associated with young-onset autosomal recessive Parkinson’s disease (PD). We generated human induced pluripotent stem cell (iPSC) lines from a patient with young-onset PD carrying a homozygous PLA2G6: c.2222G> A (p. Arg741Gln) mutation (NCBSi003-A) and unaffected heterozygous parent (NCBSi004-A). These iPSC lines will be used for investigating the key molecular signatures of young-onset PD (YOPD), and to understand the predictive phenotypes of the disease.

1. Resource Table

Unique stem cell lines identifier	NCBSi003-A https://hpscreg.eu/cell-line/NCBSi003-ANCBSi004-A
	https://hpscreg.eu/cell-line/NCBSi004-A
Alternative name(s) of stem cell lines	Park14-R741Q-2022 (NCBSi003-A)Park14-control-2022 (NCBSi004-A)
Institution	National Centre for Biological Sciences, Bengaluru, India
Contact information of distributor	Renjitha Gopurappilly renjithap@ncbs.res.in
Type of cell lines	Induced pluripotent stem cell (iPSC)
Origin	Human Park14-R741Q-2022 (NCBSi003-A) Age: 21 Sex: Male Ethnicity: Asian Indian Park14-R741Q-2022 (NCBSi004-A) Age: 40 Sex: Female Ethnicity: Asian Indian
Cell Source	Total peripheral blood mononuclear cells (PBMCs)
Clonality	Clonal
Method of reprogramming	Episomal
Genetic Modification	Yes
Type of Genetic Modification	Hereditary
Evidence of the reprogramming transgene loss	RT-PCR (absence of transgene transcripts)
Associated disease	Parkinson’s disease, PARK 14 (NCBSi003-A)
Gene/locus	NM_003560.4(PLA2G6):c.2222G>A (p. Arg741Gln)
Date archived/stock date	29th December 2022
Cell line repository/bank	NCBSi003-A https://hpscreg.eu/cell-line/NCBSi003-ANCBSi004-A https://hpscreg.eu/cell-line/NCBSi004-A
Ethical approval	Institutional Stem Cell Research Committee- 01/ICSCR/IX-06.01.2020-GH2 Institutional Ethics Committee- NCBS/IEC-10/001 Institutional Biosafety Committee-TFR: NCBS:27 IBSC/2019-GH

2. Resource utility

Among the Parkinson’s disease (PD)-specific induced pluripotent stem cell (iPSC) lines available till date, very few are focused on loci related to young-onset PD and PLA2G6 (PARK 14) in particular. This integration-free iPSC line will be a useful tool for researchers to understand the signalling pathways that are affected in PLA2G6-linked PD in a patient specific manner.

3. Resource details

Autosomal recessive PD (ARPD) results from mutations in different loci that leads to a wide range of other complex symptoms in addition to the typical motor disabilities. Though a rarer form, PLA2G6-related PD include mental disorders, cognitive decline, dystonia, and motor symptoms such as resting tremor, muscle rigidity, and bradykinesia with a high disability and morbidity rate (Oliveira et al., 2021). The recent advancements using cell-based and animal models have uncovered the role of PLA2G6 and calcium dyshomeostasis in PD (Gopurappilly, 2021). iPSC-derived dopamine neurons, and developmentally upstream phenotypes pose as disease-relevant cell types for prediction analyses and design of intervention therapies. To address this, we derived an iPSC line from a 21 yr old Asian Indian male born out of consanguineous parentage with catatonia in the form of reduced speech output, reduced oral intake, immobility and rigidity (Supplemental data). On examination, he exhibited Parkinsonian symptoms including autonomic instability with a homozygous PLA2G6: c.2222G> A (p.Arg741Gln) mutation. Familial control line was derived from the unaffected parent harbouring the mutation in a heterozygous condition (Table 1).

Table 1. Characterization and validation.

Classification	Test	Result	Data
Morphology	Photography-Bright field	Normal	Fig. 1 panel A
Phenotype	Qualitative analysis: Immunocytochemistry	Pluripotency markers: OCT4, SOX2, TRA-1-60, expressed	Fig. 1 panel D
	Quantitative analysis: RT-qPCR	Transcripts for OCT4, SOX2, NANOG, DPPA5 (PGP1 iPSCs as internal control)	Fig. 1 panel F
Genotype	Karyotype (G- banding) and resolution	NCBSi003-A-46 XY, Band resolution 450 NCBSi004-A-46 XX, Band resolution 450	Fig. 1 panel H
Identity	STR analysis	10 loci tested, matched	Supplemental data
Absence of transgenes	Endpoint PCR	OriP and EBNA tested (hSK plasmid as positive control)	Fig. 1 panel I
Mutation analysis	Sequencing	NCBSi003-A-Homozygous mutation, PLA2G6: c.2222G>A (p. Arg741Gln) NCBSi004-A-Heterozygous mutation, PLA2G6: c.2222G>A (p. Arg741Gln)	Fig. 1 panel C
Microbiology and virology	Mycoplasma	Luminescence-Negative	Supplemental data
Differentiation potential	Embryoid body formation	Expression of markers in embryoid bodies by immunostaining: Tuj1 (ectoderm), Vimentin (mesoderm) and Foxa2 (endoderm) Transcript levels of ectodermal (SOX1, NEUROD1), mesodermal (NODAL, TBX6) and endodermal (FOXA2, GATA4) genes assesses with undifferentiated iPSC as internal control	Fig. 1 panel B
			Fig. 1 panel E
			Fig. 1 panel G
Donor screening (OPTIONAL)	HIV 1 + 2 Hepatitis B, Hepatitis C	Negative	Not shown but available with author
Genotype additional info (OPTIONAL)	N/A	N/A	N/A

To generate patient-specific and parental iPSC lines, PBMCs were transfected with episomal plasmids encoding human OCT4, SOX2, CMYC, and KLF4. Primary colonies were observed after 2–3 weeks on matrigel-coated dishes in ReproTeSR™ medium (Fig. 1A). The colonies were clonally expanded in StemFlex™ medium and stored. Disease-associated mutation was confirmed by Sanger sequencing (Fig. 1C). Pluripotency markers (Fig. 1D and 1F) and trilineage markers via Embryoid Body (EB) formation (Fig. 1B, 1E and 1G) were confirmed at both protein and gene levels. PGP1 iPSC lines were used as a positive control for pluripotency genes (Church, 2005). Elimination of transgene expression was confirmed by reverse transcription- PCR in both cell lines at passage 10 (Fig.1I). G-banding analysis with a band resolution of 450 showed normal karyotypes at passage 10 (Fig. 1H). Short Tandem Repeat (STR) analysis confirmed that the cell lines had a STR profile identical to that of primary PBMCs (Supplemental data). The cell lines were also free of mycoplasma contamination using a mycoplasma detection kit (Supplemental data). Scale bars represent 50 µm.

Fig. 1. Characterization of the PD and control iPSCs.

A) Bright field images of the colonies on matrigel. B) Embryoid bodies (EBs). C) Sanger sequencing electro-pherograms to confirm the mutations. D) Immunostaining of the pluripotent markers Oct4, Sox2 and Tra-1-60 in iPSCs. E) Trilineage markers (Tuj1, Foxa2 and Vim) via immunostaining of spontaneously differentiated EBs. F) Transcript levels of pluripotent markers compared to PGP1 iPSC line. G) Fold change of ecto-, endo- and mesodermal markers in EBs over undifferentiated iPSCs. H) Karyotpe analysis at P-10. I) Semi-quantitative PCR amplicons run on a gel to show absence of reprogramming plasmid elements EBNA and OriP, hSK used as positive control. Scale bar 50 µm.

4. Materials and methods

4.1. Isolation and reprogramming of peripheral blood mononuclear cells (PBMCs) to iPSC

Blood was collected from the patient and the parent after approval from the institutional ethics committee. Peripheral blood mononuclear cells (PBMCs) were isolated from blood using Lymphoprep (Stem Cell Technologies, 07801), as per manufacturer’s protocol, frozen in Cryo-Stor®CS10 (Stem Cell Technologies, 07930) at 4 × 10⁶ cells/vial and stored in liquid nitrogen till further use.

PBMCs were thawed and seeded onto low-adherent dishes in medium containing StemSpan™ SFEM II expansion medium (Stem Cell Technologies, 02692). After expanding for 9 days, 0.2 × 10⁶ PMBCs were electroporated with 1ug each of plasmids encoding pCXLE-hOCT3/ 4-shp53-F, pCXLE-hSK and pCXLE-hUL (Addgene # 27077, 27,078 and 27080) (Okita et al., 2011) using the Neon Transfection System (Invitrogen) with the standardized parameters – 1300 V, 30 ms width, 1 pulse. Cells were seeded on 1 % Matrigel (Corning, 354277) coated 35 mm TC dish and maintained in ReproTeSR™ medium (Stem Cell Technologies, 05926) media for 18 days and gradually changed to StemFlex™ (Thermo Fisher, A3349401) until iPSC colony formation was observed as described earlier (Konala et al., 2020; Singh et al., 2021). Colonies were expanded manually for the 5 passages, followed by enzymatic dissociation using StemPro™ Accutase™ (Thermo Fisher, A1110501). RevitaCell™ supplement (Thermo Fisher, A2644501) was added on the day of thawing. Cells were grown in normoxic conditions in a 37 °C humidified incubator with 5 % CO₂. The cultures were routinely tested for mycoplasma using the MycoAlert™ kit (Lonza, LT07-118) as per the manufacturer’s instructions (See Table 1).

4.2. EB formation

iPSC colonies were grown in suspension in 20 % KOSR media for 6 days and transferred to Matrigel coated coverslips for an additional 4 days for immunocytochemical probing of the germ layer markers.

4.3. Sanger sequencing

Genomic DNA from iPSCs was isolated and amplified using Pla2g6-exon 16 specific primers (Table 2). The purified PCR products were sequenced bidirectionally to confirm the homozygous and heterozygous mutations.

Table 2. Reagents details.

Antibodies used for immunocytochemistry
	Antibody	Dilution	Company Cat #	RRID
Pluripotency Markers	Mouse anti- OCT-4 [POU5F1] Antibody, clone 7F9.2	1:200	Sigma-Aldrich Cat# MAB4419	AB_1977399
	Rabbit polyclonal to SOX2	1:250	Abcam Cat# ab97959	AB_2341193
	Mouse monoclonal [TRA-1-60]	1:100	Abcam Cat#ab16288	AB_778563
Differentiation Markers	Mouse anti- pIII Tubulin mAb (Tuj1)	1:2000	Promega Cat# G7121	AB_430874
	Mouse monoclonal [RV202] to Vimentin	1:500	Abcam Cat# ab8978	AB_306907
	Rabbit monoclonal [EPR4466] to FOXA2	1:250	Abcam Cat# ab108422	AB_11157157
Secondary antibodies	Goat antiMouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 568	1:400	ThermoFisher Scientific Cat# A-11011	AB_143157
	Goat antiMouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 568	1:400	ThermoFisher Scientific Cat# A-11077	AB_141874
Primers
	Target	Size of band	Forward/Reverse	primer (5’-3’)
Pluripotency markers	OCT4	136 bp	AGGGCCCCATTTTGGTACC
			TCAGTTTGAATGCATGGGAGAGC
	SOX2	154 bp	ACCAGCTCGCAGACCTACAT
			TGGAGTGGGAGGAAGAGGTA
	NANOG	158 bp	CAAAGGCAAACAACCCACTT
			TCTGCTGGAGGCTGAGGTAT
	DPPA5	328 bp	TCTCCCGGCACGTAGACATA
			GCCTAGTTCGAGGGCATTCA
Differentiation markers	SOX1	76 bp	GCGGAGCTCGTCGCATT
			GCGGTAACAACTACAAAAAACTTG
	NEUROD1	166 bp	GCACGCCAGTTTCACCATTT
			CCCCTGTTTCTTCCAAAGGC
	FOXA2	67 bp	TTCAGGCCCGGCTAACTCT
			AGTCTCGACCCCCACTTGCT
	GATA4	187 bp	TCCAAACCAGAAAACGGAAG
			CTGTGCCCGTAGTGAGATGA
	NODAL	268 bp	AGACATCATCCGCAGCCTACA
			GACCTGGGACAAAGTGACAGTGAA
	TBX6	150 bp	CCCGAGACCACATTCATC
			CCGCAGTTTCCTCTTCAC
Housekeeping	GAPDH	154 bp	TCACCAGGGCTGCTTTTAACTC
			ATGACAAGCTTCCCGTTCTCAG
	BETA ACTIN	86 bp	TCAAGATCATTGCTCCTCCTGAG
			ACATCGCTGGAAGGTGGACA
Sequencing	Pla2g6_ex16	272 bp	CTCAGCCTGACTCGAAAGAGCCTG
			TGGGAGGGGAAGGTCGGTGAGTC
Episomal plasmid	OriP	544 bp	TTCCACGAGGGTAGTGAACC
			TCGGGGGTGTTAGAGACAAC
	EBNA	656 bp	ATCGTCAAAGCTGCACACAG
			CCCAGGAGTCCCAGTAGTCA

4.4. Immunocytochemistry

iPSC colonies or attached EBs were fixed in 4 % paraformaldehyde for 15 min, permeabilized with 0.1 % TritonX-100 for 10 min, and blocked with 5 % normal goat serum for 2hrs at RT. Primary antibodies (as detailed in Table 2) diluted in 2 % goat serum were incubated at 4 °C overnight. Alexa Fluor-conjugated secondary antibodies were incubated for 1hr at RT, nucleus counterstained with DAPI and images acquired using an Olympus laser scanning confocal microscope FV3000 with FV31S-SW 2.1 viewer software.

4.5. Real-time quantitative PCR and semi-quantitative PCR

Real-time quantitative PCRs (qPCRs) were performed with the KAPA SYBR FAST qPCR kit (Sigma-Aldrich Cat# KK4601) on an ABI 7500 Fast machine (Applied Biosystems). The fold change of gene expression levels in experimental conditions relative to control was normalized according to the 2^−ΔΔCt method. PGP1 iPSC was used as a positive control in pluripotency marker analysis. The respective undifferentiated iPSC was used to detect the germ layer transcripts in trilineage marker analysis. Beta actin was used as a housekeeping gene. For semi-quantitative PCRs for vector clearance, amplicons were run on a 1.5 % gel for analysis with the plasmid hSK as positive control.

4.6. Karyotyping and Short Tandem Repeat (STR) genotyping

Karyotyping by GTG-banding analysis was done by Anand Diagnostic Laboratory, Bengaluru as per manufacturer’s protocol. 10 meta-phases were screened for the analysis with a band resolution of 450. STR genotyping was performed by theraCUES Innovations, Bengaluru using GenePrint 10 system for NCBSi004-A and by Medgenome Labs Ltd, Bengaluru using the SeqStudio Genetic Analyzer for NCBSi003-A.

Data availability

No data was used for the research described in the article.