Skip to main content
NCBI home page
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2023 May 1.
Published in final edited form as: Trends Cancer. 2022 May 12;8(8):632–641. doi: 10.1016/j.trecan.2022.03.005

Emerging mechanisms of telomerase reactivation in cancer

Shalu Sharma 1,2,3,5, Shantanu Chowdhury 1,2,3,4,*
PMCID: PMC7614490  EMSID: EMS174669  PMID: 35568649

Abstract

Mutations in the promoter of human telomerase reverse transcriptase (hTERT) result in hyperactivation of hTERT. Notably, all mutations are G>A transitions, frequently found in a wide range of cancer types, and causally associated with cancer progression. Initially, the mutations were understood to reactivate hTERT by generating novel E26 transformation-specific (ETS) binding sites. Recent work reveals the role of DNA secondary structure G-quadruplexes, telomere binding factor(s), and chromatin looping in hTERT regulation. Here, we discuss these emerging findings in relation to the clinically significant promoter mutations to provide a broader understanding of the context-dependent outcomes that result in hTERT activation in normal and pathogenic conditions.

Telomerase in cancer

Healthy human cells determine cellular proliferation and lifespan in a lineage-dependent manner. This process is achieved through a delicately balanced and tightly coordinated regulation of cellular proliferation and aging. While premature aging can result in pathologies such as progeria (see Glossary), Alzheimer disease, and alopecia, uncontrolled cell proliferation can cause cancer [1,2]. Consequently, decades of scientific exploration continue to investigate the underlying mechanisms of proliferation.

Glossary.

Alopecia

alopecia areata is an autoimmune disorder that causes premature balding (often in clumps the size and shape of a quarter). The disease could be hereditary and is linked with aging.

Alzheimer disease

a progressive neurologic disorder that causes brain atrophy (shrinking) due to cell death. It is caused by a combination of age-associated changes in the brain, along with genetic, environmental, and lifestyle factors.

BRAFV600E

is a point mutation (substitution of a thymine with an adenine at position 1799 on exon 15) that results in the change of amino acid 600 from valine (V) to glutamate (E). The BRAFV600E mutation causes constitutive activation of the RAS-RAF-MEK-ERK signaling pathway, independent of extracellular signals.

Chromatin looping

a chromatin loop occurs when stretches of genomic sequence that lie far away on the same chromosome (configured in cis) or different chromosomes (trans) fold to come to a close physical proximity. Looping interactions are mediated by specific proteins (e.g., CTCF and cohesins) and could be helpful in regulatory functions across the genome.

DNA methylation

epigenetic modification of cytosine nucleotides by addition of a methyl (CH3) group to the fifth carbon atom of the cytosine ring, converting it to 5-methylcytosine. This reaction is carried out by DNA methyltransferases.

ETS binding factors

ETS [E26 transformation–specific or E26 (erythroblast transformation–specific] proteins are a family of transcription factors. ETS family members are implicated in tissue development as well as in cancer progression.

GABP

GA-binding protein (GABP) is an ETS transcription factor. GABPalpha includes an ETS DNA-binding domain (DBD), while a distinct protein, GABPbeta, contains ankyrin repeats and the transcriptional activation domain (TAD).

Mediator complex 12 (MED12

a member of a group of about 25 proteins that work together to regulate gene activity. The mediator complex physically links transcription factors, which are proteins that influence whether genes are turned on or off, with RNA polymerase II.

Progeria

also known as Hutchinson– Gilford syndrome, progeria is a rare genetic condition that results in premature aging in children. Mutation in LMNA is known to cause progeria.

Telomere repeat binding factor 2 (TRF2)

a homolog of TRF1, TRF2 is an essential component of shelterin, a telomere-binding protein complex. TRF2 induces formation of a special structure of telomeric DNA, counteracts activation of the double-strand break response pathway and ataxia telangiectasia mutated kinase pathway at telomeres.

TERF2 interacting protein (TERF2 IP)/repressor activator protein 1 (RAP1)

another member of the telomere capping protein complex known as shelterin. RAP1/TERF1IP binds telomere junction sites through its association with TRF2.

T-INT1

a DNA region on chromosome 5 (chr5:1,556,087–1,558,758), it falls upstream within the regulatory region of the hTERT gene. This region carries a binding site of GABPA in cancers with as well as without hTERT promoter mutations.

Among these mechanisms is the role of telomeres. Telomeres are G-rich repetitive sequences at the ends of chromosomes that are replicated by the specialized reverse transcriptase telomerase, which comprises the catalytically active reverse transcriptase TERT and its RNA template TERC. In human normal somatic cells, hTERT is maintained in a closed state such that cells lack telomerase and are unable to maintain telomeres following cell division. As a result, telomeres shorten gradually until critically short telomeres trigger replicative senescence or apoptosis. Most cancer cells, however, experience reactivation or hyperactivation of hTERT, which disturbs the normal events leading to telomere shortening, thereby inducing uncontrolled cell proliferation [3–7].

Regulation of hTERT activity was broadly understood to be governed by holoenzyme assembly, cellular localization, and transcriptional control. Point mutations within the hTERT promoter were found to be prevalent in a significant proportion of patients with different cancer types, including ~83% of glioblastoma cases, 70% of hepatocellular carcinoma cases, 85% of bladder cancer cases, up to 75% of melanoma and non-melanoma skin cancer cases, 80% of urinary tract cancer cases, and 50% of thyroid cancer cases (Figure 1). In all cases, these mutations were G>A transitions and were found to be causally associated with telomerase hyperactivation, poor patient survival, and disease recurrence [8–18].

Figure 1. Graph representing frequency of point mutations on human telomerase reverse transcriptase (hTERT) promoter (at position −124 or −146) across different cancers.

Figure 1

Open in a new tab

These are G>A transitions, clinically prevalent across multiple cancers [20,90,91].

Understanding how promoter mutations contribute to hTERT activation has mostly focused on the novel activator protein binding site(s) that is generated as a result of the mutations (reviewed in [19,20]). Recent findings, however, add new dimensions, including the role of hTERT promoter mutations in mediating chromatin looping; interaction of telomeres with the hTERT loci; and the effect of non-duplex DNA secondary structures, G-quadruplexes, formed within the hTERT promoter. These emerging findings and the crosstalk among the apparently distinct mechanisms in possibly context-dependent ways might significantly contribute to our understanding of hTERT regulation in neoplastic transformation, in addition to pluripotency, aging, and T-cell activation. In this review, we detail the mechanisms of hTERT hyperactivation and highlight emerging possibilities.

Molecular mechanisms of telomerase hyperactivation in cancers driven by clinically prevalent mutations on the hTERT promoter

hTERT promoter mutations were discovered to occur at several positions, including −57 bp (1295161T>G), −124 bp (1295228 G>A), −146 bp (1295250G>A), and −245 bp (rs2853669 G/A) upstream of the translation start site [19,21–23] (Figure 2). Among these, −124G>A and −146G>A are the most common and are mostly monoallelic [24,25]. Both of these mutations lead to generation of a 11-bp sequence, CCCGGAAGGGG, that is similar to the ETS factor binding motif [15]. Of the 27 ETS binding factors known, GABP, ETS1, and ETV3 were screened as potential reactivators of hTERT expression. The effect of GABP on hTERT hyperactivation was most drastic in glioblastomas with the hTERT promoter mutation(s). In addition, GABP binding on the mutant hTERT promoter resulted in direct transcriptional activation of hTERT expression [26]. Similar effects of GABPalpha/beta (GABPA/B1)-mediated telomerase reactivation are also observed in melanoma, hepatocellular carcinoma, neuroblastoma, and bladder cancer [24,27]. GABPA forms a complex with BRD4 for epigenetic activation of hTERT where the GABPA–BRD4 complex induced a permissive chromatin conformation by increasing H3K4me2/3 and H3K9ac activation marks at the hTERT promoter [27–29]. Furthermore, the β1L isoform of GABP is most critical for telomerase hyperactivation in glioblastomas. GABP functions as a dimer/tetramer of its alpha and beta subunits; while the alpha subunit remains constant, the beta subunit can vary between β1 and β2. Of these, β1 can be long (β1L) or short (β1S). Mutation or deletion of GABPβ1L caused telomerase resuppression in hTERT promoter mutant glioblastoma [30].

Figure 2. Molecular mechanisms by which human telomerase reverse transcriptase (hTERT) promoter mutations induce telomerase hyperactivation.

Figure 2

Open in a new tab

Clinically prevalent point mutations −124 and −146 G>A transitions at the hTERT promoter generate novel E26 transformation-specific (ETS) factor binding sites that allow different combinations of ETS factors to bind and reactivate telomerase across cancers. From the left: (i) GABPalpha (GABPA) binds mutant hTERT promoter and hyperactivates its expression via BRD4 and mediator complex 12 (MED12); (ii) TWEAK (tumor necrosis factor-like weak inducer of apoptosis) induces NF-κB (p52) to bind with ETS1/2, which recruits it to the hTERT promoter to reactivate its expression in glioblastoma; (iii) mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) phosphorylates the Thr38 residue of ETS1, which binds the hTERT promoter, thereby reactivating it in melanoma; (iv) RAS-ERK2 reactivates hTERT in association with GABPA or ETS1 in melanoma with BRAFV600E mutation; (v) FOXE1 activates hTERT in combination with ETS factor, ETV5; and (vi) in bladder cancer, transcription factor tripartite motif containing 24 (TRIM24) and TRIM28 are recruited on hTERT promoter. Mammalian target of rapamycin (mTOR1) then phosphorylates TRIM28, releasing TRIM24, consequently activating telomerase expression.

Like GABP, other ETS binding factors mediate telomerase reactivation in cancer. Noncanonical NF-κB (p52) induced by TWEAK (tumor necrosis factor-like weak inducer of apoptosis) hyperactivates telomerase in −146G>A but not in −124G>A mutant glioblastomas. NF-κB signaling induces tumor proliferation in −146G>A mutant glioblastoma cells in vitro and T98G-derived xenografts in NOD-SCID mice in vivo. Furthermore, p52 binds in a cooperative manner with the ETS1/2 at the hTERT promoter. While both −124 and −146 mutant sites create novel ETS binding sites, they differ by the presence of a T (−146 CCCGACCCTTCCGGGTCCCC and −124 site GGCCCAGCCCTTCCGGGCCCTC) at the beginning of the ETS binding motif. The presence of TCC in the −146G>A mutation site creates specificity for p52 binding in cooperation with ETS. The presence of ETS at the mutant hTERT promoter is, however, essential for p52-mediated telomerase reactivation [31,32]. Furthermore, the crystal structure of p52/ETS1 in complex with the promoter segment harboring the −146C>T mutation revealed p52 in the homodimeric form. Along with ETS1, this finding suggests formation of a heterotetramer at the mutant hTERT promoter where the p52/ETS1 heterodimer interacts through p52 homodimerization to form a heterotetramer. This complex was also shown to interact with the native ETS binding motifs flanking the −146 mutation site within the hTERT promoter, much like the GABP heterotetramer [26,33].

ETS1-mediated telomerase reactivation is found in melanoma cell lines. As such, silencing of ETS1 resulted in significant telomerase suppression [34]. ETS1 transcriptional function is dependent on Thr38 phosphorylation of ETS1 by extracellular signal-regulated kinase (ERK). This dependency is a consequence of mitogen-activated protein kinase (MAPK) pathway activation, which associates with simultaneous BRAF or NRAS mutations in melanomas. BRAF mutations are commonly reported to co-occur with hTERT promoter mutations in melanomas and thyroid cancers [35–39]. In addition to NF-κB, RAS-ERK mediates telomerase reactivation in BRAFV600E mutant melanomas. ERK2 is recruited to the mutant hTERT promoter in association with GABP or ETS1. Following this recruitment, ERK2 phosphorylates the transcription factor SP1 and abrogates HDAC1 occupancy, thereby inducing a permissive promoter chromatin conformation through gain in H3K9 acetylation histone [40] (Figure 2).

In thyroid cancers devoid of GABP activity, the ETS factor ETV5 binds −124G>A mutant hTERT promoter to reactivate telomerase in cooperation with FOXE1 [11]. In hepatocellular carcinoma, prospero homeobox protein 1 (PROX1) transcriptionally activates the mutant hTERT promoter. However, this does not appear to be the main mechanism of telomerase reactivation, because hepatocellular carcinoma expresses high levels of the hepatitis B virus X (HBx) protein, which suppresses PROX1 expression in vitro [41]. Recently, transcription factor tripartite motif containing 28 (TRIM28) was found to induce transcriptional activation of telomerase in bladder cancers with hTERT promoter mutation (−124G>A). GABPA mediates the recruitment of TRIM28 along with TRIM24 at the mutant hTERT promoter, where TRIM24 represses telomerase. Phosphorylation of TRIM28 by mammalian target of rapamycin (mTOR) complex 1 (mTORC1) releases TRIM24, resulting in hyperactivation of telomerase [42]. Figure 2 summarizes the different molecular mechanisms known to reactivate telomerase because of hTERT promoter mutations in cancers.

Association of telomerase hyperactivating mutation(s) with telomeres and neoplastic transformation

Considering the recurrence of hTERT promoter mutations, several groups have explored the significance of telomerase reactivation in neoplastic transformation. hTERT promoter mutations have been reported as early events in cancer initiation [43–45] and have been studied as driver mutations rather than sporadic events [21,22]. However, while essential for tumor progression, hTERT promoter mutations are clonal and therefore nonessential in glioma initiation [46]. In another study, normal bladder stem cells transformed to bladder cancer cells following telomerase hyperactivation due to −124G>A promoter mutation. Conversely, correcting the −124G>A mutation back to G resuppressed telomerase in bladder cancer stem cells, resulting in inhibition of tumor proliferation [47].

Consistent with these findings, when normal somatic cells, which generally lack telomerase, are introduced with hTERT promoter mutations, telomerase is reactivated and cell proliferation is induced [9], suggesting that telomerase reactivating mutations can induce immortalization of normal somatic cells [9]. This finding was later recognized as a two-step process in melanoma: (i) hTERT promoter mutations reactivate telomerase on critically short telomeres that are barely maintained to prevent inhibition of cell proliferation and thereby extend cellular lifespan, and (ii) in the second step, critically short telomeres induce genomic instability and hTERT promoter mutations further enhance telomerase to elongate telomeres and sustain cell proliferation [48–50]. In overall agreement with these hTERT mechanisms, hTERT promoter mutations are reported as diagnostic biomarkers in several cancers, including bladder, thyroid, renal, and pelvic cancer; glioma; and spitzoid melanocytic neoplasms [43,51–56;reviewed in 57].

Role of epigenetic state and mutations in the hTERT promoter in chromatin looping and telomerase regulation

hTERT promoter mutations significantly correlate with old age across gliomas, central nervous system-associated cancers, thyroid cancers, and hepatocellular carcinoma [58–61]. Particularly, co-occurrence of hTERT promoter mutations along with BRAFV600E mutations in thyroid cancer is associated with aging [39], and the −146G>A mutation specifically correlates with telomere length in head and neck cancers [62]. In patients with long telomeres, point mutations in the hTERT promoter appear to correlate with resistance to radiotherapy and poor survival [63].

In addition, a more direct interaction between telomere length and telomerase regulation has been reported. The hTERT promoter locus (1.2 Mb from telomeres on chromosome 5p) associates with relatively long telomeres through chromatin looping, which results in telomere-like heterochromatin formation at the promoter, leading to hTERT suppression [64]. Consistent with this finding, normal aged fibroblasts express higher levels of hTERT because they lack looping-mediated chromatin interactions due to shorter telomeres. Association of the telomere repeat binding factor 2 (TRF2) at the hTERT promoter locus is a result of telomeric looping (Figure 3A); however, whether other telomere-binding proteins, such as TRF1, POT1, or RAP1, also associate with the hTERT promoter due to looping is not clear. Independently, telomere-binding proteins TRF2 and NM23-H2 have been reported to interact with the promoter and affect hTERT transcription in cancers [65,66].

Figure 3. Chromatin looping and telomere looping mediate human telomerase reverse transcriptase (hTERT) regulation.

Figure 3

Open in a new tab

(A) Telomere looping-mediated telomerase repression. Cells with long telomeres have telomeres that loop back to the hTERT promoter. This recruited telomere binds telomere repeat binding factor 2 (TRF2) to the hTERT promoter, keeping telomerase repressed in young BJ fibroblast cells. (B) Chromatin looping-mediated telomerase hyperactivation in hTERT promoter mutant cancers. hTERT promoter that is about 300 kb upstream of the site of clinically prevalent mutations is the GABPalpha (GABPA) binding site. This region loops back to near the translation start site promoter in hTERT promoter mutant cancers, thereby causing telomerase hyperactivation through BRD4 and mediator complex 12 (MED12). (C) CCCTC-binding factor (CTCF)-mediated chromosome looping causes hTERT promoter–enhancer interaction. CTCF mediates looping of an enhancer element from 4.2 kb upstream of transcription start site to activate telomerase expression in lung cancer cell lines.

In cancers with hTERT promoter mutations, a GABPA binding site approximately 300 kb upstream (known as the T-INT1 locus) is associated with the hTERT promoter through chromatin looping [27] (Figure 3B). This finding further substantiates the finding that GABPA mediates BRD4 recruitment on the mutant hTERT promoter, which results in permissive chromatin conformation [27]. While GABPA occupancy at the T-INT1 region was shown in cells without promoter mutations, the generation of new ETS binding sites triggered chromatin looping to recruit GABPA to the mutant promoter [27]. Recently, another study identified the mediator complex 12 (MED12) as a member in the GABPA/BRD4 regulatory complex using CRISPR/Cas9 and siRNA-based screens. MED12 mediated T-INT1-hTERT looping in cancers with promoter mutations, thereby inducing telomerase hyperactivation [29].

In addition, CCCTC-binding factor (CTCF) has been reported to mediate hTERT promoter–enhancer looping interaction in lung cancer cells. siRNA-mediated CTCF depletion abolishes hTERT promoter interaction with an enhancer element 4.5 kb upstream of the transcription start site. Moreover, CTCF-mediated c-MYC recruitment to hTERT proximal promoter induces hTERT [67] (Figure 3C). Together, the associations between hTERT promoter mutations, telomeres, chromosome looping, and neoplastic transformations need further investigation for a better understanding of the underlying mechanistic connections in cancer and other age-associated pathologies.

G-quadruplex-dependent mechanisms of telomerase regulation and its impact on cancer

The hTERT gene promoter is one of the most GC-rich promoters with as much as 71.3% of its content GC, including a CpG island of 1138 bp (−808 to 330 bp of the transcription start site) [68]. Repetitive guanine nucleotides fold into DNA secondary structures known as G-quadruplexes. The hTERT promoter harbors nine tandem putative G-quadruplex-forming sequences within its core promoter [69–71]. Multiple transcription factors regulate hTERT expression in a promoter G-quadruplex-dependent manner [66,72,73], and G-quadruplex-stabilizing ligands, including TMPyP4, JD83, and SMH1-4.6, have been shown to suppress hTERT [65,66,74–77]. Non-metastatic protein 2 (NME2) and CTCF were shown to repress telomerase transcriptionally. NME2 was reported to associate with a G-quadruplex 192 bp upstream of the translation start site, and CTCF was found to interact with a G-quadruplex within the first exon of the hTERT gene [66,73]. While the regulatory mechanism of CTCF remains to be explored, NME2 was reported to recruit the RE-1 silencing transcription factor (REST)/co-REST/LSD1 repressor complex to the hTERT promoter. G-quadruplex binding ligands TMPyP4, JD83, and SMH1-4.6 were found to influence the recruitment of G-quadruplex-interacting transcription factors, which resulted in altered expression of hTERT [65,66,72].

Direct binding of TRF2 that is not associated with telomeres (or nontelomeric TRF2) to the hTERT promoter is contingent on promoter G-quadruplex stability. In both cancer and normal cells without mutations in the hTERT promoter, G-quadruplexes remain intact. TRF2 associates directly with the hTERT promoter and recruits REST along with polycomb repressor complex 2 (PRC2). PRC2 mediates maintenance of the polycomb signature at the hTERT promoter [28,78], and the hTERT promoter is maintained in a constitutively repressed state unless derepressed to reactivate telomerase [78]. Loss of TRF2 binding from the hTERT promoter disrupts the repressor complex, resulting in derepression of hTERT in both normal and cancer cells [65]. Consistent with this silencing, TRF2 promotes telomerase expression and activity across normal and cancer cells. In vitro, TRF2 had higher binding affinity to the wild-type hTERT promoter than the mutated promoter. TRF2 binding is lost from the hTERT mutant promoter (−124 or −146G>A), leading to telomerase hyperactivation in patient-derived glioblastoma cell lines. Loss of TRF2 binding resulted in loss of the repressor complex-mediated restrictive chromatin conformation. GABPA silencing did not restore TRF2 binding to the mutant hTERT promoter, further confirming that TRF2 association is dependent on the presence of hTERT promoter G-quadruplex. Indeed, glioblastoma cells with mutations in hTERT promoter that were treated with G-quadruplex-stabilizing ligands resulted in resuppression of hTERT. TRF2 binding was restored at the mutant hTERT promoter along with telomerase resuppression (Figure 4). Together, these support the regulatory significance of non-ETS factors and the hTERT promoter G-quadruplexes in telomerase hyperactivation during cancer.

Figure 4. The human telomerase reverse transcriptase (hTERT) promoter has tandem G-quadruplex-forming sequences within its core promoter.

Figure 4

Open in a new tab

(A) Schematic of G-quadruplex (G4s) formation. Guanine nucleotides form Hoogsteen base pairing, leading to formation of G-tetrads, stabilized by a bivalent metal ion in the center. Two or more G-tetrads fold to form a G-quadruplex. In regions of G-repeats (including promoters and telomeres), G-tetrads stack over each other, forming ‘stems’. The GGG/GG stems are separated by stretches of nucleotides known as ‘loops’. G-quadruplexes have a consensus motif of two or three continuous guanine bases (stem) separated by loops comprising stretches of nucleotides that usually range up to 15 bp in length [89]. (B) Telomere repeat binding factor 2 (TRF2) binds hTERT promoter G-quadruplexes and recruits the RE-1 silencing transcription factor (REST)/polycomb repressor complex 2 (PRC2) repressor complex, keeping telomerase suppressed in normal cells. Clinically recurrent point mutations (−124/−146G>A) in G>A transitions destabilize the hTERT promoter G-quadruplex, thereby disrupting the TRF2 binding site. This destabilization causes telomerase hyperactivation. G-quadruplex-stabilizing small molecules permit TRF2 binding followed by hTERT repression.

Concluding remarks

Crosstalk between different transcriptional regulators such as GABP, NF-κB (p52), and TRF2 that bind at the same region of the hTERT promoter is of interest. While ETS1 mediates binding of NF-κB on the mutant hTERT promoter [31], TRF2 directly binds the wild-type hTERT promoter [65]. However, GABPA and TRF2 binding at the hTERT promoter are mutually exclusive [65]. On treatment with G-quadruplex-stabilizing ligands, along with restoration of TRF2 occupancy, GABPA binding is lost from the hTERT promoter in glioblastoma cell lines [65]. Recently, nuclear export of TRF2 following phosphorylation of TERF2 interacting protein [TERF2 IP; also known as the repressor activator protein 1 (RAP1)] activates NF-κB and induces senescence of normal endothelial cells [79]. RAP1 is known to interact with IκB kinases (IKKs) and directly regulate NF-κB expression and activity [80], and RAP1 levels are activated by NF-κB through feedforward regulation [80]. Although indirect, this finding shows that nuclear levels of TRF2 and NF-κB activation could be linked and together could impact on hTERT regulation. Given that these mechanisms overlap at the hTERT promoter, particularly in the case of promoter mutations in glioblastoma and melanoma, further work delineating the physiological contexts that dictate cooperative vis-à-vis competitive associations and the resulting effect on hTERT regulation should bring forth better understanding with clinical significance.

The DNA methylation status of the hTERT promoter is also a critical regulator of telomerase expression. In bladder cancer cells with hTERT promoter mutations, hypomethylation (5mC) of the hTERT promoter is essential for telomerase reactivation [28]. Analysis of 833 human cancer cell lines reported hypomethylation of the proximal hTERT promoter at the active allele carrying telomerase hyperactivating mutations, but not the allele without mutations [81,82]. Simultaneously, while not specifically at the hTERT promoter, genome-wide analysis independently showed that the presence of G-quadruplexes impacted the DNA methylome by sequestering DNA methyltransferase I (DNMT1) recruitment. G-quadruplex structures specifically, and not merely G-rich sequences, were shown to inhibit DNMT1 enzymatic activity [83]. Consistent with this finding, CTCF-mediated transcriptional regulation of hTERT was dependent on G-quadruplexes and DNA methylation [73]. Together, these findings imply that G-quadruplex-mediated telomerase regulation might involve multiple layers, including regulatory effects of DNA methylation on G-quadruplex stability or G-quadruplex-dependent TRF2 binding [65]. Moreover, another G-quadruplex-interacting factor, NM23-H2, regulates hTERT transcription in a G-quadruplex-dependent manner [66]. Taken together, these findings suggest that G-quadruplex-stabilizing protein(s) may impact DNA methylation at the hTERT promoter. In parallel, emerging knowledge of the involvement of G-quadruplexes in chromatin looping [84–86] and the direct role of chromatin looping in telomerase hyperactivation might shed new light on these mechanisms [27,29].

Observations suggesting a direct or indirect role of telomeres in regulation of hTERT might be key to many age-related physiologies, including cancer. Recent work shows this in normal primary fibroblasts and T-lymphocytes, where the role of telomere-bound TRF2 at the hTERT promoter was discussed [64,87]. Here, TRF2-mediated looping of telomeres to the hTERT promoter was implicated (described earlier). Independently, the role of nontelomeric TRF2 in direct transcription regulation of hTERT was demonstrated [65] in addition to findings showing that TRF2 binds and regulates transcription from several nontelomeric sites [88,89]. Furthermore, the TRF2 associations across the genome were dependent on the length of telomeres. Taken together, these findings suggest that telomeres might impact hTERT through chromatin looping or directly in possibly context-dependent pathways.

In conclusion, it would be important to explore the role of telomeres and hTERT promoter mutations in telomerase regulation, not only in cancer but also in other cell types where telomere length varies, such as in activated immune cells and in stem cells undergoing differentiation (see Outstanding questions). Additionally, extratelomeric roles of hTERT, such as those in transcriptional regulation, apoptosis, stem cell proliferation, DNA damage regulation, glucose transport, mitochondrial DNA repair, and reduction of intracellular oxidative stress, as discussed in multiple reviews [90–95], further make the case for understanding mechanisms of telomerase regulation.

Outstanding questions.

What is the role of telomeres in inducing hTERT during immune cell activation?

Why are hTERT promoter mutations not generic across all cancer types? Are there other driver mutations that govern the presence or absence of hTERT promoter mutations?

What is the crosstalk, if any, between GABPA/B/ETS1/NF-κB and TRF2 that compete for the same binding site on the hTERT promoter?

Other than telomere looping, what mechanisms govern telomere-dependent hTERT regulation?

Could stabilization of hTERT promoter G-quadruplexes in cancers with promoter mutations be a suitable anticancer therapy?

How is telomerase repression regulated as an iPSC differentiates to respective somatic cell lineages?

Is there a feedforward loop for enhancing telomerase to increase telomere length in iPSCs? If so, what or how are the limits governed?

Highlights.

Ninety percent of cancers hyperactivate telomerase to induce continuous cell proliferation. Two clinically significant noncoding point mutations within the human telomerase reverse transcriptase (hTERT) core promoter have been found causal for telomerase hyperactivation across >40% of all cancers.

G>A transitions at position −124/−146 from the transcription start site on the mutant hTERT promoter were found to generate novel E26 transformation-specific (ETS) factor binding sites. Several studies have unraveled different ETS-associated mechanisms causing transcriptional hyperactivation of telomerase owing to the mutations.

The role of chromatin looping in telomerase reactivation has also come to light in this context; we summarize all such known mechanisms and present potential connections between these.

Recent findings demonstrating the role of telomere-binding proteins and G-quadruplexes in telomerase regulation unravel another mode of potentially telomere length-dependent telomerase reactivation across cancer cells. In this review, we present the crosstalk between all mechanisms known in hyperactivating telomerase in hTERT promoter mutant cancers.

Acknowledgments

This work was supported by research grants from Wellcome Trust/DBT India Alliance Fellowship (IA/S/18/2/504021) to S.C. We acknowledge the Council of Scientific and Industrial Research and Academy of Scientific and Innovative Research for research (CSIR grant HCP 43) and other infrastructure.

Footnotes

Declaration of interests

S.C. is a scientific advisor for Rejuvas Biotech India Pvt. Ltd.

References

  • 1.Lander AD, et al. Cell lineages and the logic of proliferative control. PLoS Biol. 2009;7:e15. doi: 10.1371/journal.pbio.1000015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Duronio RJ, Xiong Y. Signaling pathways that control cell proliferation. Cold Spring Harb Perspect Biol. 2013;5:a008904. doi: 10.1101/cshperspect.a008904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Shay JW, et al. Telomerase and cancer. Hum Mol Genet. 2001;10:677–685. doi: 10.1093/hmg/10.7.677. [DOI] [PubMed] [Google Scholar]
  • 4.Shay JW. Role of telomeres and telomerase in aging and cancer. Cancer Discov. 2016;6:584–593. doi: 10.1158/2159-8290.CD-16-0062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shay JW, Bacchetti S. A survey of telomerase activity in human cancer. Eur J Cancer. 1997;33:787–791. doi: 10.1016/S0959-8049(97)00062-2. [DOI] [PubMed] [Google Scholar]
  • 6.Akincilar SC, et al. Reactivation of telomerase in cancer. Cell Mol Life Sci. 2016;73:1659–1670. doi: 10.1007/s00018-016-2146-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Shay JW, Wright WE. Senescence and immortalization: role of telomeres and telomerase. Carcinogenesis. 2005;26:867–874. doi: 10.1093/carcin/bgh296. [DOI] [PubMed] [Google Scholar]
  • 8.Liu H-Y, et al. Conformation selective antibody enables genome profiling and leads to discovery of parallel G-quadruplex in human telomeres. Cell Chem Biol. 2016;23:1261–1270. doi: 10.1016/j.chembiol.2016.08.013. [DOI] [PubMed] [Google Scholar]
  • 9.Chiba K, et al. Cancer-associated TERT promoter mutations abrogate telomerase silencing. eLife. 2015;4:e07918. doi: 10.7554/eLife.07918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Liu R, Xing M. Diagnostic and prognostic TERT promoter mutations in thyroid fine-needle aspiration biopsy. Endocr Relat Cancer. 2014;21:825–830. doi: 10.1530/ERC-14-0359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bullock M, et al. ETS factor ETV5 activates the mutant telomerase reverse transcriptase promoter in thyroid cancer. Thyroid. 2019;29:1623–1633. doi: 10.1089/thy.2018.0314. [DOI] [PubMed] [Google Scholar]
  • 12.Myung JK, et al. TERT promoter mutations and tumor persistence/recurrence in papillary thyroid cancer. Cancer Res Treat. 2016;48:942–947. doi: 10.4143/crt.2015.362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Crescenzi A, et al. Preoperative assessment of TERT promoter mutation on thyroid core needle biopsies supports diagnosis of malignancy and addresses surgical strategy. Horm Metab Res. 2016;48:157–162. doi: 10.1055/s-0035-1548873. [DOI] [PubMed] [Google Scholar]
  • 14.Sahm F, et al. TERT promoter mutations and risk of recurrence in meningioma. J Natl Cancer Inst. 2016;108:djv377. doi: 10.1093/jnci/djv377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rachakonda PS, et al. TERT promoter mutations in bladder cancer affect patient survival and disease recurrence through modification by a common polymorphism. Proc Natl Acad Sci U S A. 2013;110:17426–17431. doi: 10.1073/pnas.1310522110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Landa I, et al. Frequent somatic TERT promoter mutations in thyroid cancer: higher prevalence in advanced forms of the disease. J Clin Endocrinol Metab. 2013;98:E1562–E1566. doi: 10.1210/jc.2013-2383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Melo M, et al. TERT promoter mutations are a major indicator of poor outcome in differentiated thyroid carcinomas. J Clin Endocrinol Metab. 2014;99:E754–E765. doi: 10.1210/jc.2013-3734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Razis E, et al. Is there an independent role of TERT and NF1 in high grade gliomas. Transl Oncol. 2020;13:346–354. doi: 10.1016/j.tranon.2019.10.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ramlee MK, et al. Transcription regulation of the human telomerase reverse transcriptase (hTERT) gene. Genes (Basel) 2016;7:50. doi: 10.3390/genes7080050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Liu T, et al. Cancer-specific telomerase reverse transcriptase (TERT) promoter mutations: biological and clinical implications. Genes (Basel) 2016;7:38. doi: 10.3390/genes7070038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Horn S, et al. TERT promoter mutations in familial and sporadic melanoma. Science. 2013;339:959–961. doi: 10.1126/science.1230062. [DOI] [PubMed] [Google Scholar]
  • 22.Huang FW, et al. Highly recurrent TERT promoter mutations in human melanoma. Science. 2013;339:957–959. doi: 10.1126/science.1229259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Killela PJ, et al. TERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal. Proc Natl Acad Sci U S A. 2013;110:6021–6026. doi: 10.1073/pnas.1303607110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Stern JL, et al. Mutation of the TERT promoter, switch to active chromatin, and monoallelic TERT expression in multiple cancers. Genes Dev. 2015;29:2219–2224. doi: 10.1101/gad.269498.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Huang FW, et al. TERT promoter mutations and monoallelic activation of TERT in cancer. Oncogenesis. 2015;4:e176. doi: 10.1038/oncsis.2015.39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bell RJA, et al. The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer. Science. 2015;348:1036–1039. doi: 10.1126/science.aab0015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Akincilar SC, et al. Long-range chromatin interactions drive mutant TERT promoter activation. Cancer Discov. 2016;6:1276–1291. doi: 10.1158/2159-8290.CD-16-0177. [DOI] [PubMed] [Google Scholar]
  • 28.Stern JL, et al. Allele-specific DNA methylation and its interplay with repressive histone marks at promoter-mutant TERT genes. Cell Rep. 2017;21:3700–3707. doi: 10.1016/j.celrep.2017.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shanmugam R, et al. Genome-wide screens identify specific drivers of mutant hTERT promoters. Proc Natl Acad Sci U S A. 2022;119:e2105171119. doi: 10.1073/pnas.2105171119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mancini A, et al. Disruption of the β1L isoform of GABP reverses glioblastoma replicative immortality in a TERT promoter mutation-dependent manner. Cancer Cell. 2018;34:513–528.:e8. doi: 10.1016/j.ccell.2018.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Li Y, et al. Non-canonical NF-kB signalling and ETS1/2 cooperatively drive C250T mutant TERT promoter activation. Nat Cell Biol. 2015;17:1327–1338. doi: 10.1038/ncb3240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Tergaonkar V. NFkB drives TERT promoter reactivation in cancer. Cell Cycle. 2016;15:156–157. doi: 10.1080/15384101.2015.1118908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Xu X, et al. Structural basis for reactivating the mutant TERT promoter by cooperative binding of p52 and ETS1. Nat Commun. 2018;9:3183. doi: 10.1038/s41467-018-05644-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Vallarelli AF, et al. TERT promoter mutations in melanoma render TERT expression dependent on MAPK pathway activation. Oncotarget. 2016;7:53127–53136. doi: 10.18632/oncotarget.10634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Liu X, et al. TERT promoter mutations and their association with BRAF V600E mutation and aggressive clinicopathological characteristics of thyroid cancer. J Clin Endocrinol Metab. 2014;99:E1130–E1136. doi: 10.1210/jc.2013-4048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Xing M, et al. BRAF V600E and TERT promoter mutations cooperatively identify the most aggressive papillary thyroid cancer with highest recurrence. J Clin Oncol. 2014;32:2718–2726. doi: 10.1200/JCO.2014.55.5094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Jin L, et al. BRAF and TERT promoter mutations in the aggressiveness of papillary thyroid carcinoma: a study of 653 patients. Oncotarget. 2016;7:18346–18355. doi: 10.18632/oncotarget.7811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Dubbink HJ, et al. TERT promoter mutations and BRAF mutations are rare in sporadic, and TERT promoter mutations are absent in NF1-related malignant peripheral nerve sheath tumors. J Neuro-Oncol. 2014;120:267–272. doi: 10.1007/s11060-014-1553-8. [DOI] [PubMed] [Google Scholar]
  • 39.Shi X, et al. Association of TERT promoter mutation I, 295,228 C>T with BRAF V600E mutation, older patient age, and distant metastasis in anaplastic thyroid cancer. J Clin Endocrinol Metab. 2015;100:E632–E637. doi: 10.1210/jc.2014-3606. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Li Y, et al. Activation of mutant TERT promoter by RAS-ERK signaling is a key step in malignant progression of BRAF-mutant human melanomas. Proc Natl Acad Sci U S A. 2016;113:14402–14407. doi: 10.1073/pnas.1611106113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kim Y-J, et al. Suppression of PROX1-mediated TERT expression in hepatitis B viral hepatocellular carcinoma. Int J Cancer. 2018;143:3155–3168. doi: 10.1002/ijc.31731. [DOI] [PubMed] [Google Scholar]
  • 42.Agarwal N, et al. TRIM28 is a transcriptional activator of the mutant TERT promoter in human bladder cancer. Proc Natl Acad Sci U S A. 2021;118:e2102423118. doi: 10.1073/pnas.2102423118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wang N, et al. TERT promoter mutation as an early genetic event activating telomerase in follicular thyroid adenoma (FTA) and atypical FTA. Cancer. 2014;120:2965–2979. doi: 10.1002/cncr.28800. [DOI] [PubMed] [Google Scholar]
  • 44.Cheng L, et al. Telomerase reverse transcriptase (TERT) promoter mutation analysis of benign, malignant and reactive urothelial lesions reveals a subpopulation of inverted papilloma with immortalizing genetic change. Histopathology. 2016;69:107–113. doi: 10.1111/his.12920. [DOI] [PubMed] [Google Scholar]
  • 45.Shain AH, et al. The genetic evolution of melanoma from precursor lesions. N Engl J Med. 2015;373:1926–1936. doi: 10.1056/NEJMoa1502583. [DOI] [PubMed] [Google Scholar]
  • 46.Stead LF, Verhaak RGW. Doomed from the TERT? A two-stage model of tumorigenesis in IDH-wild-type glioblastoma. Cancer Cell. 2019;35:542–544. doi: 10.1016/j.ccell.2019.03.009. [DOI] [PubMed] [Google Scholar]
  • 47.Li C, et al. The C228T mutation of TERT promoter frequently occurs in bladder cancer stem cells and contributes to tumorigenesis of bladder cancer. Oncotarget. 2015;6:19542–19551. doi: 10.18632/oncotarget.4295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Chiba K, et al. Mutations in the promoter of the telomerase gene TERT contribute to tumorigenesis by a two-step mechanism. Science. 2017;357:1416–1420. doi: 10.1126/science.aao0535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Pestana A, et al. TERT biology and function in cancer: beyond immortalisation. J Mol Endocrinol. 2017;58:R129–R146. doi: 10.1530/JME-16-0195. [DOI] [PubMed] [Google Scholar]
  • 50.Heidenreich B, Kumar R. TERT promoter mutations in telomere biology. Mutat Res. 2017;771:15–31. doi: 10.1016/j.mrrev.2016.11.002. [DOI] [PubMed] [Google Scholar]
  • 51.Allory Y, et al. Telomerase reverse transcriptase promoter mutations in bladder cancer: high frequency across stages, detection in urine, and lack of association with outcome. Eur Urol. 2014;65:360–366. doi: 10.1016/j.eururo.2013.08.052. [DOI] [PubMed] [Google Scholar]
  • 52.Hurst CD, et al. Comprehensivemutationanalysisofthe TERT promoter in bladder cancer and detection of mutations in voided urine. Eur Urol. 2014;65:367–369. doi: 10.1016/j.eururo.2013.08.057. [DOI] [PubMed] [Google Scholar]
  • 53.Wang Z, et al. Telomeric repeat-containing RNA (TERRA) constitutes a nucleoprotein component of extracellular inflammatory exosomes. Proc Natl Acad Sci U S A. 2015;112:E6293–E6300. doi: 10.1073/pnas.1505962112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wang K, et al. TERT promoter mutations are associated with distant metastases in upper tract urothelial carcinomas and serve as urinary biomarkers detected by a sensitive castPCR. Oncotarget. 2014;5:12428–12439. doi: 10.18632/oncotarget.2660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Wang X, et al. Association of telomerase reverse transcriptase promoter mutations with the prognosis of glioma patients: ameta-analysis. Mol Neurobiol. 2016;53:2726–2732. doi: 10.1007/s12035-015-9400-2. [DOI] [PubMed] [Google Scholar]
  • 56.Lee S, et al. TERT promoter mutations are predictive of aggressive clinical behavior in patients with spitzoid melanocytic neoplasms. Sci Rep. 2015;5:11200. doi: 10.1038/srep11200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Vinagre J, et al. Telomerase promoter mutations in cancer: an emerging molecular biomarker. Virchows Arch. 2014;465:119–133. doi: 10.1007/s00428-014-1608-4. [DOI] [PubMed] [Google Scholar]
  • 58.Eckel-Passow JE, et al. Glioma groups based on 1p/19q, IDH, and TERT promoter mutations in tumors. N Engl J Med. 2015;372:2499–2508. doi: 10.1056/NEJMoa1407279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Jang J-W, et al. Significance of TERT genetic alterations and telomere length in hepatocellular carcinoma. Cancers (Basel) 2021;13:2160. doi: 10.3390/cancers13092160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Liu T, et al. The age- and shorter telomere-dependent TERT promoter mutation in follicular thyroid cell-derived carcinomas. Oncogene. 2014;33:4978–4984. doi: 10.1038/onc.2013.446. [DOI] [PubMed] [Google Scholar]
  • 61.Vinagre J, et al. Frequency of TERT promoter mutations in human cancers. Nat Commun. 2013;4:2185. doi: 10.1038/ncomms3185. [DOI] [PubMed] [Google Scholar]
  • 62.Barczak W, et al. hTERT C250T promoter mutation and telomere length as a molecular markers of cancer progression in patients with head and neck cancer. Mol Med Rep. 2017;16:441–446. doi: 10.3892/mmr.2017.6590. [DOI] [PubMed] [Google Scholar]
  • 63.Gao K, et al. TERT promoter mutations and long telomere length predict poor survival and radiotherapy resistance in gliomas. Oncotarget. 2016;7:8712–8725. doi: 10.18632/oncotarget.6007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Kim W, et al. Regulation of the human telomerase gene TERT by telomere position effect-over long distances(TPE-OLD): implications for aging and cancer. PLoS Biol. 2016;14:e2000016. doi: 10.1371/journal.pbio.2000016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Sharma S, et al. Human telomerase expression is under direct transcriptional control of the telomere-binding-factor TRF2. bioRxiv. 2020 doi: 10.1101/2020.01.15.907626. Published online January 15, 2020. [DOI] [Google Scholar]
  • 66.Saha D, et al. Epigenetic suppression of human telomerase (hTERT) is mediated by the metastasis suppressor NME2 in a G-quadruplex-dependent fashion. J Biol Chem. 2017;292:15205–15215. doi: 10.1074/jbc.M117.792077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Eldholm V, et al. CTCF mediates the TERT enhancerpromoter interactions in lung cancer cells: identification ofa novel enhancer region involved in the regulation of TERT gene. Int J Cancer. 2014;134:2305–2313. doi: 10.1002/ijc.28570. [DOI] [PubMed] [Google Scholar]
  • 68.Horikawa I, et al. Cloning and characterization of the promoter region of human telomerase reverse transcriptase gene. Cancer Res. 1999;59:826–830. [PubMed] [Google Scholar]
  • 69.Lim KW, et al. Coexistence of two distinct G-quadruplex conformations in the hTERT promoter. J Am Chem Soc. 2010;132:12331–12342. doi: 10.1021/ja101252n. [DOI] [PubMed] [Google Scholar]
  • 70.Monsen RC, et al. The hTERT core promoter forms three parallel G-quadruplexes. Nucleic Acids Res. 2020;48:5720–5734. doi: 10.1093/nar/gkaa107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Palumbo SL, et al. Formation of a unique end-to-end stacked pair of G-quadruplexes in the hTERT core promoter with implications for inhibition of telomerase by G-quadruplex-interactive ligands. J Am Chem Soc. 2009;131:10878–10891. doi: 10.1021/ja902281d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Grand CL, et al. The cationic porphyrin TMPyP4 down-regulates c-MYC and human telomerase reverse transcriptase expression and inhibits tumor growth in vivo. Mol Cancer Ther. 2002;1:565–573. [PubMed] [Google Scholar]
  • 73.Li P-T, et al. Expression of the human telomerase reverse transcriptase gene is modulated by quadruplex formation in its first exon due to DNA methylation. J Biol Chem. 2017;292:20859–20870. doi: 10.1074/jbc.M117.808022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Kang H-J, et al. A pharmacological chaperone molecule induces cancer cell death by restoring tertiary DNA structures in mutant hTERT promoters. J Am Chem Soc. 2016;138:13673–13692. doi: 10.1021/jacs.6b07598. [DOI] [PubMed] [Google Scholar]
  • 75.Savva L, Georgiades SN. Recent developments in small-molecule ligands of medicinal relevance for harnessing the anticancer potential of G-quadruplexes. Molecules. 2021;26:841. doi: 10.3390/molecules26040841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Sengupta A, et al. Non-duplex G-quadruplex DNA structure: A developing story from predicted sequences to DNA structure-dependent epigenetics and beyond. Acc Chem Res. 2021;54:46–56. doi: 10.1021/acs.accounts.0c00431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Song JH, et al. Small-molecule-targeting hairpin loop of hTERT promoter G-quadruplex induces cancer cell death. Cell Chem Biol. 2019;26:1110–1121.:e4. doi: 10.1016/j.chembiol.2019.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Valentijn LJ, et al. TERT rearrangements are frequent in neuroblastoma and identify aggressive tumors. Nat Genet. 2015;47:1411–1414. doi: 10.1038/ng.3438. [DOI] [PubMed] [Google Scholar]
  • 79.Kotla S, et al. Endothelial senescence is induced by phosphorylation and nuclear export of telomeric repeat binding factor 2-interacting protein. JCI Insight. 2019;4:124867. doi: 10.1172/jci.insight.124867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Teo H, et al. Telomere-independent Rap1 is an IKK adaptor and regulates NF-KB-dependent gene expression. Nat Cell Biol. 2010;12:758–767. doi: 10.1038/ncb2080. [DOI] [PubMed] [Google Scholar]
  • 81.Rowland TJ, et al. Allele-specific proximal promoter hypomethylation of the telomerase reverse transcriptase gene (TERT) associates with TERT expression in multiple cancers. Mol Oncol. 2020;14:2358–2374. doi: 10.1002/1878-0261.12786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Mukherjee AK, et al. Non-duplex G-quadruplex structures emerge as mediators of epigenetic modifications. Trends Genet. 2019;35:129–144. doi: 10.1016/j.tig.2018.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Mao S-Q, et al. DNA G-quadruplex structures mold the DNA methylome. Nat Struct Mol Biol. 2018;25:951–957. doi: 10.1038/s41594-018-0131-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Hou Y, et al. Integrative characterization of G-quadruplexes in the three-dimensional chromatin structure. Epigenetics. 2019;14:894–911. doi: 10.1080/15592294.2019.1621140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Miglietta G, et al. Correction to article ‘G-quadruplex-R-loop interactions and the mechanism of anticancer G-quadruplex binders. Nucleic Acids Res. 2021;49:6000–6001. doi: 10.1093/nar/gkab483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Li L, et al. YY1 interacts with guanine quadruplexes to regulate DNA looping and gene expression. Nat Chem Biol. 2021;17:161–168. doi: 10.1038/s41589-020-00695-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Kim W, Shay JW. Long-range telomere regulation of gene expression: telomere looping and telomere position effect over long distances (TPE-OLD) Differentiation. 2018;99:1–9. doi: 10.1016/j.diff.2017.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Mukherjee AK, et al. Telomere length-dependent transcription and epigenetic modifications in promoters remote from telomere ends. PLoS Genet. 2018;14:e1007782. doi: 10.1371/journal.pgen.1007782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Mukherjee AK, et al. Telomere repeat-binding factor 2 binds extensively to extra-telomeric G-quadruplexes and regulates the epigenetic status of several gene promoters. J Biol Chem. 2019;294:17709–17722. doi: 10.1074/jbc.RA119.008687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Ozturk MB, et al. Current insights to regulation and role of telomerase in human diseases. Antioxidants (Basel) 2017;6:E17. doi: 10.3390/antiox6010017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Akincilar SC, et al. Non-canonical roles of canonical telomere binding proteins in cancers. Cell Mol Life Sci. 2021;78:4235–4257. doi: 10.1007/s00018-021-03783-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Martínez P, Blasco MA. Telomeric and extra-telomeric roles for telomerase and the telomere-binding proteins. Nt Rev Cancer. 2011;11:161–176. doi: 10.1038/nrc3025. [DOI] [PubMed] [Google Scholar]
  • 93.Park J-I, et al. Telomerase modulates Wnt signalling by association with target gene chromatin. Nature. 2009;460:66–72. doi: 10.1038/nature08137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Ding D, et al. Human telomerase reverse transcriptase regulates MMP expression independently of telomerase activity via NF-KB-dependent transcription. FASEB J. 2013;27:4375–4383. doi: 10.1096/fj.13-230904. [DOI] [PubMed] [Google Scholar]
  • 95.Ghosh A, et al. Telomerase directly regulates NF-KB-dependent transcription. Nat Cell Biol. 2012;14:1270–1281. doi: 10.1038/ncb2621. [DOI] [PubMed] [Google Scholar]

RESOURCES