Skip to main content
UKPMC Funders Author Manuscripts logoLink to UKPMC Funders Author Manuscripts
. Author manuscript; available in PMC: 2024 Jun 1.
Published in final edited form as: Cancer Immunol Res. 2023 Nov 7;11(12):1611–1629. doi: 10.1158/2326-6066.CIR-22-0606

A metabolic gene survey pinpoints fucosylation as a key pathway underlying the suppressive function of regulatory T cells in cancer

Sotiria Pinioti 1,2, Himal Sharma 1,2, Nina C Flerin 1,2, Qian Yu 3, Amalia Tzoumpa 1,2, Sarah Trusso Cafarello 1,2, Elien De Bousser 4,5, Nico Callewaert 4,5, Guillaume Oldenhove 6,7, Susan Schlenner 8, Bernard Thienpont 3, Abhishek D Garg 9, Mario Di Matteo 1,2, Massimiliano Mazzone 1,2,*
PMCID: PMC7615342  EMSID: EMS190759  PMID: 37933083

Abstract

Forkhead box P3 (Foxp3)-expressing regulatory T cells (Tregs) are the guardians of controlled immune reactions and prevent the development of autoimmune diseases. However, in the tumor context, their increased number suppresses antitumor immune responses, indicating the importance of understanding the mechanisms behind their function and stability. Metabolic reprogramming can affect Foxp3 regulation and, therefore, Treg suppressive function and fitness. Here, we performed a metabolic CRISPR/Cas9 screen and pinpointed novel candidate positive and negative metabolic regulators of Foxp3. Among the positive regulators, we revealed that targeting the GDP-fucose transporter Slc35c1, and more broadly fucosylation, in Tregs compromises their proliferation and suppressive function both in vitro and In vivo, leading to alteration of the tumor microenvironment (TME) and impaired tumor progression and pro-tumoral immune responses. Pharmacologic inhibition of fucosylation dampened tumor immunosuppression mostly by targeting Tregs, thus, resulting in reduced tumor growth. In order to substantiate these findings in humans, tumoral Tregs from colorectal cancer (CRC) patients were clustered based on the expression of fucosylation (Fuco)-related genes. FucoLOW Tregs were found to exhibit a more immunogenic profile compared to FucoHIGH Tregs. Furthermore, an enrichment of a FucoLOW signature, mainly derived from Tregs, correlated with better prognosis and response to immune checkpoint blockade in melanoma patients. In conclusion, Slc35c1-dependent fucosylation is able to regulate the suppressive function of Tregs, and measuring its expression in Tregs might pave the way towards a useful biomarker model for cancer patients.

Keywords: regulatory T cells, CRISPR/Cas9 screen, Foxp3, Slc35c1, fucosylation

Introduction

The physiological role of regulatory T cells (Tregs) in the immune system is to suppress the immune response to self-antigens and prevent excessive immune reactions [1]. However, Tregs are increased in the tumor and in the blood of cancer patients, and a higher number of Tregs has been correlated with poor prognosis in various tumor types [2,3]. The importance of Tregs in both cancer and autoimmunity has led to increased interest in targeting these cells in order to improve disease outcomes.

Tregs mainly originate from the thymus, but a subset of Tregs also develops in the periphery from CD4+ T cells upon exposure to environmental stimuli, such as in the tumor. In vitro-induced Tregs (iTregs) can be generated from naïve CD4+ T cells exposed to IL2 and TGFβ. Tregs are characterized by the expression of the lineage-specific transcription factor Foxp3, which is crucial for their maturation and suppressive function [4]. Other molecules are also important for Tregs to exert their suppressive function, such as efficient TCR stimulation, CTLA-4, PD-1, CD39, and CD73 expression, secretion of inhibitory cytokines, and others [5]. However, Tregs under certain conditions, can lose their suppressive functions, which can be accompanied by reduction or loss of Foxp3 expression, known as “unstable” Tregs, or by maintenance of Foxp3 expression, known as “fragile” Tregs [6]. Remarkably, Tregs’ suppressive activity has been associated with their metabolism [7]. Indeed, intracellular metabolism of Tregs affects Foxp3 expression and Treg stability [8–10]. Vice versa, Foxp3 expression can alter Treg metabolism by impairing glycolysis and promoting oxidative phosphorylation [11]. Despite these and other significant efforts in understanding the metabolic needs of Tregs in cancer and autoimmune diseases [8–12], a broad study of the metabolic factors regulating Treg functionality is currently missing. Here, to study the connection between the metabolism of Tregs, the maintenance of Foxp3 expression, and their stability, we performed an in vitro CRISPR/Cas9 metabolic screen in Tregs, followed by the validation of the main target, Slc35c1, both in mice and humans.

Materials and methods

Cell lines

HEK293 cells were provided from ATCC (cat. number CRL-1573) in 2018, and MC38 and CT26 cells were provided from Kerafast (cat. number ENH204-FP) in 2016. For the generation of CD90.1+ CT26 cells was used the plasmid LentiGuideThy1.1 (Addgene, 128063) containing the non-targeting sequence (5’ GAACAGTCGCGTTTGCGACT 3’). CT26 cells were transduced with lentivirus and the CD90.1+ CT26 cells were FACS sorted 7 days upon transduction and used for the In vivo experiments. HEK293 and MC38 cells were cultured in DMEM (Gibco Thermo Fischer Scientific, 41965039) supplemented with 10% heat-inactivated FBS (Biowest, S1810), 100 U/mL penicillin, 100 μg/mL streptomycin (Gibco Thermo Fischer Scientific, 15140122), and 2 mmol/L glutamine (Gibco Thermo Fischer Scientific, 25030024). CT26 and CD90.1+ CT26 cells were cultured in RPMI 1640 (Gibco, Thermo Fischer Scientific, 21875034) supplemented with 10% heat-inactivated FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. All cells were frozen between passage 4 and 6 after purchase. Cells were cultured at 37°C and 5% CO2. All the cell lines were passaged in the laboratory for no longer than 10 passages after receipt and tested for Mycoplasma by PlasmoTest-Mycoplasma Detection kit (InvivoGen) every 6 months.

Animal experiments

C57BL/6J females were provided from the internal stock of KU Leuven, Balb/c females were obtained from Charles River, and C57BL/6J Rosa26-Cas9 (B6J.129(Cg)-Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP)Fezh/J) mice were obtained from the Jackson Laboratory. Rosa26-Cas9 mice were crossed with Ly5.1+ mice for use in In vivo suppressive assays as described below. Ly5.1+ Foxp3Thy1.1 and Ly5.1/2+ Foxp3Thy1.1 mice were provided from the lab of Prof. Susan Schlenner (KU Leuven-University of Leuven, Department of Microbiology, Immunology and Transplantation, Leuven B3000, Belgium) [13], and Pdcd1-/- mice were provided by Prof. Oldenhove (Laboratory of Immunobiology, Université Libre de Bruxelles, Gosselies, Belgium). Rag2-/- (C57BL/6N-Rag2Tm1/CipheRj) mice were obtained from Janvier labs.

Euthanasia was performed by cervical dislocation. Housing and all the experimental animal procedures were approved by the Animal Ethics Committee of the KU Leuven (ECD number 226/2017 and 102/2021).

Naïve CD4+ T-cell isolation

Total lymphocytes were isolated from spleen, inguinal, and axillary lymph nodes from naïve Rosa26-Cas9 or C57BL/6J mice depending on the experiment. Spleens were processed on a 40-μm pore-sized strainer in sterile PBS, and cells were centrifuged for 5 minutes at 400 x g. Red blood cell lysis was performed by using Hybri-Max (Sigma-Aldrich, R7757) and cells derived from spleens and lymph nodes were mixed. Naïve CD4+ T cells were isolated using a naïve CD4+ T-cell negative selection kit (Stemcell Technologies, 19765) with the use of EasySep magnets according to the manufacturer’s instructions, and the purity was > 92% checked by FACS. For naïve CD4+ T-cell activation, 24-well plates were pre-coated with 2 μg/mL anti-CD3 and 5 μg/mL anti-CD28 (BD Biosciences, 557393) for 2h at 37°C and then washed 1X with 1 mL PBS per well. The anti-CD3 was made in-house (clone 125-2C11), purified according to standard procedures for IgG purification, and subsequently treated with LPS removal beads, followed by performing a LAL assay (Cambrex) to confirm it was LPS-free (kindly provided by Prof. Stijlemans; Lab of Cellular and Molecular Immunology, Vrije Universiteit Brussel, Belgium). Naïve CD4+ T cells were resuspended and seeded at 0.5 million/mL in T-cell medium [RPMI 1640 supplemented with 10% heat-inactivated FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, 25 μmol/L β-mercapto-ethanol (Gibco, Thermo Fisher Scientific, 60-24-2), 1% MEM non-essential amino acids (NEAA, Gibco, Thermo Fisher Scientific 11140035), and 1 mmol/L sodium pyruvate (Gibco, Thermo Fisher Scientific, 11360070)]. For iTreg induction, naïve CD4+ T cells were cultured in the presence of murine recombinant IL2 (Peprotech, 212-12) at final concentration 20 ng/mL and human recombinant TGFβ (R&D systems, 7754-BH-005/CF) at 5 ng/mL for 3-5 days.

In vivo Treg isolation

In vivo Tregs were isolated from spleens and lymph nodes of 6-8 weeks old naïve female C57BL6/J, Rosa26-Cas9, Ly5.1+ Foxp3Thy1.1, Ly5.1/2+ Foxp3Thy1.1, and Pdcd1-/- mice, depending on the experiment as previously mentioned. When high numbers of Tregs were needed, their number was expanding In vivo upon intraperitoneal injection of the complex: anti-mouse IL2 (clone: JES6-1A12, Biolegend, 503706) with murine IL2. Briefly, for each mouse 20 μg of IL2 was mixed with 10 μg of the anti-mouse IL2, and the complex was incubated for 30 minutes at 37°C and then injected intraperitoneally to the mice. The injection was repeated for 3 constitutive days followed by 2 days of non-injection and then the mice were sacrificed [14]. Cells from spleens and lymph nodes were dissociated as stated above. Cells were resuspended in 1X Mojosort buffer (Biolegend, 480017), followed CD4+ T cell negative selection with the use of the Mouse CD4+ T-cell isolation kit (Mojosort, 480033) and Mojosort magnets with purity > 95% checked by FACS. Then Tregs were sorted as live CD4+CD25high or CD4+Thy1.1+ [(fixable viability dye efluor 506, CD4 PerCpCy5.5, CD25 PE, CD90.1 APC-Cy7)] depending on the mice used, using a BD FACS Aria II or BD FACS Aria Fusion. In vivo-derived sorted Tregs were seeded at 1 million/mL into 24-well plates and activated with anti-CD3/CD28-coated Dynabeads (Thermo Fischer Scientific, 11453D) at a ratio 3:1 beads to cells for 3 days in the presence of human IL2 (Peprotech, 200-02) at final concentration of 2000 Units/mL.

Lentiviral sgRNA library construction

For perturbing the metabolism of Tregs, we used a library of 10,640 optimized single-guide (sg)RNAs targeting 2,078 metabolism genes (5 sgRNAs per gene), including 46 essential and 41 non-essential control genes plus 250 non-targeting control sequences [15,16]. The library was generated by integrating the metabolic genes from the Kyoto Encyclopedia of Genes and Genomes (KEGG) with previously published high-quality reconstructions of mouse metabolism [17]. The corresponding sgRNAs were designed according to previously published criteria (CRISPick genetic perturbation platform, Broad Institute) [17], synthesized as 79-mer oligo pools (CustomArray, Bothell, WA), and amplified by PCR. Using a one-step digestion (Esp3I) and ligation reaction, the purified library PCR pool was then cloned into lentiGuide-Thy1.1 (Addgene, 128063), which co-expressed the congenic marker CD90.1 along with a single-guide RNA. The ligation reactions were purified and transformed into Endura ElectroCompetent cells (Biosearchtech, 602420) ensuring a proper library representation. To confirm library representation and distribution, the pDNA was sequenced by Illumina HiSeq. After mapping of Illumina reads, we calculated the overall fraction of reads that contained intended sgRNAs, which served as a surrogate for the quality of the oligonucleotide synthesis. The pooled plasmid library was then used to produce lentiviral particles according to standard procedures, as described below. The library we produced has been reported by another lab for different purposes [18].

Lentiviral vector production

HEK293 cells were seeded in 150 mm dishes at 9 million cells/dish in DMEM supplemented with 10% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, and 1% GlutaMax (Gibco, Thermo Fisher Scientific, 35050061). One day later, the medium was changed to IMDM (Gibco, Thermo Fisher Scientific, 12440053) supplemented with 10% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin, and 1% GlutaMax, and each dish was transfected with 7 μg of envelop plasmid pMD2 VSV_G (Addgene, 12259), 16.25 μg packaging plasmid psPAX2 (Addgene, 12260), and 32 μg of sgRNA transfer plasmid. A lentiGuide-Thy1.1 vector was used containing the Slc35c1_s_08724 sgRNA (5’ GCAGTGAGGTCACCAGGCAT 3’) or the non-targeting control sgRNA (5’ GAACAGTCGCGTTTGCGACT 3’). Cell culture media was replenished 16 hours after transfection with fresh IMDM complete media supplemented with 10 mM sodium butyrate (Merck, 303410). The lentiviral supernatant was collected 48 and 72h post transfection and was concentrated with ultracentrifugation (ultracentrifuge: OPTIMA, XPN-80 and 50.2 Ti Rotor) at 302000 x g for 30 minutes at 4°C and titrated in HEK293 cells.

Retroviral vector production

HEK293 cells were seeded in 150 mm dishes at 13.5 million cells/dish in RPMI supplemented with 10% FBS. The day after, the medium was replaced, and the cells were transfected using Genejuice Transfection reagent (Merch Millipore, 70967-4) with 10 μg sgRNA transfer plasmid and 10 μg of ecopac packaging plasmid (Addgene, 12371) per dish. The following morning, the medium was refreshed. 48 and 72h post-transfection, the cell supernatant was collected and concentrated 20X using Sartorius Vivaspin concentrators (VS2012) and centrifugation. For the Pdcd1 reconstitution of Pdcd1-/- Tregs, the PD-1 GFP wild-type (WT) and PD-1 GFP N49Q/N74Q double-mutant constructs were kindly offered by Prof. Yoshimura (Department of Microbiology and Immunology, Keio University, Japan) and generated as described in a previous publication without any modification [19].

Treg transduction

For Treg lentiviral transduction, iTregs or In vivo-derived Tregs were seeded in 24-well plates at 0.5 million cells/well, and lentivirus with 1 μg/mL protamine sulfate (Sigma-Aldrich, P3369) was added to the top of each well. The plate was centrifuged for 1h at 1000 x g at room temperature and incubated overnight at 37°C. The day after transduction, the cells were collected, and the T-cell medium with IL2 was refreshed. Transduced cells were sorted 3-4 days post transduction as live CD90.1+ cells as previously described and used for experiments. For Pdcd1-/- Treg retroviral transduction, the same process was followed, except that 2 μg/mL polybrene (Sigma-Aldrich, H9268) was used instead of protamine sulfate.

PD-1 reconstitution

Tregs were sorted from spleens and lymph nodes of naïve 6-8 weeks old Pdcd1-/- female mice and cultured as previously described. 24 hours post activation, cells were transduced with the retroviral vector encoding PD-1 fused to GFP (PD-1 WT) or PD-1 N49Q/N74Q double-mutant fused to GFP (PD-1 mutant, referred as PD-1 MUT) construct. The day after transduction, medium was refreshed, and 72h post transduction, PD-1 WT and PD-1-mutant Tregs were cultured with 130 μM 2-peracetyl fucose (2FF, Sigma-Aldrich, 344827) or control DMSO (Sigma-Aldrich, D2438) for 3 days. PD-1-reconstituted Tregs were sorted as live (viability efluor 506, CD4 PerCpCy5.5, CD90.1 APC-Cy7 and endogenous GFP) using a BD FACS Aria II. Sorted GFP+ Tregs with purity > 95% and used for In vivo suppression assays as described.

CRISPR/Cas9 screening

Naïve CD4+ T cells were isolated from spleen and lymph nodes of 6-8 weeks old Rosa26-Cas9 female or male mice and induced into iTregs as described previously. Five days after polarization, enrichment of the polarized cells was performed using a CD4+CD25+ Tregs enrichment kit (CD4+CD25+ Regulatory T cell isolation kit, Miltenyi, 130-091-041), and the purity of the population was confirmed by flow cytometry staining for Foxp3 (Invitrogen, 17-5773-80). iTregs were transduced with the lentiviral library as described, and a multiplicity of infection (MOI) reaching approximately 30% of transduction was used to guarantee that each cell was carrying a single gRNA. The percentage of transduction was checked by flow cytometry with the use of anti-CD90.1 (Biolegend, 202520 or 202524). The number of infected cells was carefully estimated to maintain a library complexity ≥ 500X. Five days after transduction, the cells were stimulated with a stimulation cocktail (Thermo Fischer Scientific, 00497003) and Brefeldin A (BioLegend, 420601) for 4h at 37°C. After the incubation, cells were washed with FACS buffer and surface-stained for viability (Thermo Fisher Scientific, 65-0866-14), CD4 (BioLegend, 100540), CD90.1 (Biolegend, 202520), followed by fixation and permeabilization with the eBioscience Foxp3/Transcription Factor Fixation/Permeabilization kit (Thermo Fischer Scientific, 00-5521-00B) according to the manufacturer’s instructions. Cells were incubated overnight at 4°C with intracellular antibodies Foxp3 (Invitrogen, 17-5773-80) and IFNγ (Invitrogen, 25-7311-41) in 1X permeabilization buffer. Cells were isolated using FACS by gating as live, CD4+, CD90.1+, Foxp3high or Foxp3low, and IFNγ+ or IFNγ-. The pellets of sorted cells were frozen at -20°C until the gDNA extraction was performed. The CRISPR/Cas9 screening was performed twice to achieve a sufficient number of reads. For each repetition, 1 million cells from each of the 2 populations, Foxp3high and Foxp3low, were analyzed.

gDNA extraction and preparation for Next-Generation Sequencing

For gDNA extraction, the DNeasy Blood & Tissue kit (Qiagen, 69506) was used, following the manufacturer’s instructions. The extracted DNA was resuspended in ddH2O and measured by Nanodrop. We then performed PCR of gDNA to attach sequencing adaptors and barcode samples. For the amplification of all the samples was used a common mix of P5 primers and a P7 primer with unique barcode for each sample (Supplementary table 1). For each sample, the gDNA was split into multiple 25 μL PCR reactions containing a maximum of 1 μg gDNA. PCR mixture per reaction: 12.5 μL KAPA HiFi HotStart ReadyMix PCR kit (Kapa Biosystems, KK2602), 1 μL of P5 stagger primer mix (stock at 10 μM concentration), 1 μL of a uniquely barcoded P7 primer (stock at 10 μM concentration), adding mQ water and gDNA input (max 1 μg per reaction) to 25 μL P5 and P7 primers were synthesized at Integrated DNA Technologies (IDT). The PCR cycling conditions were as follow: 98°C for 2 minutes (initial denaturation); 5 cycles of 98°C for 30 sec (denaturation), 60°C for 30 sec (annealing), and 72°C for 30 sec (extension); 25 cycles of 98°C for 30 sec (denaturation), 65°C for 30 sec (annealing), and 72°C for 30 sec (extension); and a final extension of 72°C for 5 minutes. An average of 15 PCR reactions per sample was performed, and the pooled PCR products were purified with Agencourt AMPure XP SPRI beads according to manufacturer’s instructions (Beckman Coulter, A63881).

Next-Generation Sequencing (NGS)

The purified PCR fragments were quantified with the QC Qubit DNA High Sensitivity kit, and samples were equimolarly pooled and subjected to Illumina next-generation sequencing by an Illumina NextSeq500 instrument following these parameters: High Output v2, 75bp, Single Reads, 1.1 pM + 34.1% PhiX. Mapped read-counts were subsequently used as input for the MAGeCK analysis software package.

Data analysis of CRISPR/Cas9 screen

MAGeCK-VISPR (version 0.5.3) was used to process CRISPR/Cas9 screen NGS data [20]. The MAGeCK ‘count’ module generated a raw count table with sgRNA as rows and samples as columns. This table was normalized by 250 non-targeting control guides, and corrected for batch effects by Combat [21,22]. The MAGeCK ‘test’ module used all Foxp3high samples as treatment and Foxp3low as control, and the robust ranking aggregation (RRA) algorithm to perform positive and negative selection. Log2 fold-change (LFC) for each gene was calculated as the median LFC of the 5 sgRNAs. Gene LFCs were further centered and scaled to LFC z-scores by R (version 3.6.2), which were used together with P values for positive and negative selections to select regulators and to generate plots shown in Fig. 1. Quality control, gene level, and sgRNA level positive and negative selection results can be found in Supplementary Fig. S1. Samples derived from females or males were pooled bioinformatically. Also, Foxp3highIFNγ+, Foxp3highIFNγ- were bioinformatically pooled as Foxp3high and Foxp3lowIFNγ+, Foxp3lowIFNγ- were bioinformatically pooled as Foxp3low.

Figure 1. CRISPR/Cas9 metabolic screen on in v/tro-induced Tregs.

Figure 1

A,Schematic workflow of the screening. Naïve CD4+ T cells were isolated from Rosa26-Cas9 mice and polarized to Tregs with the use of IL2 and TGFβ for 5 days. At day 5 after polarization Tregs were isolated as CD4+CD25+ T cells and transduced with the lentiviral sgRNA metabolic library. Transduced cells were sorted in 2 populations: Foxp3high and Foxp3low. B, Polarization efficiency and purity after enrichment for Tregs (5 days after isolation), gated for CD25 and Foxp3. C, For the screening we used MOI that leads to transduction efficiency of < 30% indicated by the percentage of CD90.1 congenic marker. D, Percentage of Foxp3 expression 5 days after transduction with sgNT and with the library. E, Volcano plot showing regulators of Foxp3 expression identified in the screening. Genes with p-value < 0.05 and z-score LFC < -0.5, are annotated as “Positive regulators”. Genes with p-value < 0.05 and z-score LFC > 0.5, are annotated as “Negative regulators”. F, Distribution of the 5 sgRNAs per gene and Log2Fold Change of each sgRNA. In blue are the sgRNAs that are enriched in the Foxp3 negative population (genes are positive regulators of Foxp3) and in red are the sgRNAs that are enriched in the Foxp3 positive population (genes are negative regulators of Foxp3). Figure 1D is representative of three independent experiments.

Electroporation

The validation of the screening was performed with the use of electroporation [23]. CRISPR-Cas9 RNAs (crRNAs) and trans-activating crRNAs (tracrRNAs, IDT, 1072534) were synthesized by IDT. Lyophilized RNA was resuspended in Nuclease-Free Duplex Buffer (IDT, 11-01-03-01) in final concentration 100 μM. The 2 RNA oligos (crRNA and tracrRNA) were mixed at equimolar concentrations to a final duplex concentration 50 μM and annealed at 95°C 5 minutes, 90°C 2 minutes, 85°C 2 minutes, 80°C 2 minutes, 75°C 2 minutes, 70°C 2 minutes, 65°C 2 minutes, 60°C 2 minutes, 55°C 2 minutes, 50°C 2 minutes, 45°C 2 minutes, 40°C 2 minutes, 35°C 2 minutes, 30°C 2 minutes, 25°C infinite in a Doppio Gradient Thermocycler (VWR, 31141-01A00037). The crRNA:tracrRNA duplex was mixed with cas9 enzyme (IDT, 1081059) at 3:1 duplex:cas9 ratio in order to form the ribonucleoprotein complex for 10-20 min at room temperature. As negative control was used the CRISPR-Cas9 Negative control crRNA (IDT, 04204645). iTregs were electroporated 3 days after stimulation and polarization from naïve CD4+ T cells. Five million Tregs were resuspended in 100 μL of Lonza electroporation buffer in P4 primary (Lonza, V4XP-4024) per cuvette on the Lonza 4D Nucleofector System system with pulse code CM137. Immediately after electroporation, cells were resuspended in T-cell medium supplemented with 20 ng/mL IL2. The day after, T-cell medium and IL2 were refreshed, and cells were seeded in 24-well plates at 0.5 million cells/mL per well. The gRNA sequences used for electroporation are listed at Supplementary table S1.

RNA extraction, reverse transcription, and real-time quantitative PCR (RT-qPCR)

RNA was extracted using the RNeasy Micro kit (Qiagen, 74004) according to the manufacturer’s instructions. Reverse transcription was performed with the Superscript III First Strand cDNA Synthesis Kit (Life Technologies, 18080051) in a Doppio Gradient Thermocycler (VWR, 31141-01A00037) according to the manufacturer’s instructions. cDNA, primers, and Power Up SYBR Green Master Mix (Thermo Fischer Scientific, A25780) were prepared in a volume of 20 μL. Samples were loaded into an optical 96-well Fast Thermal Cycling Plate, and RT-qPCR was performed using a QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems). Samples were run in technical duplicates. Data was normalized to housekeeping gene expression for β-actin. The probes used for PCR are listed in Supplementary Table S1.

In vivo suppression assay in a tumor model

In vivo Tregs were isolated from spleen and lymph nodes of 6-8 weeks old naïve female Rosa26-Cas9 mice. Tregs were transduced by lentivirus expressing the control sequence (sgNT) or sgSlc35c1. Four days upon transduction, transduced Tregs (CD90.1+) were sorted. cas9+CD45.1+CD4+CD25- cells were isolated from spleen and lymph nodes of Ly5.1+ Rosa26-cas9 female mice with the use of the CD4+CD25+ Treg isolation kit as the CD4+CD25- fraction (Miltenyi, 130-091-041). Cas9+CD8+ T cells were isolated from spleen and lymph nodes of Rosa26-cas9 female mice with the use of the Mouse CD8+ T Cell Isolation kit (Mojosort, 480008). 0.5 million Tregs, with 1 million cas9+CD45.1+CD4+CD25- cells and 0.5 million cas9+CD8+ T cells, were resuspended in final volume 200 μL PBS and transferred by tail vein injection in each Rag2-/- mouse. The purity of the injected cells after isolation was tested by flow cytometry and was > 95%. In the mixed cell model, the two subtypes of Tregs, sgNT and sgSlc35c1, were mixed in ratio 50:50 in order to maintain that total amount at 0.5 million Tregs. The day after adoptive cell transfer (ACT), each mouse was injected subcutaneously on the right flank with 0.5 million MC38 cells resuspended in 100 μL PBS. The tumor volume was measured 3 times per week by electronic calipers, and tumor volume was calculated with the formula V= π x (d2 x D)/6, where d is the minor tumor axis and D is the major tumor axis. 17 days after tumor injection, mice were sacrificed, and tumors and spleens were weighted and collected for immune phenotyping by flow cytometry. Isolated cells were stimulated with cell stimulation cocktail (Thermo Fischer Scientific, 00497003) and incubated with Brefeldin A (BioLegend, 420601) for 4 hours at 37°C before staining as described below.

In vivo suppression assay with Tregs treated with a fucosylation inhibitor in a tumor model

To assess the effect of a fucosylation inhibitor on Tregs function, In vivo-derived Tregs from Ly5.2 Foxp3Thy1.1 mice were sorted as CD4+CD90.1+ (a Foxp3 reporter used here) and activated with anti-CD3/CD28-coated Dynabeads in the presence of IL2 and 2F-peracetyl-fucose at final concentration of 100 μM or DMSO as control for 6 days in total. At day 3, media was replenished with fresh media containing IL2 and 2FF or DMSO. At day 6, the cells were tested for lectin staining by flow cytometry as previously described. 1 million 2FF- or DMSO-treated Tregs were co-injected with 2 million CD45.1+CD4+CD25- cells and 1 million CD45.1+CD8+ T cells resuspended in 200 μL PBS by tail vein injection in each Rag2-/- mouse. CD45.1+CD4+CD25- and CD45.1+CD8+ T-cell were isolated as previously described. The purity of the injected cells after isolation was tested by flow cytometry and was > 95%. The following day, each mouse was injected subcutaneously with 0.5 million MC38 cells resuspended in 100 μL PBS, and the tumor growth was monitored as previously described. In the end-stage mice were sacrificed and tumors were collected for analysis by flow cytometry.

In vivo CT26 tumor model

8 weeks old Balb/c females were injected with 1 million CD90.1+ CT26 cells resuspended in 100 μL PBS subcutaneously in the right flank. When tumor size reached 150 mm3, mice were treated intraperitoneally with 1.25 mg/kg 2FF (Synchem, SC36700) or saline control twice per day until the end of the experiment. In the experiments where Tregs were depleted, at day 5 and day 7 after tumor injection, the mice were treated with 10 mg/kg anti-CD25 (Evitria, clone 7D4) [24] or control rat serum IgG (Sigma-Aldrich, I4131) via intraperitoneal injection, and at day 8 mice were treated with 2FF or saline twice per day until sacrifice. At the end stage, tumors were weighted and collected for flow cytometric analyses.

In vivo iTreg competition assays

Naïve CD4+ T cells were isolated from Ly5.1+ Foxp3Thy1.1 or from Ly5.1/2+ Foxp3Thy1.1 congenic mice and polarized into iTregs for 3 days as described. iTregs were electroporated with the control sequence or with an RNP targeting Slc35c1, and 4 days after electroporation, live, CD90.1+ (Foxp3 reporter) Tregs were sorted from each condition as previously indicated. Two million CD45.1+ and CD45.1/2+ sorted iTregs per condition were mixed in a 50:50 ratio and co-injected via tail vein injection in healthy Rag2-/- mice. The ratio of the two types of injected iTregs was checked by flow cytometry before injection. After 7 days, blood and spleen of the Rag2-/- mice were collected and analyzed by flow cytometry. Blood collection was performed in Eppendorf’s containing 10% heparin by retro-orbital bleeding. For the competition assay in MC38 tumor-bearing Rag2-/- mice, when tumors reached 100 mm3, two million sorted iTregs per condition were mixed in a 50:50 ratio and co-injected as described. Seven days after adoptive cell transfer, mice were sacrificed, and the tumors were processed for flow cytometric analysis.

Flow cytometry

Mice were sacrificed, and depending on the experiment, tumors and/or spleens were collected. Tumors were digested after incubation for 30 min at 37°C in a-minimum essential medium (MEM, Lonza BE12-169F) containing 1% penicillin/streptomycin, 5% FBS, 50 μM β-mercaptoethanol, 0.85 mg/mL Collagenase V (Sigma-Aldrich, C9263-1G), 1.25 mg/mL Collagenase D (Roche, 11 088 882 001), 1 mg/mL Dispase (Gibco, Thermo Fisher Scientific, 17105-041), and 5 U/mL DNase I (Roche, 10104159001). The digested tissues were filtered using a 70-μm pore-sized strainer, and cells were centrifuged for 5 min at 300 x g. Spleens were processed on a 40-μm pore-sized strainer in sterile PBS, and cells were centrifuged for 5 min at 300 x g. Red blood cell lysis was performed by using Hybri-Max (Sigma-Aldrich, R7757). For both tumor and spleen-derived single cells were resuspended in FACS Buffer [PBS containing 2% FBS and 2 nmol/L EDTA (Sigma-Aldrich, 03690)] and incubated for 15 min on ice with Fc Block anti-mouse CD16/32 (BD Pharmingen, 553142). Surface staining was performed for 30 min on ice. For intracellular staining, cells were fixed and permeabilized with the eBioscience Foxp3/Transcription Factor Fixation/Permeabilization kit (Thermo Fischer Scientific, 00-5521-00) according to the manufacturer’s instructions, and cells were incubated overnight at 4°C with the intracellular antibodies in 1X permeabilization buffer. Cells were subsequently washed and resuspended in FACS buffer before flow cytometric analysis on a Fortessa X-20. Data were analyzed by FlowJo (TreeStar, Version 10.7). Fluorescence Minus One (FMO) or isotype controls were utilized to ensure proper gating of positive populations. For lectin staining, cells were fixed with 4% paraformaldehyde (Sigma-Aldrich, 252549) for 20 minutes at room temperature and then stained with biotinylated Aleuria aurantia lectin (AAL, Vector Laboratories, B1395-1, 1:1000) for 30 min on ice. Cells were washed with lectin-binding buffer (PBS with 0.1 mM CaCl2) and stained with secondary antibody – Avidin, Neutravidin PE conjugate (Thermo Fisher Scientific, A2660). As a negative control for lectin staining, Tregs were incubated for 120 min at 37°C with 3 mg/mL fucosidase (house in-made, kindly provided by Prof. Callewaert, Department of Biochemistry and Microbiology, Ghent University, Belgium), followed by lectin staining. For the detection of MC38 tumor-specific CD8+ T cells, single-cell suspensions of tumors and spleens were stained with PE-conjugated H-2Kb MuLV p15E tetramer-KSPWFTTL (MBL, TB-M507-1) for 30 min, followed by extracellular staining, including anti-CD8 (clone KT15) compatible for co-staining with an MHC tetramer. Absolute number of cells was counted by flow cytometry with the use of Precision Count Beads (BioLegend, 424902). All the antibodies used are listed in Supplementary Table S2.

iTreg In vivo migration assay

Naïve CD4+ T cells were isolated from Ly5.1 + Foxp3Thy1.1 mice and polarized to iTregs for 3 days as described. iTregs were electroporated with the control sequence or with an RNP targeting Slc35c1, and 4 days after electroporation, live, CD90.1+ (Foxp3 reporter) Tregs were sorted from each condition. Sorted iTregs were labeled with either 3.5 μmol/L Cell Tracer Violet (CTV) (Thermo Fisher Scientific, C34557) or 1 μmol/L carboxyfluorescein diacetate succinimidyl ester (CFSE) (Thermo Fisher Scientific, C34570). For CFSE labeling, cells were stained in PBS for 8 min at room temperature. For CTV labeling, cells were stained for 20 min at 37°C. 2 million labeled sgNT iTregs were co-injected with 2 million labeled sgSlc35c1 iTregs by tail-vein injection in MC38 tumor-bearing (tumor size 100 mm3) Rag2-/- mice. After 20 hours spleen, and tumors were collected and analyzed by flow cytometry. Blood was also collected in Eppendorfs containing 10% heparin with capillary pipettes by retro-orbital bleeding. To exclude probe-specific effects, the fluorescent cell tracers were switched accordingly, and the ratio of the 2 types of iTregs injected was checked by flow cytometry before injection.

In vitro suppression assay

In vivo-derived Tregs were isolated from Rosa26-Cas9 mice, and cells were activated and transduced with lentivirus targeting sgNT or sgSlc35c1 as previously described. At day 4 after transduction, transduced cells (CD90.1+) were sorted and placed in round-bottom 96-well plate for co-culture with cas9+CD45.1+CD4+CD25- effector T cells labeled with CTV and Rag2-/- splenocytes in the presence of 1 μg/mL soluble anti-CD3 for 72h. For ratio 1:1 were used 105 Tregs with 105 CD4+ effector and 5*104 Rag2-/- splenocytes per well. The suppressive function of Tregs on CD4+ effector T cells was measured by flow cytometry as the serial dilution of CTV, which indicated proliferation of CD4+ effector T cells.

Cell proliferation assays

For the EdU proliferation assay, In vivo-derived Tregs were activated and transduced with lentivirus targeting sgNT or sgSlc35c1 as previously described. Four days after transduction, Tregs were cultured in the presence of 10 μM EdU for 16 hours. After 16 hours, cells were collected and first extracellularly staining, followed by the Click-iT EdU assay protocol (Thermo Fisher Scientific, C10419), as suggested by the manufacturer, and analyzed by flow cytometry. For the In vivo EdU proliferation assay in MC38 tumor-bearing mice, 0.5 million MC38 cells resuspended in 100 μL PBS were injected subcutaneously in Rag2-/- mice. 7 days upon tumor injection, 2 million CD45.1 sgNT or CD45.1/2 sgSlc35c1 iTregs were transferred in the tumor-bearing Rag2-/- mice by tail vein injection. Following, 7 days upon T cell transfer, mice were injected intraperitoneally with 50 mg/kg EdU and sacrificed 16 hours later. Blood, spleen and tumor were collected for analysis by flow cytometry. For the proliferation assay using Incucyte Live-Cell analysis system, In vivo-derived Tregs were transduced and sorted as specified previously. Followed, Tregs were seeded in non-treated 48-well plates, coated with 20 μg/mL RetroNectin (Takara Bio, T100B) and blocked with 2% BSA (Sigma-Aldrich, 9048-46-8) in PBS. Cell growth was monitored with an S3 Incucyte for 72h. The percent confluency of the cells was calculated as the confluency of the cells at 72 hours (t72) minus the confluency at 0 hours (t0).

Annexin V/propidium iodide apoptosis assay

In vivo-derived Tregs 4 days after transduction were collected, washed with 1X Annexin V Binding Buffer (Biolegend, 422201), followed by staining with Annexin V (Biolegend, 640941, 1:100) in the binding buffer. After 15 min at room temperature, 1 μL of propidium iodide (Sigma-Aldrich, P4864, stock 1 mg/mL) was added, and the samples were analyzed by flow cytometry.

Bioinformatic analyses of human cancer patient data

Single-cell RNA-seg data analyses

Colorectal cancer patient (n = 23) derived tumor single-cell expression data (normalized values with 5th and 95th percentile as min and max), accessed from a published dataset (GSE132465), was processed using a standardized and uniformized workflow (BBrowser v.3) as described elsewhere without modification [25,26]. Data was derived for pre-annotated regulatory CD4+ T cells (Treg) that passed default qualitative filters. Thereafter, a fucosylation signature (Fuco-signature) consisting of following genes: FUT1, FUT2, FUT3, FUT4, FUT5, FUT6, FUT7, FUT8, FUT9, FUT10, FUT11, POFUT1, POFUT2, GMDS, TSTA3, FUK, FPGT and SLC35C1, was used to create a sum-based metagene expression spectrum per Treg cell (974 Treg single-cells expressed this signature). The Fuco-metagene expression ranged from 0 to 16.3 units. Herein, we took a middle cut-off of 7.02 expression units to bifurcate total Tregs into Tregs with a high Fuco-signature (metagene expression > 7.02) or Tregs with a low Fuco-signature (metagene expression < 7.02). Thereafter, we carried out differential gene expression analyses between Fuco-signature, high vs. low, single-cell Treg using the built-in Differential Expression (DE) Dashboard function. This analysis was performed using the DESeq2 statistical method for deriving threshold-bound volcano plots. These gene hits were further used as input for the built-in Enrichment panel that was used for enrichment of REACTOME pathways using gene-set enrichment analyses (GSEA) methodology [27].

Survival analyses in TCGA melanoma dataset

Survival analysis was carried out using the top 30 most enriched genes within the Fuco-signature low Tregs in the TCGA melanoma dataset. We accessed overall survival (OS) and tumor gene expression profiles for skin cutaneous melanoma (SKCM) (n = 458) patients using the GEPIA2 work-flow [28], based on the UCSC Xena project (http://xena.ucsc.edu). Briefly, OS analysis was based on log-rank hypothesis test (the Mantel-Cox statistical test) that also estimated the Cox-proportional hazard ratio (HR) and the 95% confidence intervals, accompanied by a Kaplan-Meier (KM) plot. Herein, the expression threshold cut-off at a median signature expression level was used for splitting the patients into high-expression and low-expression sub-cohorts. Finally, the Fuco-signature was correlated (Pearson’s correlation) to signatures of various immune cells, fibrobl asts, endothelial cells, or melanocytic (cancer) cells derived from an existing study [29].

Survival analysis of immuno-oncology clinical trials

Patient survival analysis in immuno-oncology clinical trials was carried out using the above top 30 most enriched genes within the Fuco-signature low Tregs. We accessed tumor transcriptomic data from melanoma patients (at post-treatment) profiled after anti-CTLA-4 immunotherapy (n = 15) [30] or before anti-PD-1 immunotherapy (n = 41) [31]. These data and subsequent OS estimates were performed via TIDE-workflow as described elsewhere [32]. Herein, the prognostic effects were calculated as z-score deduced using the Coxph statistical model. These data were represented as Kaplan-Meier curves (at median expression cut-off).

Bulk human RNA-seq data analysis

Raw reads were downloaded from GEO under accession number GSE89225 [33], which included Tregs from peripheral blood mononuclear cells (treg_PBMC, n = 4), breast tumors (treg_tumor, n = 6), and normal breast parenchyma (treg_NBP, n = 6). Trimmomatic (v0.39) removed low-quality reads and trimmed adapters with default setting. STAR (v2.7.7a) was used to align reads to human genome hg38 and RSEM (v1.3.1) to estimate gene expression. R package DESeq2 (v1.26.0, R version 3.6.2) calculated normalized counts. GSVA (v1.34.0) performed single-sample GSEA analysis. Significant tests were performed by T-test. A Golgi fucosylation signature consisted of the following genes: FUT1, FUT2, FUT3, FUT4, FUT5, FUT6, FUT7, FUT8, FUT9, FUT10, FUT11, and SLC35C1.

Analysis of fucosyltransferases expression in Human Protein Atlas

Normalised mRNA expression of fucosyltransferases (Fut1, Fut2, Fut4, Fut7, Fut8, Fut9) was determined in Tregs sorted from the blood of 6 healthy human donors, 3 male and 3 female, by querying a previously published transcriptomic dataset [34]. The available data were normalized transcript expression values, and no additional data normalization was performed, nor were any additional expression thresholds applied. Data were plotted using the box plot function in R.

Statistical analysis

Data entry and all analyses were performed in a blinded fashion. All statistical analysis was performed using GraphPad Prism Software (Version 9.4.1). Pairwise comparisons on two experimental conditions were performed using unpaired or paired Student t-test analysis. Detection of mathematical outliers was performed with the use of Grubbs test in GraphPad. Grouped data were assessed by two-way ANOVA Sidak’s multiple comparisons test. Sample sizes for all experiments were used based on previous experience. Statistical details of each experiment are mention on the legends of each figure. All graphs show mean value ± SEM.

Results

A survey of metabolic genes in iTregs reveals novel regulators of Foxp3

To systemically identify metabolic genes affecting Foxp3 expression in iTregs, we implemented a pooled lentiviral CRISPR/Cas9 screening using a single-guide RNA (sgRNA) library targeting 2,005 metabolic genes. The library co-expressed the congenic marker CD90.1, which allowed an optimal tracing and enrichment of the transduced cells (Fig. 1A). Naïve CD4+ T cells were isolated from Rosa26-Cas9 mice and polarized to Tregs for 5 days, which showed a sustained expression of Foxp3 and CD25 (Fig. 1B). Thereafter, iTregs were transduced with the lentiviral sgRNA library. A multiplicity of infection (MOI) reaching approximately 30% of transduction was used to guarantee that most cells carried a single gRNA (Fig. 1C). Tregs were kept in culture for 5 additional days, a time point where a library-dependent perturbation of Foxp3 expression was evident compared to control iTregs (i.e., transduced with the non-targeting sgRNA, sgNT), thereby benchmarking the screening settings (Fig. 1D).

Transduced cells (CD90.1+) were sorted based on Foxp3 expression and IFNγ production into four populations: Foxp3highIFNγ+, Foxp3highIFNγ-, Foxp3lowIFNγ+, Foxp3lowIFNγ- (Supplementary Fig. S1A). Based on the library coverage obtained in each population, we focused on two populations: Foxp3low (bioinformatic pool of Foxp3lowIFNγ+, Foxp3lowIFNγ-) versus Foxp3high (bioinformatic pool of Foxp3highIFNγ+ and Foxp3highIFNγ-) iTregs (Supplementary Fig. S1B). Analysis of sgRNA abundance and distribution in each sorted population was performed with the MAGeCK bioinformatic pipeline to evaluate the quality of the screening (Supplementary Fig. S1C-F). After selecting a threshold of p-value < 0.05 and z-score Log2 fold-change (LFC) > 0.5 or LFC < -0.5, we identified 50 genes as negative regulators and 12 genes as positive regulators of Foxp3 expression (Fig. 1E-F).

Validation of screening hits and identification of Slc35c1 as a Foxp3 modulator

To validate our screening hits, we independently assessed the effects of knocking out the top regulators of Foxp3 expression via electroporation of the CRISPR/Cas9 RNP complex (Fig. 2A). First, we confirmed the gene-editing efficiency of the electroporation platform in iTregs using a sgRNA targeting Foxp3 (Fig. 2B). Silencing of all the top positive Foxp3 regulators from our screening (i.e., Slc35c1, Dck, Cyp3a13, A4galt, Duox1, Echs1, and Pla2g4c) (Supplementary Fig. S2A-G), and measurement of Foxp3 expression at the protein (Fig. 2C, Supplementary Fig. S2H) and/or transcript level (Fig. 2D), revealed that Foxp3 protein expression was significantly reduced upon silencing of Slc35c1, Dck, and A4galt only. Slc35c1 targeting was tested using two different crRNAs, and for the following experiments, guide #1 was used (Supplementary Fig. S2I). Among the negative regulators, we validated Pold3, Adss, and Gys2, confirming that genetic inactivation of any of these three targets led to increased Foxp3 expression at the protein level (Fig. 2C, Supplementary Fig. S2J). The top enriched positive regulator, based on the pre-defined statistical threshold, and the only regulator that significantly reduced Foxp3 expression at both RNA and protein levels was Slc35c1, a transporter that mediates GDP-fucose entry into the Golgi-lumen, providing substrates for fucosyltransferases [35]. Analysis of the expression of fucosyltransferases (from Human Protein Atlas) [34], represented in the metabolic library (Fut1, Fut2, Fut4, Fut7, Fut8, Fut9), showed that only Fut2, Fut4, Fut7, and Fut8 were expressed in human Tregs (Fig. 2E). All gRNAs against these fucosyltransferases (Fut2, Fut4, Fut7 and Fut8) were also identified as positive regulators of Foxp3 expression (Fig. 2F), disclosing a previously unknown role of fucosylation in Foxp3 maintenance. Comparison of the total levels of fucosylation (MFI AAL) in a murine CT26 model showed significantly higher fucosylation in tumor-infiltrating Tregs versus those isolated from the non-perfused spleen of the same mouse (Fig. 2G), likely rendering Slc35c1 as a safe target in the context of cancer biology.

Figure 2. Validation of the positive and negative regulators of Foxp3.

A,Schematic workflow of the individual CRISPR knockouts on iTregs with RNP electroporation. B, Efficiency of the Foxp3 targeting compared to control 7 days after electroporation by flow cytometry. C, Percentage of Foxp3 expression by flow cytometry on iTregs 7 days after electroporation of each of the targets. D, PCR on Foxp3 expression on iTregs 7 days after electroporation for each of the targets. E, Analysis of the expression levels of fucosyltransferases Fut1, Fut2, Fut4, Fut7-9 and the transporter Slc35c1 in Tregs derived from the Human Protein Atlas. F, Z-score of the enrichment or depletion of the gRNAs. In grey all the genes investigated in the screening (n = 2078), in orange the fucosyltransferases Fut2, Fut4, Fut7 and Fut8 and in red Slc35c1. With grey line shown the overall median and with orange line shown the median of the 4 FUTs. G, Total fucosylation levels (MFI AAL) in Tregs derived from spleen or tumor of CT26 tumor-bearing mice. H, Efficiency of the KO after Slc35c1 targeting on electroporated iTregs by PCR. I, Efficiency of the deletion after Slc35c1 targeting with lentiviral vector by PCR on In vivo-derived Tregs. In vitro data are the pooled data of least three independent experiments. ns, p > 0.05, * p ≤ 0.05, ** p ≤ 0.01 and *** p ≤ 0.001. All graphs show mean value ± SEM.

Figure 2

We focused on an upstream process of fucosyltransferases, the transport of GDP-fucose in the Golgi compartment, a process mainly controlled by Slc35c1. Despite some knowledge regarding the implications of Slc35c1 mutations in humans and mice [35–37], its role in Treg biology is largely unknown. Gene editing by electroporation or lentiviral vector transduction in Tregs resulted in 50-70% reduction of the Slc35c1 transcript (Fig. 2H-I). By using two different guides targeting Slc35c1 in electroporated Tregs and one independent guide targeting Slc35c1 in lentiviral vector-transduced Tregs, we confirmed that Slc35c1 deficiency reduced Foxp3 expression and increased IFNγ (Fig. 3A, Supplementary Fig. S3A-B). In addition, sgSlc35c1-Tregs had a significant decrease in CD25 mean fluorescent intensity (MFI), without affecting the expression of ICOS, TGFβl, and GITR (Fig. 3B). Moreover, surface or total staining of PD-1 revealed that Slc35c1 deficiency significantly reduced surface expression of PD-1 (Fig. 3C), without affecting its mRNA expression (Supplementary Fig. S3C), suggesting a post-transcriptional, fucosylation-dependent effect on PD-1 expression, as shown previously [19]. Also, Slc35c1 genetic targeting in Tregs reduced their suppressive capacity towards effector CD4+ T cells (Fig. 3D).

Figure 3. Slc35c1 deficiency compromises Foxp3 expression, suppressive function and competitive fitness of in vitro-induced and In vivo-derived Tregs.

Figure 3

A,Flow cytometry to assess the levels of Foxp3 and IFNγ expression 5 days after transduction for In vivo-derived sgSlc35c1 Tregs compared to sgNT Tregs. B, MFI of GITR, CD25, ICOS, TGFβ1 and PD-1 in In vivo-derived sgSlc35c1 and sgNT Tregs 5 days after transduction. C, Percentage of PD-1+ (out of Tregs), electroporated sgNT and sgSlc35c1 iTregs followed by PD-1 extracellular staining only or PD-1 extra- and intracellular staining. D, In vitro suppressive assay with sgNT or sgSlc35cl In vivo-derived Tregs cultured with CTV-labeled CD4+ effector T cells showing ratio 1:1. E, MFI of AAL on In vivo-derived sgNT or sgSlc35cl Tregs 4 days after transduction. F, Percentage of confluence of sgNT and sgSlc35cl Tregs at t72-t0 measured by Incucyte. G, Percentage of Annexin+ PI+ cells (late apoptosis) out of transduced In vivo-derived Tregs. H, Percentage of Annexin+ PI- cells (early apoptosis) out of transduced In vivo-derived Tregs. I, Percentage of CFSE+ or CTV+ iTregs found in the blood, spleen or tumor of the MC38 tumor-bearing Rag2-/- mice 20 hours upon Tregs transfer. J, Percentage of sgNT and sgSlc35cl iTregs derived from different congenic mice CD45.1 and CD45.1/2 found in the spleen of healthy Rag2-/- mice 7 days after Tregs transfer. K, Percentage of EdU+ sgNT and sgSlc35c1 iTregs in the MC38 tumor of Rag2-/- mice 7 days after Tregs transfer. L, Number of sgNT and sgSlc35c1 iTregs in the MC38 tumor of Rag2-/- mice 7 days after Tregs transfer. In vitro and In vivo data are the pooled data of at least three independent experiments. ns, p > 0.05, * p ≤ 0.05, ** p ≤ 0.01 and *** p ≤ 0.001.-All graphs show mean value ± SEM.

Mechanistically, Slc35c1 inactivation in Tregs led to reduced fucosylation, as indicated by AAL staining (Fig. 3E, Supplementary Fig. S3D). Also, Slc35c1 deletion led to reduced proliferation of iTregs in vitro (Fig. 3F, Supplementary Fig. S3E) without affecting their viability (Fig. 3G-H). Because fucosylation of different surface proteins is important for cell trafficking [38], we assessed if there was any difference in the recruitment of sgSlc35c1-iTregs. A 50:50 mix of sgNT- and sgSlc35c1-iTregs, labeled with CFSE or CTV (Supplementary Fig. S3F), was injected in MC38 tumor-bearing Rag2-/- mice, and the mice were sacrificed 20 hours after iTreg transfer. There were no differences in the number of sgNT- and sgSlc35c1-iTregs in the spleens and tumors (blood was used as experimental control tissue) (Fig. 3I), indicating that the deletion of Slc35c1 does not affect the trafficking of iTregs towards these tissue sites. However, when the experiment was performed at a later timepoint in healthy mice (sacrificed 7 days after CD45.1+ or CD45.1/2+ Foxp3Thy1.1 iTreg transfer; Supplementary Fig. S3G), fewer sgSlc35c1 cells were detected in the spleen of recipient Rag2-/- mice (Fig. 3J, Supplementary Fig. S3H-I). This suggested that Slc35c1 deletion conferred a proliferation disadvantage, as corroborated by the in vitro proliferation data (Fig. 3F, Supplementary Fig. S3E) and a decrease in the percentage of intratumoral EdU+ sgSlc35c1-iTregs at an early stage, i.e., day 7 after ACT (Fig. 3K). This reduction in EdU associated with a reduced total number of S/c35c1-deficient iTregs per tumor (Fig. 3L).

Slc35c1 deficiency impairs the suppressive function of In vivo-derived Tregs against effector CD4+ and CD8+ T cells, leading to reduced tumor growth

To test whether Tregs suppressive function could also be negated in the tumor microenvironment by ablating Slc35c1, we performed an In vivo suppression assay as previously described [39]. Sorted CD45.2+CD90.1+Cas9+ sgNT- or sgSlc35c1-Tregs were co-transferred with CD45.1+Cas9+CD4+CD25- and CD8+ T cells in Rag2-/- mice, followed by MC38 cell injection. In line with the reduced suppressive function of sgSlc35c1-iTregs in vitro, growth of MC38 tumors was significantly inhibited in mice that received sgSlc35c1-Tregs compared to the mice that received sgNT-Tregs (Fig. 4A-B). Also, CD4+ and CD8+ T-cell accumulation was higher in mice injected with sgSlc35c1-Tregs, and CD4+ T cells were able to produce more IFNγ compared to the sgNT-Treg group (Fig. 4C-F). Because the effect of sgSlc35c1-Tregs on IFNγ production was stronger for CD4+ T cells compared to CD8+ T cells, we checked the representation of tumor antigen-specific TCRs in CD8+ T cells with using a KSPWFTTL-H-2Kb tetramer. Although there was no difference in cell number (Supplementary Fig. S4A), tumor antigen-specific CD8+ T cells produced higher IFNγ in the sgSlc35c1 group (Fig. 4G-H). Thus, deletion of Slc35c1 reduced the suppressive function of In vivo-derived Tregs and restored anti-tumor immunity. Functionally, sgSlc35c1-Tregs exhibited a lower Foxp3 and slightly higher IFNγ expression compared to sgNT-Tregs (Fig. 4I-M), confirming the impaired Treg phenotype observed in vitro. A 50:50 mix of sgNT- and sgSlc35c1-Tregs was injected in Rag2-/- mice in the same setting as previously described, and tumor growth in these mice was intermediate (between the two conditions) (Fig. 4N), indicating that sgSlc35c1-Tregs are not able to drive fragility in surrounding Tregs, likely due to the mild increase of IFNγ production upon Slc35c1 deletion. To characterize the effect of sgSlc35c1-Tregs on the remodeling of the TME, possibly explaining the reduction in tumor growth, we also analyzed tumor-associated macrophages (TAMs). Here, we found a reduced number of TAMs in the sgSlc35c1 versus sgNT condition (Fig. 4O), which indicates that the impaired suppressive function of sgSlc35c1 -Tregs leads to tumor growth inhibition both directly and indirectly via macrophage alterations.

Figure 4. Slc35c1 deletion leads to less suppressive Tregs in the tumor.

Figure 4

In vivo suppressive assay of sgNT or sgSlc35c1 Tregs in a MC38 tumor model followed by flow cytometric analysis of the tumors. A, MC38 tumor growth. B, MC38 tumor weight at the endpoint. C, Percentage of CD4+CD90.1- (out of CD45+) T cells. D, Percentage of IFNγ produced by the CD4+ CD90.1- T cells. E, Percentage of CD8+ T cells (out of CD45+). F, Percentage of IFNγ produced by the CD8+ T cells. G, Percentage of IFNγ+ cells gated out of tetramer+ CD8+ T cells. H, MFI of IFNγ+ in the tetramer+ CD8+ T cells in the tumor. I, Percentage of CD90.1+ Tregs (transduced Tregs) in the tumor. J, MFI of Foxp3 in the CD90.1+ Tregs. K, Percentage of Foxp3 (out of the CD90.1+ Tregs). L, Percentage of IFNγ (out of the CD90.1+ Tregs). M, MFI of IFNγ in the CD90.1+ Tregs. N, MC38 tumor growth upon co-injection of 50:50 sgNT and sgSlc35c1 Tregs and In vivo suppressive assay. O, Number of F4/80+ macrophages per gram of tumor. The In vivo data are the pooled data from three independent experiments with n = 3-4 mice per group per experiment. ns, p > 0.05, * p ≤ 0.05, ** p ≤ 0.01 and *** p ≤ 0.001. All graphs show mean value ± SEM.

Ex vivo pharmacological inhibition of fucosylation abates Treg suppressive function and restores anti-tumor immunity

To translate our data in a pharmacological setting, we used the fucosylation inhibitor 2-peracetyl fucose (2FF). In an ex vivo preconditioning regimen, Tregs were isolated from Ly5.1+ Foxp3Thy1.1 mice and cultured in the presence of 100 μM 2FF or DMSO for 6 days. AAL FACS staining confirmed the reduction in fucosylation in 2FF-treated Tregs (Fig. 5A), and we also observed a slight, but significant, reduction in Foxp3 MFI, frequency of PD-1+ cells, and PD-1 MFI, a phenotype similar to what we observed in sgSlc35c1-Tregs (Fig. 5B-D). Subsequently, one day before MC38 implantation, CD4+CD25- and CD8+ T effector cells were adoptively transferred alone or in combination with 2FF- or DMSO-treated Tregs into Rag2-/- mice (Fig. 5E). Consistent with our hypothesis, mice that received 2FF-treated Tregs exhibited reduced tumor growth (Fig. 5F-G) compared to the DMSO-Treg group, indicating that 2FF ex vivo preconditioning impairs Tregs In vivo suppressive function. This was accompanied by a significant increase of CD4+ T-cell infiltration and a slight increase in CD4+ T-cell IFNγ production (Fig. 5H-I). Analysis of tumor-derived Tregs at end-stage revealed no difference in their numbers (Supplementary Fig. S5A) or phenotype, as determined by frequency of Foxp3+ cells and Foxp3 MFI (Supplementary Fig. S5B-C). By assessing the AAL MFI in splenic Tregs from tumor-bearing mice at end-stage, we observed significantly higher fucosylation in the 2FF-pretreated group (Fig 5J). From these data, we can speculate that the effects of 2FF in reducing fucosylation, and on reducing suppressive function of Tregs, is maintained in the early stages following ACT, but it is lost, or possibly compensated, at end-stage (Fig. 5G and 5J).

Figure 5. Pre-treatment of In vivo-derived Tregs with the fucosylation inhibitor 2FF impairs their suppressive function in the tumor.

Figure 5

In vivo-derived Tregs were treated with 2FF or control DMSO ex vivo followed by tail vein injection in Rag2-/- mice for In vivo suppressive assay with MC38 tumors. A, MFI AAL gated out of alive In vivo-derived Tregs upon 6 days of ex vivo culture with 2FF or DMSO control. B, MFI Foxp3 out of alive Tregs. C, Percentage PD-1+ out of alive Tregs. D, MFI PD-1 out of alive Tregs. E, Scheme of the In vivo suppressive assay with Tregs ex-vivo treated with the fucosylation inhibitor 2FF or DMSO and injected in Rag2-/- mice implanted with MC38 tumors. F, MC38 tumor growth. G, Tumor weight at the end-stage. H, Percentage of intratumoral CD4+CD45.1- T cells (out of CD45+). I, Percentage of IFNγ produced by intratumoral CD4+CD45.1- T cells. J, MFI AAL out of Tregs in the spleen of tumorbearing mice at end-stage. In vitro experiments are the pooled data of least three independent times. The In vivo data are the pooled data from three independent experiments with n = 3-4 mice per group per experiment. ns, p > 0.05, * p ≤ 0.05, ** p ≤ 0.01 and *** p ≤ 0.001. All graphs show mean value ± SEM.

Systemic inhibition of fucosylation reduces tumor growth through its effect on Tregs

Augmented fucosylation of several proteins involved in tumor progression has been reported in several cancer types [40,41]. However, the functional relevance of fucosylation inhibition in Tregs is unknown. To assess the effect of fucosylation blockade in Tregs In vivo, CT26 tumor-bearing mice were treated with 2FF or saline starting at an average tumor volume of 150 mm3. 2FF systemic administration led to a significant reduction in tumor growth and weight (Fig. 6A-B). The total number of Tregs was significantly reduced at early stage, i.e., after 7 days of 2FF treatment (Fig. 6C) but disappeared at end-stage (Fig. 6D). In 2FF-treated mice, PD-1 expression was significantly reduced on Tregs (Fig. 6E-F, Supplementary Fig. S6A), without altering CD4+Foxp3- and CD8+ T cells in the tumor (Fig. 6G-J). In spleens from treated mice, although the percentage of Tregs did not change, we observed a higher percentage of CD4+Foxp3- and CD8+ T cells (Supplementary Fig. S6B-D) and a lower percentage of PD-1 on Tregs and CD4+Foxp3- T cells (Supplementary Fig. S6E-J). By measuring fucosylation levels in different intratumoral cell types, we found that 2FF led to significantly reduced fucosylation in Tregs but not in other T cells (Fig. 6K, Supplementary Fig. S6K). Although 2FF treatment did not affect the percentage of all cell populations in the tumor (Supplementary Fig. S6L-O), it led to a significant reduction in the percentage of F4/80+ macrophages, which also expressed higher MHCII (Supplementary Fig. S6P-Q), and to a significant increase in the percentage of CD8+ T cells (Supplementary Fig. S6S). When bone-marrow derived macrophages (BMDMs) were treated with 2FF in vitro there were no differences either in the percentage of MHCIIHIGH cells, other antigen-presentation-related proteins, or viability (Supplementary Fig. S6R). To better understand the main target of 2FF, we performed systemic 2FF treatment upon efficient Tregs’ depletion with anti-CD25 (Supplementary Fig. S6T-U) [24]. 2FF alone or Tregs’ depletion alone led to a significantly reduced tumor growth, but their combination did not further reduce tumor growth (Fig. 6L-M). Also, 2FF administration upon Tregs’ depletion, did not lead to differences in TAMs or MHCII expression (Supplementary Fig. S6V-W). These data, together with a decrease in TAMs upon transfer of sgSlc35c1-Tregs (Fig. 4O), indicate that the effect on macrophages in the TME is mediated through Tregs.

Figure 6. Systemic administration of a fucosylation inhibitor abates tumor immunosuppression.

Figure 6

CT26 tumors were engrafted in Balb/c mice. At day 8 of tumor engraftment, mice started treatment with 2FF or saline control twice per day until the end of the experiment. A, CT26 tumor growth following systemic administration of the fucosylation inhibitor 2FF or saline (control). B, CT26 tumor weight at the endpoint. C, Number of Tregs per gram of tumor 7 days upon start of 2FF. D, Number of Tregs per gram of tumor at the end-stage (15 days upon start of 2FF). E, Percentage of PD-1+ in Tregs in the tumor. F, MFI of PD-1 in Tregs in the tumor. G, Percentage of PD-1+ in CD8+ T cells in the tumor. H, MFI of PD-1 in CD8+ T cells in the tumor. I, Percentage of PD-1+ in CD4+Foxp3- in the tumor. J, MFI of PD-1 in CD4+Foxp3- in the tumor. K, MFI of AAL in Tregs, CD4+Foxp3- and CD8+ T cells in the tumor. L, Tumor growth of CT26 tumors upon Tregs depletion with an a-CD25 or IgG control administration followed by 2FF or saline treatment. M, Tumor weight (gr) of the CT26 tumors at end-stage. N, In vivo suppressive assay upon transfer of PD-1 WT or PD-1 MUT reconstituted Tregs ex vivo treated with 2FF or DMSO control, tumor growth of MC38 tumors. O, Tumor weight (gr) of the MC38 tumors at end-stage. The In vivo data shown in Fig. 6A-J are the pooled data from three independent experiments with n = 3-4 mice per group per experiment. The data shown in Fig. 6K-M are representative of three independent experiments and the data shown in Fig. 6N-O are the pooled data of two independent experiments with n = 3-4 mice per group. ns, p > 0.05, * p ≤ 0.05, ** p ≤ 0.01 and *** p ≤ 0.001. All graphs show mean value ± SEM.

To understand if impaired fucosylation of PD-1 could be responsible for the reduced suppressive function of Tregs, Tregs were isolated from Pdcd1-/- mice and transduced with retroviral vectors encoding a PD-1 wild-type (WT) or mutant form, which has reduced PD-1 fucosylation due to the N49Q/N74Q double mutation as has been previously shown [19]. The efficiency of the reconstitution is shown in Supplementary Fig. S6X. Three days upon transduction, WT or mutant PD-1 Tregs were treated ex vivo with 2FF (PD-1 WT + 2FF and PD-1 MUT + 2FF Tregs) or DMSO vehicle (PD-1 WT + DMSO and PD-1 MUT + DMSO Tregs) for 3 additional days. The four groups of Tregs were transferred via tail vein injection into Rag2-/- mice to perform In vivo suppressive assays as described previously. Mice injected with vehicle-treated mutant PD-1 Tregs (PD-1 MUT + DMSO) exhibited smaller MC38 tumors compared to mice injected with vehicle-treated WT PD-1 Tregs (PD-1 WT + DMSO) (Fig. 6N-O), indicating the PD-1 fucosylation is important for the maintenance of Treg suppressive function In vivo.

FucoLOW Tregs exhibit an immunogenic profile and predict better outcome in cancer patients

We sought to characterize Tregs with different levels of fucosylation within the tumors, and determined if these populations could be relevant prognostic factors for patient survival. An already published scRNAseq data of colorectal cancer patients (n = 23) was used to investigate the fucosylation profile of tumor-infiltrating Tregs (Fig. 7A) [27]. Tregs were bifurcated into FucoLOW and FucoHIGH Tregs based on the expression of genes related to fucosylation (Fig. 7B) [40]. Out of 974 total Tregs identified to proficiently express the fucosylation signature, 352 Tregs were FucoLOW and 622 Tregs were FucoHIGH in colorectal cancer patients (Fig. 7C). Thereafter, we performed a REACTOME biological pathway enrichment analysis on FucoLOW vs. FucoHIGH Tregs and found that FucoLOW Tregs were enriched for more immunogenic or pro-inflammatory pathways related to T-cell receptor (TCR) activation, IFNγ signaling, and MHCII antigen presentation (Fig. 7D-E).

Figure 7. Classification of Tregs based on their fucosylation level in cancer patients. A,

Figure 7

t-Distributed Stochastic Neighbor Embedding (t-SNE) from published single cell data of CRC patients (n = 23). In the pre-annotated regulatory CD4+ T cells (Treg) cluster was used a fucosylation signature to create sum-based metagene expression spectrum per Treg cell (974 Treg single-cells expressed this signature). B, The Fuco-metagene expression ranges from 0 to 16.3 units. A middle cut-off of 7.02 expression units was used to bifurcate the total Tregs into Tregs with high Fuco-signature (metagene expression > 7.02) or Tregs with low Fuco-signature (metagene expression < 7.02). C, Number of FucoLOW Tregs (n = 352) and FucoHIGH Tregs (n = 622) cells in tumor out of total Tregs identified in the fucosylation signature (n = 974). D, Pathways enriched in Fuco-low Tregs cluster with p-value < 0.05 and FDR < 0.3, where enrichment score (ES). E, Pathways enriched in FucoHIGH Tregs cluster with p-value < 0.05 and FDR < 0.3. F, Overall survival analysis of Skin Cutaneous Melanoma (SKCM) patients (n = 458) from TCGA using the top most enriched genes within the Fuco-low signature Tregs. G, Median survival fraction of melanoma patients prior anti-PD-1 immunotherapy (n = 41). Red line = high number of FucoLOW signature and blue line = low number of FucoLOW signature in the tumor, Z = -1.92 and p-value = 0.0543. H, Median survival fraction of melanoma patients post anti-CTLA4 immunotherapy (n = 15). Red line = high number of FucoLOW Treg signature and blue line = low number of FucoLOW Treg signature in the tumor, Z= -2.09 and p-value = 0.0367.

We next questioned if the FucoLOW Treg footprint in tumors could be used as biomarker for predicting patient survival. Analysis of melanoma patient data retrieved from The Cancer Genome Atlas (TCGA) showed that patients with high expression of the FucoLOW signature (extracted from above scRNA-seq analyses) survived significantly longer than patients with low expression of the FucoLOW signature (Fig. 7F). Also, analysis of the melanoma tumor transcriptome prior to treatment of patients with anti-PD-1 therapy [31] or post-treatment with anti -CTLA-4 [30] showed that patients with high expression of the FucoLOW signature had improved survival compared to patients with low expression of the signtaure, thereby indicating that the FucoLOW footprint could be a useful biomarker for immuno-oncological applications (Fig. 7G-H). Because the data from TCGA includes transcripts from whole tumors, analysis of the correlation between our FucoLOW Treg signature with bulk-transcriptome signatures for tumor-associated Tregs, macrophages, fibroblasts, endothelial cells, and melanocytic cancer cells was performed. It was found that a FucoLOW Treg signature positively correlated with a bulk-transcriptome Treg signature within the same melanoma tumor, shown to associated with better prognosis (Supplementary Fig. S7A-E). This suggests an important contribution of Tregs to patient survival. Also, the expression of Golgi-related fucosylation genes (Fut1-11 and Slc35c1) was analyzed in a published RNA-seq dataset from breast cancer patients [33]. The expression of these genes was enriched in breast tumor-derived Tregs and also in Tregs derived from the normal breast parenchyma (NBP) compared to Tregs derived from PBMCs (Supplementary Fig. S7F). This finding suggests that fucosylation is important for Tregs in tumor and adjacent tissues but not Tregs in circulation.

Discussion

Despite numerous studies on Tregs’ metabolism [8–12] and CRISPR/Cas9 screenings tailored to identify novel regulators of Treg identity [23,39,42,43], an unbiased and holistic discovery of metabolic factors regulating Treg functionality is currently missing. Here, we performed a loss-of-function, pooled, CRISPR-based metabolic screen and identified functionally relevant positive (Slc35c1, Dck, Cyp3a13, A4galt, Duox1, Echs1, and Pla2g4c) and negative regulators (Adss, Gys2, and Pold3) of Foxp3. Among the positive regulators, we uncovered genes related to fucosylation, specifically fucosyltransferases Fut2, Fut4, Fut7 and Fut8 and the transporter Slc35c1. We further uncovered the role of Slc35c1, which has no previous reported role on Treg functionality. Slc35c1 is a GDP-fucose transporter from the cytosol into the Golgi, important for the synthesis of fucosylated glycans. Defects of this gene have been associated in humans with leucocyte adhesion deficiency II (LAD II) [35,37]. Fucosylation of glycans is very important for many biological processes such as leucocyte cell migration, immune cell interactions, and antibody-dependent cellular cytotoxicity (ADCC) [40,44]. Besides our focus on positive regulators, future work geared towards understanding the functional relevance of the metabolic negative regulators of Foxp3 identified in this study are underway.

Our data indicate that impaired fucosylation after Slc35c1 deletion in Tregs weakens Foxp3 expression, slightly enhances IFNγ production, and limits Treg suppressive capacity in vitro, reminiscent of a “unstable,” less suppressive Treg phenotype [6]. Mechanistically, Slc35c1 deletion impaired the proliferation of Tregs in vitro and In vivo without affecting their recruitment capacity into tissues. In line with this, the In vivo transfer of sgSlc35c1-Tregs in tumor-bearing mice led to reduced tumor growth and increased numbers and IFNγ production, mainly driven by the CD4+ T cells, confirming that sgSlc35c1-Tregs had impaired suppressive activity once in the TME. In addition, tumors in mice injected with sgSlc35c1-Tregs had significantly fewer TAMs, which are known to suppress antitumor immunity and promote tumor progression. However, the limitations related to the transfer of Tregs in Rag2-/- mice should be considered. Although commonly used, Rag2-/- mice do not recapitulate a physiological tumor environment. The creation of Slc35c1-knockout mice and specific deletion of Slc35c1 in Tregs in the future will allow for a deeper characterization of the role of Slc35c1 in Treg biology.

Pharmacological inhibition of fucosylation has been reported to inhibit tumor growth In vivo [45,46] and to potentiate the effector functions of CD8+ T cells adoptively transferred into tumor-bearing mice [19]. Of note, enhancing fucosylation in human regulatory T cells prior to their transfer leads to prolonged survival of Tregs, a finding that led to a clinical trial in GVHD patients (NCT02423915) [47]. In the current study, we showed that adoptive transfer of Tregs preconditioned with a fucosylation inhibitor or systemic inhibition of fucosylation in tumor-bearing mice led to reduced tumor growth. Systemic administration of 2FF led to impaired fucosylation in Tregs but not in other T-cell populations, consistent with the observation that fucosylation’s anti-tumor effect was predominantly through an alteration of suppressive Treg function. We also showed a reduced fraction of TAMs, albeit with a higher expression of MHCII (a marker of improved antigen-presentation), which was similar to when sgSlc35c1-Tregs were transferred. This difference in TAMs was not observed with Treg depletion, nor with in vitro treatment of macrophages with 2FF. Overall, our data suggest that Tregs are the main T-cell population in the tumor affected by inhibition of fucosylation, and this could impair the density and suppressive phenotype of TAMs in the TME. Further studies are required to describe the exact mechanism by which fucosylation in Tregs affects TAM number and function.

Tregs exhibit their suppressive function through a variety of mechanisms, including immune checkpoint molecules (e.g., GITR, CTLA-4, ICOS, TGFβ1, PD-1, etc.). These are generally families of proteins highly decorated with oligosaccharide moieties, and altering this process might affect their folding, stability, intracellular trafficking, cell-surface marker expression, secretion, cell-cell binding, receptor-ligand interactions, and cell trafficking [48]. Although it is known that membrane exposure and turnover of PD-1 is regulated by fucosylation [19], we showed that inhibition of fucosylation significantly reduced surface PD-1 expression on Tregs, which was eventually more prominent in tumor Tregs than in CD8+ or CD4+ effector T cells. Also, the reconstitution of Pdcd1-/- Tregs with a PD-1 mutant that had impaired fucosylation, led to less suppressive Tregs In vivo, indicating that PD-1 fucosylation was partly responsible for the reduced suppressive phenotype of sgSlc35c1-Tregs. We speculate that in Tregs, Slc35c1 deletion through its effect on fucosylation, leads to reduced surface expression of PD-1. PD-1 has been shown to be important for Treg stability and Foxp3 expression, thus regulating the suppressive function of Tregs [49–51]. However, the role of PD-1 blockade in Tregs has been controversial [52]. In addition, our data suggest that Slc35c1 deficiency may affect Treg function through multiple mechanisms, altogether harnessing their suppressive functions and altering the tumor microenvironment towards an anti-tumor immune response. Despite our focus on PD-1 fucosylation, we believe that Slc35c1 controls the fucosylation of several other membrane proteins that are important for the suppressive function of Tregs. For example, fucosylation of TGFβ receptors is critical for their function [53,54]. Given the broad biological effects of core fucosylation, all the pathways affected by Slc35c1 deficiency in Tregs remain to be elucidated in future studies.

We additionally tested the human relevance of our findings and revealed that tumoral Tregs could be distinguished as FucoLOW and FucoHIGH subpopulations, with FucoHIGH Tregs being the most abundant in the tumor compared to the FucoLOW. In accordance with our findings in mouse Tregs, FucoLOW Tregs exhibited a pro-inflammatory and IFNγ-producing phenotype, and their high number associated with a relatively better disease outcome and positive response to immune checkpoint blockade in melanoma patients. Analysis of the fucosylation signature in RNA-seq data from Tregs derived from breast cancer patients showed that Tregs in tumor and adjacent tissues had higher levels of fucosylation compared to circulating Tregs. This was also corroborated by our observation in mice, whereby tumor-infiltrating Tregs exhibited the highest extent of fucosylation. These data point to the notion that targeting Slc35c1 might lower the risk of non-specific targeting and development of autoimmunity compared to pan-Treg depletion. Because fucosylation-related genes are involved in a multitude of pathways that are part of glycosylation structure synthesis, further study of the role of each of these genes in Treg biology could lead to the better understanding of their function.

Supplementary Material

Data file CRISPR_cas9 screen Data file CRISPR_cas9 screen
Data file Reactome_analysis
Figure S1
Figure S2
Figure S3
Figure S4
Figure S5
Figure S6
Figure S7
Table S1
Table S2

Synopsis.

A metabolic CRISPR-Cas9 screen reveals the important role of fucosylation in the suppressive function of regulatory T cells (Tregs). Measuring fucosylation in Tregs has the potential to aid in the discovery of relevant prognostic markers for cancer patients.

Acknowledgements

S. Pinioti was supported by a MSCA-ITN grant (META-CAN; #766214). Q. Yu was funded by the Stichting tegen Kanker (F/2020/1544). E. D. Bousser and N. Callewaert were funded by the Foundation for Scientific Research Flanders and from VIB. Research in A. D. Garg lab was supported by Research Foundation Flanders (FWO) (Fundamental Research Grant, G0B4620N; Excellence of Science/EOS grant, 30837538, for ‘DECODE’ consortium), KU Leuven (C1 grant, C14/19/098, C3 grant, C3/21/037, and POR award funds, POR/16/040), Kom op Tegen Kanker (Stand Up To Cancer, the Flemish Cancer Society) (KOTK/2018/11509/1; KOTK/2019/11955/1), VLIR-UoS (iBOF grant, iBOF/21/048, for ‘MIMICRY’ consortium). M. Mazzone holds an ERC Consolidator Grant for the project ImmunoFit (773208). We would like to thank Jens Serneels, Dana Liu, Elisabeth Vandeputte, and Alicia Jacquemotte for their technical support, Dr. Jochen Lamote for his scientific input in flow cytometry data analysis, Prof. Akihiko Yoshimura for providing the PD-1 WT and mutant plasmids and Vincent Van Hoef for contributing on the analysis of the NGS data.

Footnotes

Authors’ Contributions

S. Pinioti: Conceptualization, formal analysis, validation, investigation, visualization, writing original, review and editing. H. Sharma: Validation, investigation and methodology. N. C. Flerin: Conceptualization, formal analysis, validation, and methodology. Q. Yu: Investigation, formal analysis and visualization. A. Tzoumpa: Methodology. S. T. Cafarello: Investigation. N. Callewaert and E. D. Bousser: Methodology and resources. G. Oldenhove: Resources. S. Schlenner: Resources. B. Thienpont: Conceptualization and visualization. A. D. Garg: Conceptualization and visualization. M. D. Matteo: Conceptualization, investigation and writing original draft. M. Mazzone: Conceptualization, resources, supervision, funding acquisition, writing original draft, review and editing.

Conflict of interest:

There is no conflict of interest

Data availability

The human RNA-seq bulk dataset was obtained from GEO under accession number GSE89225. The single-cell RNA-seq dataset from colorectal cancer patients was obtained from GSE132465. All the other data presented in this manuscript are available in the supplementary materials and data files or from the corresponding authors upon request.

References

  • 1.Sakaguchi S, Yamaguchi T, Nomura T, et al. Regulatory T Cells and Immune Tolerance. Cell. 2008;133:775–87. doi: 10.1016/j.cell.2008.05.009. [DOI] [PubMed] [Google Scholar]
  • 2.Woo EY, Chu CS, Goletz TJ, et al. Regulatory CD4(+)CD25(+) T cells in tumors from patients with early-stage non-small cell lung cancer and late-stage ovarian cancer. Cancer Res. 2001;61:4766–72. [PubMed] [Google Scholar]
  • 3.Curiel TJ, Coukos G, Zou L, et al. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat Med. 2004;10:942–9. doi: 10.1038/nm1093. [DOI] [PubMed] [Google Scholar]
  • 4.Williams LM, Rudensky AY. Maintenance of the Foxp3-dependent developmental program in mature regulatory T cells requires continued expression of Foxp3. Nat Immunol. 2007;8:277–84. doi: 10.1038/ni1437. [DOI] [PubMed] [Google Scholar]
  • 5.Schmidt A, Oberle N, Krammer PH. Molecular Mechanisms of Treg-Mediated T Cell Suppression. Front Immun. 2012;3 doi: 10.3389/fimmu.2012.00051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Overacre-Delgoffe AE, Vignali DAA. Treg Fragility: A Prerequisite for Effective Antitumor Immunity? Cancer Immunol Res. 2018;6:882–7. doi: 10.1158/2326-6066.CIR-18-0066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Abbas AK, Benoist C, Bluestone JA, et al. Regulatory T cells: recommendations to simplify the nomenclature. Nat Immunol. 2013;14:307–8. doi: 10.1038/ni.2554. [DOI] [PubMed] [Google Scholar]
  • 8.Delgoffe GM, Kole TP, Zheng Y, et al. The mTOR Kinase Differentially Regulates Effector and Regulatory T Cell Lineage Commitment. Immunity. 2009;30:832–44. doi: 10.1016/j.immuni.2009.04.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chapman NM, Zeng H, Nguyen T-LM, et al. mTOR coordinates transcriptional programs and mitochondrial metabolism of activated Treg subsets to protect tissue homeostasis. Nat Commun. 2018;9:2095. doi: 10.1038/s41467-018-04392-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sugiura A, Andrejeva G, Voss K, et al. MTHFD2 is a metabolic checkpoint controlling effector and regulatory T cell fate and function. Immunity. 2022;55:65–81.:e9. doi: 10.1016/j.immuni.2021.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gerriets VA, Kishton RJ, Johnson MO, et al. Foxp3 and Toll-like receptor signaling balance Treg cell anabolic metabolism for suppression. Nat Immunol. 2016;17:1459–66. doi: 10.1038/ni.3577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Angelin A, Gil-de-Gómez L, Dahiya S, et al. Foxp3 Reprograms T Cell Metabolism to Function in Low-Glucose, High-Lactate Environments. Cell Metabolism. 2017;25:1282–1293.:e7. doi: 10.1016/j.cmet.2016.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Liston A, Nutsch KM, Farr AG, et al. Differentiation of regulatory Foxp3 + T cells in the thymic cortex. Proc Natl Acad Sci USA. 2008;105:11903–8. doi: 10.1073/pnas.0801506105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Webster KE, Walters S, Kohler RE, et al. In vivo expansion of T reg cells with IL-2-mAb complexes: induction of resistance to EAE and long-term acceptance of islet allografts without immunosuppression. J Exp Med. 2009;206:751–60. doi: 10.1084/jem.20082824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Evers B, Jastrzebski K, Heijmans JPM, et al. CRISPR knockout screening outperforms shRNA and CRISPRi in identifying essential genes. Nat Biotechnol. 2016;34:631–3. doi: 10.1038/nbt.3536. [DOI] [PubMed] [Google Scholar]
  • 16.Hart T, Tong AHY, Chan K, et al. Evaluation and Design of Genome-Wide CRISPR/SpCas9 Knockout Screens. G3 Genes|Genomes|Genetics. 2017;7:2719–27. doi: 10.1534/g3.117.041277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Doench JG, Fusi N, Sullender M, et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016;34:184–91. doi: 10.1038/nbt.3437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Tsai C-H, Chuang Y-M, Li X, et al. Immunoediting instructs tumor metabolic reprogramming to support immune evasion. Cell Metab. 2023;35:118–133.:e7. doi: 10.1016/j.cmet.2022.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Okada M, Chikuma S, Kondo T, et al. Blockage of Core Fucosylation Reduces Cell-Surface Expression of PD-1 and Promotes Anti-tumor Immune Responses of T Cells. Cell Rep. 2017;20:1017–28. doi: 10.1016/j.celrep.2017.07.027. [DOI] [PubMed] [Google Scholar]
  • 20.Li W, Köster J, Xu H, et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biol. 2015;16:281. doi: 10.1186/s13059-015-0843-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Li W, Xu H, Xiao T, et al. MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens. Genome Biol. 2014;15:554. doi: 10.1186/s13059-014-0554-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Johnson WE, Li C, Rabinovic A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics. 2007;8:118–27. doi: 10.1093/biostatistics/kxj037. [DOI] [PubMed] [Google Scholar]
  • 23.Schumann K, Lin S, Boyer E, et al. Generation of knock-in primary human T cells using Cas9 ribonucleoproteins. Proc Natl Acad Sci USA. 2015;112:10437–42. doi: 10.1073/pnas.1512503112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Solomon I, Amann M, Goubier A, et al. CD25-Treg-depleting antibodies preserving IL-2 signaling on effector T cells enhance effector activation and antitumor immunity. Nat Cancer. 2020;1:1153–66. doi: 10.1038/s43018-020-00133-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Vanmeerbeek I, Borras DM, Sprooten J, et al. Early memory differentiation and cell death resistance in T cells predicts melanoma response to sequential anti-CTLA4 and anti-PD1 immunotherapy. Genes Immun. 2021;22:108–19. doi: 10.1038/s41435-021-00138-4. [DOI] [PubMed] [Google Scholar]
  • 26.Sprooten J, Vankerckhoven A, Vanmeerbeek I, et al. Peripherally-driven myeloid NFkB and IFN/ISG responses predict malignancy risk, survival, and immunotherapy regime in ovarian cancer. J Immunother Cancer. 2021;9:e003609. doi: 10.1136/jitc-2021-003609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Lee H-O, Hong Y, Etlioglu HE, et al. Lineage-dependent gene expression programs influence the immune landscape of colorectal cancer. Nat Genet. 2020;52:594–603. doi: 10.1038/s41588-020-0636-z. [DOI] [PubMed] [Google Scholar]
  • 28.Tang Z, Kang B, Li C, et al. GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis. Nucleic Acids Research. 2019;47:W556–60. doi: 10.1093/nar/gkz430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Aran D, Hu Z, Butte AJ. xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol. 2017;18:220. doi: 10.1186/s13059-017-1349-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nathanson T, Ahuja A, Rubinsteyn A, et al. Somatic Mutations and Neoepitope Homology in Melanomas Treated with CTLA-4 Blockade. Cancer Immunol Res. 2017;5:84–91. doi: 10.1158/2326-6066.CIR-16-0019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gide TN, Quek C, Menzies AM, et al. Distinct Immune Cell Populations Define Response to Anti-PD-1 Monotherapy and Anti-PD-1/Anti-CTLA-4 Combined Therapy. Cancer Cell. 2019;35:238–255.:e6. doi: 10.1016/j.ccell.2019.01.003. [DOI] [PubMed] [Google Scholar]
  • 32.Naulaerts S, Borras DM, Martinez AA, et al. Immunogenomic, single-cell and spatial dissection of CD8 + T cell exhaustion reveals critical determinants of cancer immunotherapy. Immunology. 2021 doi: 10.1101/2021.11.22.468617. [DOI] [Google Scholar]
  • 33.Plitas G, Konopacki C, Wu K, et al. Regulatory T Cells Exhibit Distinct Features in Human Breast Cancer. Immunity. 2016;45:1122–34. doi: 10.1016/j.immuni.2016.10.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Uhlen M, Karlsson MJ, Zhong W, et al. A genome-wide transcriptomic analysis of protein-coding genes in human blood cells. Science. 2019;366:eaax9198. doi: 10.1126/science.aax9198. [DOI] [PubMed] [Google Scholar]
  • 35.Hellbusch CC, Sperandio M, Frommhold D, et al. Golgi GDP-fucose Transporter-deficient Mice Mimic Congenital Disorder of Glycosylation IIc/Leukocyte Adhesion Deficiency II. Journal of Biological Chemistry. 2007;282:10762–72. doi: 10.1074/jbc.M700314200. [DOI] [PubMed] [Google Scholar]
  • 36.Lühn K, Wild MK, Eckhardt M, et al. The gene defective in leukocyte adhesion deficiency II encodes a putative GDP-fucose transporter. Nat Genet. 2001;28:69–72. doi: 10.1038/ng0501-69. [DOI] [PubMed] [Google Scholar]
  • 37.Skurska E, Szulc B, Maszczak-Seneczko D, et al. Incorporation of fucose into glycans independent of the GDP-fucose transporter SLC35C1 preferentially utilizes salvaged over de novo GDP-fucose. J Biol Chem. 2022;298:102206. doi: 10.1016/j.jbc.2022.102206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wright RD, Cooper D. Glycobiology of leukocyte trafficking in inflammation. Glycobiology. 2014;24:1242–51. doi: 10.1093/glycob/cwu101. [DOI] [PubMed] [Google Scholar]
  • 39.Loo C-S, Gatchalian J, Liang Y, et al. A Genome-wide CRISPR Screen Reveals a Role for the Non-canonical Nucleosome-Remodeling BAF Complex in Foxp3 Expression and Regulatory T Cell Function. Immunity. 2020;53:143–157.:e8. doi: 10.1016/j.immuni.2020.06.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Park S, Lim J, Chun J, et al. Altered expression of fucosylation pathway genes is associated with poor prognosis and tumor metastasis in non-small cell lung cancer. Int J Oncol. doi: 10.3892/ijo.2019.4953. Published Online First: 24 December 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Leng Q, Tsou J-H, Zhan M, et al. Fucosylation genes as circulating biomarkers for lung cancer. J Cancer Res Clin Oncol. 2018;144:2109–15. doi: 10.1007/s00432-018-2735-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Cortez JT, Montauti E, Shifrut E, et al. CRISPR screen in regulatory T cells reveals modulators of Foxp3. Nature. 2020;582:416–20. doi: 10.1038/s41586-020-2246-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Long L, Wei J, Lim SA, et al. CRISPR screens unveil signal hubs for nutrient licensing of T cell immunity. Nature. doi: 10.1038/s41586-021-04109-7. Published Online First: 18 November 2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Becker DJ, Lowe JB. Fucose: biosynthesis and biological function in mammals. Glycobiology. 2003;13:41R–53R. doi: 10.1093/glycob/cwg054. [DOI] [PubMed] [Google Scholar]
  • 45.Okeley NM, Alley SC, Anderson ME, et al. Development of orally active inhibitors of protein and cellular fucosylation. Proceedings of the National Academy of Sciences. 2013;110:5404–9. doi: 10.1073/pnas.1222263110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Disis ML, Corulli LR, Gad EA, et al. Therapeutic and Prophylactic Antitumor Activity of an Oral Inhibitor of Fucosylation in Spontaneous Mammary Cancers. Mol Cancer Ther. 2020;19:1102–9. doi: 10.1158/1535-7163.MCT-19-0500. [DOI] [PubMed] [Google Scholar]
  • 47.Parmar S, Liu X, Najjar A, et al. Ex vivo fucosylation of third-party human regulatory T cells enhances anti–graft-versus-host disease potency In vivo. Blood. 2015;125:1502–6. doi: 10.1182/blood-2014-10-603449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Varki A, Lowe JB. In: Essentials of Glycobiology. Varki A, Cummings RD, Esko JD, et al., editors. Cold Spring Harbor Laboratory Press; Cold Spring Harbor (NY): 2009. [accessed 21 May 2022]. Biological Roles of Glycans. http://www.ncbi.nlm.nih.gov/books/NBK1897/ [Google Scholar]
  • 49.Stathopoulou C, Gangaplara A, Mallett G, et al. PD-1 Inhibitory Receptor Downregulates Asparaginyl Endopeptidase and Maintains Foxp3 Transcription Factor Stability in Induced Regulatory T Cells. Immunity. 2018;49:247–263.:e7. doi: 10.1016/j.immuni.2018.05.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kim MJ, Kim K, Park HJ, et al. Deletion of PD-1 destabilizes the lineage identity and metabolic fitness of tumor-infiltrating regulatory T cells. Nat Immunol. 2023;24:148–61. doi: 10.1038/s41590-022-01373-1. [DOI] [PubMed] [Google Scholar]
  • 51.Park HJ, Park JS, Jeong YH, et al. PD-1 upregulated on regulatory T cells during chronic virus infection enhances the suppression of CD8+ T cell immune response via the interaction with PD-L1 expressed on CD8+ T cells. J Immunol. 2015;194:5801–11. doi: 10.4049/jimmunol.1401936. [DOI] [PubMed] [Google Scholar]
  • 52.Kumagai S, Togashi Y, Kamada T, et al. The PD-1 expression balance between effector and regulatory T cells predicts the clinical efficacy of PD-1 blockade therapies. Nat Immunol. 2020;21:1346–58. doi: 10.1038/s41590-020-0769-3. [DOI] [PubMed] [Google Scholar]
  • 53.Hirakawa M, Takimoto R, Tamura F, et al. Fucosylated TGF-β receptors transduces a signal for epithelial–mesenchymal transition in colorectal cancer cells. Br J Cancer. 2014;110:156–63. doi: 10.1038/bjc.2013.699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Shen N, Lin H, Wu T, et al. Inhibition of TGF-β1-receptor posttranslational core fucosylation attenuates rat renal interstitial fibrosis. Kidney Int. 2013;84:64–77. doi: 10.1038/ki.2013.82. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data file CRISPR_cas9 screen Data file CRISPR_cas9 screen
Data file Reactome_analysis
Figure S1
Figure S2
Figure S3
Figure S4
Figure S5
Figure S6
Figure S7
Table S1
Table S2

Data Availability Statement

The human RNA-seq bulk dataset was obtained from GEO under accession number GSE89225. The single-cell RNA-seq dataset from colorectal cancer patients was obtained from GSE132465. All the other data presented in this manuscript are available in the supplementary materials and data files or from the corresponding authors upon request.

RESOURCES