Interleukin-9 rescues class switching of Memory B cells derived from Common variable immunodeficiency patients

Abstract

Impaired class switch memory (CSM) B cell formation is the hallmark of common variable immunodeficiency (CVID). Various T cell abnormalities have been observed in CVID patients indicating inadequate T-cell help to B cells. A major setback in understanding its pathogenesis is due to diverse clinical presentation. Therefore, we performed extensive immunological investigation in a cohort of CVID patients with similar clinical findings in order to unravel the T cell dysfunction and its influence on the defective humoral immune response. All recruited CVID patients exhibited B cells in the normal range, but reduced CSM B cells. However, patients showed reduced T cell proliferation, reduced level of serum Interleukin-9 (IL-9) and frequency of IL-9 expressing CD4 (Th-9) cells. IL-9 supplementation along with CD40 engagement was effective in inducing in vitro CSM B cells formation in CVID patients. Thus, IL-9 supplementation has the potential to restore impaired CSM B cell formation in CVID.

1. Introduction

Common variable immunodeficiency (CVID) is a heterogeneous pathologic entity attributed to diverse etiology with prevalence of 1:10,000–1:50,000. It is characterized by hypogammaglobulinemia resulting in susceptibility to recurrent bacterial infection [1,2]. The CVID cases present a myriad of clinical symptoms affecting multiple organ systems, commonly recurrent respiratory or gastrointestinal tract infections [3]. Other clinical presentations include autoimmune, granulomatous or inflammatory diseases or enteropathy etc. [4–6]. Late onset of disease, lack of family history, wide variation in clinical manifestation of the disease suggests the involvement of multifactorial pathogenic events [7]. While 15–20% of CVID cases have an underlying genetic basis, the majority of the cases do not have known etiology [8,9]. Its diagnosis relies on the defective humoral immune response and exclusion of other known causes of hypogammaglobulinemia. Variable clinical presentations often delay diagnosis by approximately five years from the onset [10].

Impaired class switched memory (CSM) B cells formation leading to reduced serum immunoglobulins are the hallmark and the most consistent features in CVID patients which necessitates the treatment with either intravenous or subcutaneous immunoglobulins (IgG) replacement therapy [11]. Even though restoration of IgG level in the CVID patients’ blood reduces the complications and the severity of infections, patients often exhibit higher rates of mortality than the general population [2]. This suggests that in CVID, contribution of defective humoral response due to impaired CSM B cells formation may not be the exclusive factor and may involve other immune cell dysfunction in determining the course of the disease. Therefore, identifying the underlying defect of the immune system and rectifying them may rescue the hallmark defect of CSM B cells for sustained maintenance.

Certain abnormalities have been observed in the T lymphocytes of CVID patients ranging from T cell lymphopenia, abnormal cytokine production, reduced proliferation to increased apoptosis [12–15]. These T cell abnormalities may influence the impaired humoral response in CVID as T cell help is critical for class switching. Moreover, the CVID patients with T cell abnormalities during diagnosis are associated with higher mortality [16]. Precise defects in the T cells and its causal relationship with hypogammaglobulinemia of CVID requires better understanding. Despite extensive research over the last two decades, not much insight has been gained with regard to the immunological basis of CVID possibly due to lack of investigations on homogeneous study cohorts.

In-depth study of T cells and its function in phenotypically homogeneous groups of patients would help in unraveling the underlying etiopathogenesis of CVID. Therefore, we performed extensive immunological investigation in a cohort of relatively homogenous CVID patients in order to investigate the T cell function among CVID patients and its influence on CSM B cell formation.

In our study cohort, we observed diminished T cell proliferation and reduced frequency of IL-9 expressing CD4 cells. We also observed low soluble level of IL-9 in CVID patients compared to healthy controls. IL-9, a member of the common gamma chain (γc) receptor cytokine family, exerts its effect by binding to a heterodimeric receptor consisting of the IL-9 receptor (IL-9R) α and the common γc [17]. T cells remain the chief producer of this cytokine, among CD4 T helper (Th) cells, a specialized subset known as Th-9 cells secrete IL-9 in copious amounts [17]. In B cells, IL-9 has been reported to enhance IL-4–mediated antibody production and humoral recall responses [18–20]. Furthermore, transgenic expression of IL-9 in mice resulted in the increase of B1 cells (15–20%) as compared to wild type mice [21]. Considering this evidence, in the present study, we assessed the impact of IL-9 supplementation along with CD40 co-stimulation on in vitro class switched memory (CSM) B cells formation and immunoglobulin G production in CVID patients.

2. Methods

2.1. Study subjects

In this study we have recruited 10 CVID patients with GI manifestation who were under regular follow-up with the Department of Gastroenterology and Human Nutrition at AIIMS, New Delhi. All the recruited CVID patients was clinically reviewed. Diagnosis of CVID patients recruited in our study were based on ESID diagnostic criteria (http://esid.org/Working-Parties/Registry/Diagnosis-criteria). Diagnosis of CVID was done based on low IgG level along with either low IgA or IgM (serum immunoglobulin levels were repeated thrice for all patients at 1–2-month time interval) and exclusion of other causes of hypogammaglobulinemia, both primary including selective immunoglobulin IgA deficiency, X-linked agammaglobulinemia, combined immunodeficiency and hyper IgM syndrome as well as secondary causes was considered in differential diagnosis of CVID. Serological investigations were performed to rule out infectious and non-infectious cause of protein losing enteropathy. Additionally, as a routine investigation, gastric and duodenal biopsy had been performed to exclude protein losing enteropathy as a cause of hypogammaglobulinemia. 10 age and sex matched healthy subjects were recruited for this study. Written informed consent was taken from all the recruited individuals. The institute ethics committee approved the study (Ref. No.: IEC-238/05.05.2017).

2.2. Peripheral blood mononuclear cells (PBMCs) separation

5-8 ml of Peripheral blood was taken and PBMCs were isolated using Ficoll-Hypaque density gradient.

2.3. Cell culture

To study the impact of IL-9 on B cell class switching, PBMCs were stimulated with α-CD40 antibody (2 μg/ml)(Clone-5C3, BD Biosciences, San Diego, USA) in presence or absence of recombinant IL-9(20 ng/ml) (Peprotech, USA) for 8 days at 37 °C followed by flow cytometry based detection of CD19⁺CD27⁺IgD⁻ cells. On day 8, culture supernatant was isolated from all the culture conditions and stored at -80̊C for measurement of total IgG and IgM level by ELISA.

To investigate various intracellular cytokines (IFN-γ, TNF-α, IL-4 IL-9 and IL-10) and co stimulatory molecule (CD154) using flow cytometry, we stimulated the PBMCs from CVID patients with Dynabeads® Human T-Activator CD3/CD28 (Gibco™, Thermo Fisher Scientific, USA; 8 μl per 0.5 million cells in 200 μl culture medium). For CD154 expression, cells were stimulated for 24 h and for cytokines, cells were stimulated for 48 h at 37 °C. For intracellular cytokines detection, Brefeldin A (10 μg/ml) was added after 36 h of stimulation. For proliferation assay using Ki67, the cells were stimulated for 72 h.

2.4. Flow cytometry

PBMCs were surface stained for different cell surface markers using antibodies listed (Supplementary Table 1). Samples were fixed in 1% formaldehyde and data was acquired on LSR Fortessa X-20 (BD Bio-sciences, San Jose, CA, USA). For intracellular staining for cytokines, PBMCs were cultured for 48 h followed by flowcytometry based detection of intracellular cytokines (IFN-γ⁺, TNF-α⁺, IL-9⁺, IL-4⁺, IL-17⁺, IL-10⁺) (Antibodies listed in Supplementary Table 1). For investigating the IL-9 induced activation of AKT, STAT1, STAT3 and STAT5.Cells were stimulated with 20 ng/ml of rIL-9 for 15, 30 and 60 min. Cells were fixed after stimulation and surface stained with CD19. Following permeabilization, cells were stained for phospho (p)-STAT1, pSTAT3, pSTAT5 and pAKT. Data analysis was performed using Flow Jo software (Tree Star, Inc., Ashland, OR, USA).

2.5. Real time polymerase chain reaction (RT-PCR)

Total mRNA was isolated using GeneJET RNA Purification Kit (Thermo Fisher Scientific, USA) and cDNA was prepared using Revert Aid First strand cDNA synthesis kit (Thermo Scientific). Realtime PCR was performed using the QuantStudio 5 Real-Time PCR Systems (Applied Biosystems). β-Actin (ACTB) (Forward Primer: 5’ ATATGA-GATGCGTTGTTA 3′; Reverse Primer: 5’ AAGTATTAAGGCGAAGAT 3′) was used as normalization control and the relative expression of AICDA (Forward Primer: 5’AGTGAAGAGGCGTGACAGTG 3′ and R: 5’CAG-GAGGTGAACCAGGTGAC3’) was determined by the formula rE = 1/(2^ΔCt).

2.6. ELISA

Total Human IgG and IgM concentration was quantified using Human IgG Total ELISA Kit and Human IgM ELISA kit (Invitrogen, USA) respectively, according to the manufacturer’s protocol. Levels of soluble IL-9 was assessed in serum by IL-9 ELISA kit (Biolegend) as per the manufacturer’s protocol.

2.7. Statistical analysis

Statistical significance of the results was determined with help of the Graph Pad Prism 5 software (GraphPad Software Inc., La Jolla, CA, USA). Analysis was performed using Mann-Whitney test. P < 0.05 was considered as statistically significant.

3. Results

3.1. Description of study population

In our study cohort, we have recruited CVID patients exhibiting gastrointestinal (GI) manifestations. Diagnosis of CVID patients recruited in our study were based on ESID diagnostic criteria (http://esid.org/Working-Parties/Registry/Diagnosis-criteria). Recruited CVID patients presented repeated infection and persistent low serum levels of IgG and IgA and/or IgM. These patients with hypogammaglobulinemia were evaluated for flow cytometry based immunophenotyping to rule out combined immunodeficiencies and X linked agammaglobulinemia. Furthermore, secondary causes of hypogammaglobulinemia (e.g., drugs, malignancies) were ruled out. Recruited CVID patients with GI manifestation were under regular follow-up with the Department of Gastroenterology and Human Nutrition at AIIMS, New Delhi. The demographic and clinical characteristics of the recruited patients are summarized in Table 1.

Table 1. Demographic and clinical characteristics of CVID patients.

S⋅No	Age (Years)	Sex	Age of Onset (years)	Delay in diagnosis (years)	Serum immunoglobulins	Infection History (except GI)	GI infections	GI clinical features	GI Histology	Non-infectious Complication
1	30	M	12	18	Reduced IgG, IgA and IgM	Recurrent respiratory tract infection	None	Persistent diarrhea symptoms of malabsorption	Atrophic gastritis (antral sparing) Nonspecific duodenitis	Gastric carcinoma
2	17	M	12	5	Reduced IgG, IgA and IgM	None	None	Persistent & recurrent small bowel diarrhea	Nonspecific duodenitis with polyclonal lymphoid hyperplasia	None
3	23	M	13	10	Reduced IgG, IgA and IgM	None	None	Persistent diarrhea, weight loss	Inconclusive	None
4	24	M	6	18	Reduced IgG, IgA and IgM	None	Giardiasis	Persistent diarrhea, weight loss	Nonspecific duodenitis with polyclonal lymphoid hyperplasia	None
5	17	F	8	9	Reduced IgG, IgA and IgM	None	None	Recurrent diarrhea, failure to gain weight and height	Mild villous atrophy with polyclonal lymphoid hyperplasia	Vitiligo
6	20	F	5	5	Reduced IgG, IgA	Recurrent respiratory tract infections	Giardiasis	Chronic persistent diarrhea with features of malabsorption failure to gain weight	Mild villous atrophy with polyclonal lymphoid hyperplasia	None
7	39	F	15	24	Reduced IgG, IgA	None	Giardiasis	Chronic persistent diarrhea features of malabsorption	Nonspecific duodenitis with polyclonal lymphoid hyperplasia	None
8	17	M	10	7	Reduced IgG, IgA and IgM	Recurrent respiratory tract infections	None	Chronic persistent diarrhea features of malabsorption	Nonspecific duodenitis	None
9	20	M	13	7	Reduced IgG, IgA and IgM	None	None	Persistent & recurrent small bowel diarrhea	Nonspecific duodenitis	None
10	23	F	15	6	Reduced IgG, IgA and IgM	None	None	Chronic persistent diarrhea features of malabsorption failure to gain weight	Nonspecific duodenitis	None

CVID patients display a variety of abnormalities in B cells and its subpopulations that results in defective humoral immune response [22]. Claudia et al. had observed either absent or dramatically reduced B cells in 10% of CVID patients in their study cohort but in rest of the cases, no significant reduction of peripheral blood (PB) B cells had been documented [4]. In this study, all the patients demonstrated normal frequency of B lymphocytes (Range: 5.94–13.2) (Fig. 1A and B). Next, we evaluated the frequency of class switched memory (CSM) B cells (CD19⁺ CD27⁺ IgD⁻). Reduced frequency of CSM B cells is considered a sensitive marker for perturbed germinal center function and is often reduced in 80–90% of reported CVID cases [23,24]. Our patients showed significant reduced CSM B cells (<2%) relative to healthy control (HC) (Fig. 1 C and D). These patients also exhibited significant reduced frequency of non-switched memory B cells (CD19⁺ CD27⁺ IgD⁺) and enhanced percentage of naïve B cells (CD19⁺ CD27⁻ IgD⁺) compared to HC (Fig. 1E and F).

Figure. 1. B cell phenotype in CVID patients.

(A-G) PBMCs isolated from HC and CVID patients were stained with the antibodies (CD19, CD27, IgD and CD40) for ex vivo analysis of B cells using FC. (A, B) Lymphocytes were first gated on their scatter profile (FSC/SCC). Representative histogram plots of CD19+ cells (A) and cumulative plot showing percentage frequency of CD19⁺ B cells (B) in CVID patients and HC. (C–F) lymphocytes were gated on the basis of their scatter profile (FSC/SSC) followed by gating on CD19⁺ cells. On gated CD19+ cells, switched memory (CD19⁺CD27⁺IgD⁻), non-switched memory (CD19⁺CD27⁺ IgD⁺) and naïve (CD19⁺CD27^-IgD⁺) B cells were analyzed. Representative pseudocolor plots (C) and bar diagram demonstrating switched memory CD19⁺CD27⁺IgD⁻ (D), Non-switched memory CD19⁺CD27⁺IgD⁺ (E), naïve CD19⁺CD27^-IgD⁺ (F) cells in CVID patients compared to age and sex matched HC. (F) Lymphocytes were gated on the basis of their scatter profile (FSC/SSC) and CD19⁺CD40⁺ cells were analyzed. Percentage frequency of B cells expressing CD40 in CVID patients and HC. Data analyzed as mean ± SD. Statistical analysis was done using Student’s t-test non-parametric Mann Whitney test (N = 10; *P < 0.05 ***P < 0.0005). (PBMCs – Peripheral blood mononuclear cells, HC – Healthy Control, CVID – Common Variable Immune Deficiency, FC - flowcytometry).

Engagement of CD40 expressed on B cells with its ligand, CD154 expressed on activated T cells play critical role in the B cell functions [25,26]. This interaction is indispensable for the CSM B cell formation [27]. Therefore, we evaluated the frequency of CD40 expressing B cells (CD19⁺ CD40⁺) in our patients and no significant reduction in their frequency was observed (Fig. 1G). CD154 expression on activated T cells were also observed normal (Supplementary Fig. 1 A and B).

Thus, our study cohort represent a relatively homogenous group with shared clinical presentation, exhibited B cell frequency in the normal range and showed <2% CSM B cells with preserved CD40 expression. Higher frequency of naïve B cells along with reduced CSM and non-switched memory B cells indicate failure of B cell activation in CVID patients.

3.2. Immunophenotyping of T cell subsets

The complex process of an adequate humoral response requires cross-talk between T and B lymphocytes. Patients with CVID demonstrate abnormalities in T cell homeostasis ranging from CD4 T cell lymphopenia, reversal of CD4: CD8 ratio, abnormalities in cytokine production to cell proliferation [28–33]. To understand these T cell abnormalities in our study cohort, we looked at the frequency of CD3 + T-cells and its subsets in the PB. Lymphocyte subset analysis demonstrated that all the patients have comparable frequency of CD3+ T cells numbers with HC in the PB (Fig. 2 A and B). Also, no significant difference was observed between the groups for the frequency of CD4 and CD8 cells in the PB (Fig. 2 C, D and E). The ratio between CD4 and CD8 was in normal range for all the patients (except one).

Fig. 2. Ex vivo analysis of T cells in CVID patients.

(A-F) PBMCs isolated from HC and CVID patients were stained with the antibodies (CD3, CD4, CD8 and FOXP3) for ex vivo analysis of T cells using FC. Lympho-cytes were first gated on their scatter profile (FSC/SCC). (A-B) Representative histogram plots of CD3+ cells (A) and cumulative plot showing percentage frequency of CD3+ T cells (B) in CVID patients and HC. (C–D) lymphocytes were gated on the basis of their scatter profile (FSC/SSC) followed by gating on CD3⁺ cells. On gated CD3+ cells, CD4+ and CD8+ cells were analyzed. Representative pseudocolor plots (C) and bar diagram demonstrating frequency of CD3⁺CD4⁺ (D) and CD3⁺CD8⁺ (E) cells in CVID patients compared to HC. (F) lymphocytes were gated on the basis of their scatter profile (FSC/SSC) followed by gating on CD4⁺ CD25^bright cells. On gated cells, FOXP3 was analyzed. Cumulative plots showing frequency of Regulatory T cells (CD4⁺ CD25⁺ FOXP3⁺) cells in CVID patients compared to HC. Statistical analysis was done using Student’s t-test non-parametric Mann Whitney test (mean ± SD; N = 10; ns – non significant). (PBMCs – Peripheral blood mononuclear cells, HC – Healthy Control, CVID – Common Variable Immune Deficiency, FC - flowcytometry)

We further compared the frequency of regulatory T cells (Tregs), a critical subset of CD4+ T cells for mediating immune tolerance in the PB of CVID patients with HCs. No significant difference in the frequency of circulatory Treg cells (Fig. 2 F; Supplementary Fig. 1C) was observed between the two study groups indicating that in our study cohort, patients did not show any quantitative alteration in the number of CD4 and CD8.

3.3. Reduced IL-9 producing CD4 cells in CVID patients

In CVID, number of studies had observed impairment in the T cell proliferation and cytokine production [34–36]. Thus, we first evaluated the in vitro proliferation of CD4 and CD8 T lymphocytes with anti-CD3/28 stimulation. We measured the expression of Ki-67 nuclear antigen, a marker selectively expressed in proliferating cells (Fig. 3 A and B). Marked reduction in the frequency of Ki-67⁺ T cells in patients was observed relative to healthy individuals, indicating diminished in vitro T cell proliferation in CVID patients.

Fig. 3.

T cell proliferation and function in CVID patients: PBMCs from patients CVID were stimulated with anti-CD3/CD28 conjugated dynabeads in presence of recombinant (r) IL-2 (30 U/ml) for 72 h followed by intracellular detection of Ki67. Lymphocytes were initially gated on the basis of their scatter profile (FSC/SSC) and further gated on CD4⁺ Ki67⁺ or CD8⁺ Ki67⁺ T cells. Cumulative data demonstrating the percentage of proliferating CD4 cells (A) and CD8 T cells proliferation (B) in CVID and healthy subjects. PBMCs of CVID patients as well as HCs were stimulated with anti-CD3/CD28 conjugated dynabeads for 48 h followed by intracellular detection of IFN-γ, IL-4, IL-17 and IL-9. Bar diagram is the cumulative data demonstrating percentage frequency of CD4⁺IFN-γ⁺ cells (C), CD8⁺IFN-γ⁺ cells (D) IL-4 producing CD4⁺T cells (E), CD4 ⁺ IL-17⁺ (F) and CD4⁺IL-9⁺ (G) in CVID patients relative to controls. (H) Measurement of soluble IL-9 in serum using ELISA. Data analyzed as mean ± SD (N = 10). Statistical analysis was done using Mann Whitney. P values <0.05 were considered significant (*** P < 0.0001; **P < 0.005; *P < 0.05). (PBMCs – Peripheral blood mononuclear cells, HC – Healthy Control, CVID – Common Variable Immune Deficiency)

To understand the perturbation in the T cell homeostasis in CVID, we performed a detailed analysis of T cell functions in terms of cytokine production which are critical players in orchestrating the immune response including B cell activation and class switching. Based on the cytokine profile, the T cell effector responses are classified into various types including Th-1, Th2, Th-17 and Th-9. For this purpose, PBMCs from HC and CVID patients were stimulated with anti-CD3/28 beads and investigated for Th1 (IFN-γ, TNF-α), Th-2 (IL-4), Th-9 (IL-9) and Th-17 (IL-17) associated cytokines.

Our results demonstrate no significant difference in the number of IFN-γ and TNF-α producing Th1 cells and cytotoxic T cells between the groups (Fig. 3 C, Supplementary Fig. 2A, Fig. 3 D). Similarly, we observed comparable frequency of IL-4 producing and IL-17 producing helper CD4 cells in CVID patients relative to healthy individuals (Fig. 3 E and F). Interestingly, we observed reduced proportion of IL-9 producing CD4 cells (Th-9) in CVID patients relative to HCs (Fig. 3 G). In concordance, the soluble IL-9 level was markedly reduced in CVID (Fig. 3 H). Next, we enumerated the IL10 producing Treg (CD4+ CD25+ FoxP3+) cells and found no significant difference in CVID patients and HCs (Supplementary Fig. 2B).

Our data demonstrate reduced level of IL-9 and Th-9 cells in CVID patients, which may be a clue for defective B cell function.

3.4. IL-9 influences B cell class switching

Taking cues from our results. Reduced proportion of Th-9 cells and soluble IL-9 in CVID patients, we intended to investigate the role of IL-9 on B cell class switching. For this purpose, PBMCs from HCs were stimulated with anti-CD40 mAb in presence / absence of recombinant (r)IL-9, and CSM (CD19⁺ CD27⁺ IgD^-) B cells were enumerated (Fig. 4 A and B). Similar culture in presence of IL-4 was taken as positive control for CSM B cells. We noted significant rise in the number of CSM B cells with anti-CD40 Mab stimulation in presence of rIL-9. The proportion of increase in CSM B cells in anti-CD40 with rIL-9 treated condition was comparable with the positive control (anti-CD40 mAb with rIL-4). Concordantly, soluble rise of IgG level was observed in presence of IL-9 with anti-CD40 mAB. (Fig. 4 C). From this observation, we concluded a definitive role of IL-9 in CSM B cells and IgG response suggesting that IL-9 has the potential to facilitate in vitro B cell class switching like its other cytokine members of γc family.

Fig. 4.

Impact of recombinant IL-9 on B cell class switching in healthy subjects: PBMCs from healthy individuals were stimulated with anti-CD40 Mab in presence of recombinant (r)IL-9 for 8 days followed by flow-cytometry based detection of CD19⁺CD27⁺IgD⁻ (class switched memory) cells and measurement of total IgG in the supernatant. Representative pseudocolor plots (A) and cumulative (B) showing increased in percentage frequency of class switched memory cells in B cells that were treated with recombinant (r) IL-9 along with anti-CD40 antibody. (C) Total IgG level at days 8 in culture supernatant were quantified by ELISA. Data analyzed as mean ± SD (N = 10). Statistical analysis was done using Mann Whitney. P values <0.05 were considered significant (*** P < 0.0001; **P < 0.005; *P < 0.05). (PBMCs = Peripheral blood mononuclear cells, Mab = monoclonal antibody, IL = interleukin).

3.5. IL-9 restores the class switched memory B cells in CVID

Intrigued by our results, we evaluated the impact of IL-9 on B cell class switching in CVID patients. PBMCs from ten CVID patients were stimulated with anti-CD40 in presence or absence of IL-9. Out of ten CVID patients, in nine patients, we observed increase in CSM (CD19⁺ CD27⁺ IgD^-) cells and IgG production with anti-CD40 stimulation in presence of IL-9 (Fig. 5A, B and C). In concordance, we observed increase in the ratio of IgG/IgM with IL-9 treatment in presence of anti-CD40 stimulation (Fig. 5D).

Fig. 5.

IL-9 induces B cell class switching in CVID patients: PBMCs from CVID patients were stimulated with anti-CD40 Mab in presence or absence of recombinant (r)IL-9 for 8 days followed by flowcytometry based detection of CD19⁺CD27⁺IgD⁻ (class switched memory) cells. At days 8, culture supernatant was removed and subsequently used for measurement of total IgG and IgM level. Representative pseudocolor plots (A) and cumulative plot (B) showing frequency of class switched memory B cells. (C) Total IgG level at days 8 in culture supernatant were quantified using ELISA. (D) Ratio of total IgG: total IgM level in the culture supernatant. (E) Relative expression of AICDA using realtime PCR. Data analyzed as mean ± SD. Statistical analysis was done using Mann Whitney. P values <0.05 were considered significant (N = 10; *** P < 0.0001; **P < 0.005; *P < 0.05).

To further elucidate the molecular mechanism involved in immunoglobulin production, we analyzed the expression of activation induced cytidine deaminase (AICDA). The expression of AICDA was upregulated in cells stimulated with rIL-9 and anti-CD40 indicating that CSR is induced by a combination of IL-9 and anti-CD40 stimulation in cells derived from patients with CVID (Fig. 5E).

In order to understand the mechanism by which IL-9 induces these effect on B cells, we stimulated the PBMCs with rIL-9 for 15, 30 and 60 min and quantified the phosphorylation of STAT1 (Tyr701), STAT3 (Tyr705), STAT5 (Y694) and AKT (ser-473) in B cells. We observed phosphorylation of STAT1, STAT3 and STAT5 after 15 min, which remained till 30 min (Supplementary Fig. 3). After 60 min, the phosphorylation of STAT1, STAT3 and STAT5 diminished. However, we failed to see any phosphorylation of AKT in B cells. These observations suggest that IL-9 mediate its effect on B cells through activation of STAT1, STAT3 and STAT5.

Together, our observation clearly suggests that in CVID patients, that IL-9 has the potential to mediate B cell class switching along with CD40 co-stimulation.

4. Discussion

The major hallmark of CVID is hypogammaglobulinemia due to defective CSM B cell formations. Pathogenic mechanisms underlying these defects are inconclusive. T cell help to B cells is crucial for CSM B cell formation and accordingly T cell abnormalities are considered to contribute to the pathogenesis of CVID. Diverse clinical presentation of CVID poses a major challenge in our understanding of its immune-pathogenesis of the CVID. In this study, we tried to decipher the T cell dysfunction involved in B cell activation and class switching in a group of patients with closely similar clinical manifestations.

Normal representation of peripheral B cells in CVID hints towards the possible defects in the B cell is confined to the B-cell differentiation (Naïve to Memory) and class switching resulting in the state of hypogammaglobulinemia. In accordance with the earlier report [37], we also observed marked reduction in CSM B cells (CD19 ⁺ CD27 ⁺ IgD^-) and non-switched memory B cells (CD19 ⁺ CD27 ⁺ IgD⁺). However, an increased percentage of naïve B cells (CD19 ⁺ CD27^-IgD⁺) was observed in CVID patients. Such profile of B cell phenotype is indicative towards perturbed/disturbed B cell maturation in CVID patients.

T cells provide help to B cells for maturation through direct interaction and cytokines. One of the essential elements to facilitate B cell maturation signal is CD40 ligand (CD154) expressed on activated T cells. Therefore, impairment of interaction between CD154 (T cells) and CD40 (B cells) may be an important factor underlying defect in CVID patients. This is supported by the report of Farrington et al, showing abnormality in the expression of CD154 in a subset of CVID patients [38]. Taking cues from this, we evaluated the expression of CD40 on B cells and CD154 on activated T cells in the peripheral blood of a group of patients with relatively homogeneous clinical manifestation. Our results indicate relatively intact expression of CD154 (T cells) and CD40 (B cells) in CVID patients thus hinting towards the intactness of the CD154-CD40 axis. We concluded that this receptor ligand interaction may not be a critical factor for rendering resistance to CSM B cell formation in CVID.

To understand the nature of plausible T cell defect among CVID, we evaluated the functions of T cells. We observed lower T cell proliferation capacity among CVID patients. Co-signaling molecules including costimulatory and coinhibitory molecules profoundly shape the outcome of T cell mediated immune response. In our present study, we have checked frequency of some co-stimulatory and co-inhibitory receptors like ICOS, OX40, 41BB, PD1 and CTLA4 on T cells (Data not shown). We did not observe any significant difference in the expression of ICOS, OX40, 41BB and PD1 between CVID patients and Healthy control. However, we observed a significantly higher frequency of CTLA expressing CD4 and CD8 cells in CVID patients compared to HC, which might explain the reduced T cells proliferation in our study cohort. To further characterize the functional T cell subsets, we looked at Th1, Th2, Th17 and Treg cell subsets and found no significant changes in the frequency in CVID patients. Interestingly, IL-9 producing T cells and IL-9 levels were markedly reduced in our study cohort of CVID patients with GI manifestation. Previously, Berrón-Ruiz et al had observed in a subgroup of CVID patients, reduced level of IL-9 in the supernatant of cells stimulated with Staphylococcal enterotoxin B (SEB) [39]. However, it would be interesting to compare the IL-9 levels and frequency of IL-9 producing T cells among CVID patients with diverse clinical features for better understanding of the impact of IL-9 on diseases manifestation. Presuming its possible role in pathogenesis of CVID, we aimed at elucidating the impact of IL-9 on CSM B cell formation.

Cytokines play a crucial role in the orchestration of protective and long-lived humoral immune response [40]. Much of our knowledge about the molecular mechanism underlying class switch recombination in B cells has been gained from the in vitro assay for B cell class switching. In vitro human B cells can be induced to undergo class switch recombination with anti- CD40 monoclonal antibody (mAb) or CD40 ligand (CD40L) in presence of exogenous cytokines, while anti-CD40 mAb (or CD40L) alone do not have any effect. Various cytokines including gamma chain (γc) family of cytokines like IL-4, IL-15, IL-21 have been shown to induce the in vitro isotype class switching in B cells [41–43]. Cytokines along with CD40 engagement has been described to play critical role in B cell class switching [44]. This along with our finding of reduced IL-9 and Th-9 cells among CVID patients encouraged us to see the effect of IL-9 supplementation along with CD40 engagement on CSM B cell formation. Indeed, impact of IL-9 was remarkable in inducing CSM B cells. IL-9 supplementation also promoted IgG production by CSM B cells derived from CVID patients. Additionally, we demonstrate that IL-9 activates STAT1, STAT3 and STAT5 on B cells. Mutational and deletion studies have revealed the importance of STAT1 and STAT3 in the formation of antigen specific memory B cells and STAT5 in cell survival [45–47]. It is possible that IL-9 mediated activation of STAT1 and STAT3 might help in generation of CSM B cells, whereas activation of STAT5 might help in cell survival. Therefore, our results indicate that IL-9 could restore the impaired class switching of B cells in CVID patients. However, in our study we have used PBMCs for checking the impact of IL-9 on B cell class switching, which precludes us from concluding whether the impact was a direct or indirect effect of IL-9. Systematic future studies with different B cell subset may provide mechanistic insight about the impact of IL-9 on B cell class switching and antibody production.

In summary, the results obtained from our CVID patient cohort with uniform clinical presentation demonstrates that i) CVID patients with GI manifestations have markedly reduced Th-9 and soluble IL-9 levels however our study did not suggest whether the reduction in IL-9 is primary or secondary in case of CVID indicating the limitation of the study, ii) ability of IL-9 supplementation (in conjunction with CD40 co-stimulation) to rescue the class switching of B cells. This suggests that B cells derived from CVID patients have intact molecular machinery necessary for class switching and IL-9 supplementation has the potential to facilitate B cell class switching.

Based on our observations, we conclude that IL-9 level may plays an important role in the pathogenesis of CVID, at least in some subset of patients and rescuing Th9 cells and/or supplementing IL-9 may be a potential immunotherapeutic strategy to restore the class switch memory B cells defect in CVID patients.

Supplementary Material

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.clim.2023.109697.

Abbreviations

CVID

Common variable immunodeficiency

CSM B cell

Class Switched Memory B cells

GI

Gastrointestinal

IgG

Immunoglobulin G

IL-9

Interleukin-9

IL-9R

IL-9 receptor

IFN-γ

Interferon gamma

PBMC

Peripheral blood mononuclear cells

Treg

Regulatory T cells

TNF-α

Tumour Necrosis Factor - alpha

Th

T helper.

Data availability

Data will be made available on request.