Abstract
Biallelic variants in TPRKB (TP53RK-binding protein) are known to cause Galloway–Mowat syndrome 5 (MIM#617731). It is a rare renal-neurologic disease characterized by early-onset nephrotic syndrome, facial dysmorphism, developmental delay, cerebral and cerebellar atrophy, and central nervous system white matter abnormalities. To date, four families with biallelic variants in TPRKB have been reported. We report two individuals from two unrelated families presenting with Galloway–Mowat Syndrome 5. Whole exome sequencing revealed a novel homozygous in-frame deletion, c.92_94del p.(Arg31del) in exon 2 of TPRKB (NM_016058.5) in both. In silico analysis of the TPRKB mutant protein showed alteration in the interactions with the neighboring residues due to Arg31 deletion, thus leading to altered protein conformation compared to the wild-type protein. Additionally, TPRKB mRNA levels were significantly reduced in the skin fibroblasts of proband 1. In addition, the phenotypic characteristics among GAMOS subtypes were reviewed.
Keywords: Galloway-Mowat Syndrome 5, in-frame deletion, microcephaly, TPRKB
Introduction
Galloway and Mowat described two individuals with severe microcephaly, nephrotic syndrome, and a large hiatus hernia in 1968, a combination of features later recognized as a syndrome bearing their names [1,2]. Galloway-Mowat syndrome (GAMOS) is a renal-neurological syndrome, characterized by early-onset nephrotic syndrome, developmental delay, and primary microcephaly [3]. Ataxia, seizures, retinal dysfunction, facial dysmorphisms, and skeletal anomalies such as arachnodactyly are among the variable clinical features [4]. Neuroimaging findings include, but are not limited to, cerebral and cerebellar atrophy, thin corpus callosum, cortical abnormalities, delayed myelination, and brain stem hypoplasia [5–7].
GAMOS5, caused by variants in the TPRKB gene (TP53RK binding protein; MIM *608680), was first described by Braun et al. in 2017 in two individuals presenting with early-onset steroid-resistant nephrotic syndrome (SRNS) and microcephaly [5]. Other features included facial dysmorphism, global developmental delay, spasticity, proteinuria, and on neuroimaging, cerebral atrophy and white matter abnormalities [5,8,9]. To date, biallelic variants in TPRKB have been reported in four unrelated families [5,8,9]. Herein, we describe two additional probands from two unrelated families with a novel homozygous in-frame deletion in TPRKB, thereby expanding the spectrum of GAMOS5.
Methods
Subject recruitment, clinical evaluation and genetic testing
Two probands from two unrelated families were recruited after obtaining informed consents approved by the institutional ethics committee (IEC 0363/2020 and IEC 488/2018). A detailed family and medical history were obtained followed by clinical evaluation. Genomic DNA was extracted (Qiagen, 51104) from the blood of probands and their parents. Singleton exome sequencing was performed for both. For proband 1, exonic and flanking genomic regions were captured using the Agilent SureSelect Clinical Research Exome v3 (CREv3) kit which was followed by sequencing on an Illumina NextSeq Platform (Illumina, San Diego, California, USA). Annotation of the raw data and variant prioritization was performed using an in-house filtering strategy as previously described [10]. Exome analysis was performed using the human reference genome GRCh38. The mean coverage depth was 104X with 97% of target bases covered at ≥20X. For proband 2, testing was carried out in a clinical sequencing lab using TWIST capture kit. Sanger sequencing was performed to validate and segregate the variant in the families. Further, published reports of all GAMOS subtypes describing the phenotypic characteristics of affected individuals were also reviewed and compared to GAMOS5.
Regions of Homozygosity (ROH) analysis
The VCF files from the two probands were analysed for runs of homozygosity (ROH) in autosomes using AutoMap v1.3 with default parameters and GRCh38 reference genome [11]. The minimum read depth threshold of ≥ 10 was used. Overlapping ROH regions between the two samples were identified using bedtools v2.31.1 and were analysed to infer shared ancestry, if any [12].
In silico mutagenesis
Multiple sequence alignment (MSA) was done using ClustalOmega. The protein structure, obtained from Protein Data Bank (PDB) (PDB ID: 3ENP; accessed on March 29th, 2024), was loaded into UCSF Chimera (v1.16). In silico mutagenesis of the TPRKB protein was performed using Chimera v1.16 [13]. Polar contacts around Arg31 were determined in the mutant protein and its neighboring amino acids compared to the wild-type protein.
Cell culture
Primary fibroblast cells were established using a skin biopsy from proband 1. The fibroblasts were cultured in Dulbecco's Modified Eagle Media (GibcoTM DMEM, cat. no. 10566016, Invitrogen), supplemented with 10% heat-inactivated fetal bovine serum (HiMedia), 100 μg/ml streptomycin (HiMedia), and 100 U/ml penicillin (HiMedia), at a temperature of 37°C with 5% CO2. Fibroblasts from an unrelated age-matched healthy child were used as the control in all the experiments.
Quantitative Reverse Transcription PCR
Total RNA was extracted from the fibroblasts of proband 1 and an unrelated control using TRIzol™ (Invitrogen, Waltham, Massachusetts, USA). Reverse transcription was performed using iScript™ Reverse Transcription Supermix (Biorad, California, USA) according to the manufacturer's protocol. qPCR was carried out using cDNA from proband 1 and control with an appropriate primer pair (forward: AGCTGGACCTATTTCCCGAATG and reverse: GAACTGCTTTGTTTGCTGCCA). qPCR Mastermix SYBR Green (Applied Biosystems, Waltham, Massachusetts, USA), 10 nM of each primer, and 20 ng of DNA were used to prepare a reaction master mix of 10 μl. All samples were run in duplicate on a QuantStudio 5 Real-Time PCR system (Applied Biosystems, Waltham, Massachusetts, USA), and data analysis was performed using the QuantStudio qPCR Data Analysis Software (Applied Biosystems, Waltham, Massachusetts, USA). GAPDH was used as an internal control for normalization of qPCR data.
Results
Clinical details
Proband 1
Proband 1 (P1) was first brought to medical attention at eight months of age. His parents noticed developmental delay and poor weight gain. He is a second-born male to a fourth-degree consanguineous couple. His birth weight was 3150g (+0.5SD) and the perinatal period was uneventful except for a history of hyperbilirubinemia, which required phototherapy. He could hold his neck, smile, and recognize his mother at the age of three months and roll over by five months. However, no other milestones were subsequently achieved. A brain imaging carried out at eight months, which showed mild cerebral atrophy, periventricular hyperintensities in the long white matter tracts and globus pallidus and delayed myelination. He was subsequently referred for genetics evaluation at 11 months of age (Figures 1A, 1C, 1E). On examination at 11 months, he had microcephaly [occipitofrontal circumference: 41 cm (−4.09 SD)] and failure to thrive [weight: 6.35 kg (−3.92 SD) and length: 73 cm (−0.6 SD)]. He had a narrow forehead, upslanting palpebral fissures, esotropia, large and everted ears, and lip-smacking. Neurological examination revealed increased tone, brisk deep tendon reflexes in both upper and lower limbs, and ankle clonus. Visual fixation and tracking were poor. Fundus evaluation and hearing assessment were unremarkable.
Figure 1.
Pedigree of (A) family 1 and (B) family 2. (C) Clinical photographs of the proband 1 showing microcephaly, small forehead, eyelid puffiness, broad bridge of nose, dysmorphic ears and mild micrognathia and (D) proband 2 showing microcephaly, prominent metopic ridge, mild lower eyelid puffiness, and dysmorphic ears. MRI of (E) the proband 1 and (F) the proband 2 showing delayed myelination and mild cerebral atrophy (yellow arrow), hyperintensities in globus pallidus (blue arrow). (E-iii) Proband 1 also had thin corpus callosum.
On follow-up at 1 year and 10 months of age, P1 had developed repetitive hand movements and atonic seizures, with no new milestones achieved. His liver and renal functions were normal (Serum creatinine: 0.31mg/dL; Range: 0.24-0.41 mg/dL, Urea: 15mg/dl; Range: 12 - 45 mg/dL). However, urine analysis showed proteinuria (2+) and hematuria (2+).
Proband 2
A 2-year-old female proband (P2), born to a non-consanguineous couple was evaluated for regression of milestones and progressive spasticity noted from 8 months of age (Figure 1B, 1D, and 1F). After an uneventful antenatal period, she was born at term with a birth weight of 2800g and cried immediately after birth. She was discharged from the hospital on day three of life without any significant perinatal events. She achieved neck holding at four months, rolling over at six months, and sitting with support at seven months of age, before regression of these milestones was noted. She also regressed in other developmental domains, including reaching out for objects (fine motor), babbling (language), and stopped responding to her parents (social).
On examination, at two years of age, her occipitofrontal circumference was 42 cm (-3.77SD), weight was 8.5kg (-3.62SD), and length was 81cm (-1.36SD), suggesting microcephaly and failure to thrive. Craniofacial features included curly hair, metopic prominence, mild lower eyelid edema, and large, everted ears. Hypertonia, exaggerated deep tendon reflexes, and ankle clonus were noted on neurological examination. She showed poor visual fixation and tracking. On neuroimaging, mild cerebral atrophy and delayed myelination were observed (Figure 1F). Brain evoked response auditory studies showed the presence of V peak up to 30dB with latency delay, suggestive of auditory maturation delay. Ophthalmic evaluation revealed a normal fundus with a dull foveal reflex and inability to follow post-fixation. The metabolic studies, ultrasonogram, and nerve conduction velocity test showed normal findings. The results of the biochemical analysis for proteinuria till the age of two years were negative and renal functions were normal. Table 1 compares the clinical features, biochemical parameters, brain imaging findings and variants in TPRKB observed in all GAMOS5 studies, including the current probands.
Table 1. Summary of phenotypic and genotypic characteristics of our probands and previously reported individuals with GAMOS5.
| Our study | Braun et.al (2017) | Kose et. al (2021) | Hiraide. et al (2024) | |||
|---|---|---|---|---|---|---|
| Proband | P1 | P2 | P3 | P4 | P5 | P6 |
| Country | India | India | Egypt | Europe | Turkey | Japan |
| Consanguinity | Yes | No | Yes | Yes | No | No |
| Gender | Male | Female | Male | Male | Female | Male |
| Variant/s in TPRKB (NM_016058.5) | c.92_94del | c.92_94del | c.407T>C | c.446A>G | c.[128C>T]; [355T>C] |
c.[224dup];[247C>T] |
| Amino acid change | p.(Arg31del) | p.(Arg31del) | p.(Leu136Pro) | p.Tyr149Cys | p.[(Ala43Val)]; [(Ser119Pro)] |
p.[(Ser76IlefsTer3)];[ (Leu83Phe)] |
| Exon | 2 | 2 | 4 | 5 | 2,4 | 3 |
| Zygosity | Hom | Hom | Hom | Hom | Compound heterozygous | Compound heterozygous |
| Age of onset | 8 months | 8 months | NA | NA | NA | 6 months |
| Developmental delay | Yes | Yes | Yes | Yes | NA | + |
| Developmental regression | No | Yes | NA | NA | NA | Yes |
| Microcephaly (SD) | Yes (-4.09SD) | Yes (-3.77 SD) | Yes | Yes | NA | Yes (-4.4SD) |
| Facial dysmorphism | Yes | Yes | Yes | Yes | NA | Yes |
| Vision & hearing | Poor visual tracking | Poor visual tracking; BERA showing maturation delay |
NA | NA | NA | Poor visual tracking - VEP bilaterally absent; BERA - normal |
| Deep Tendon Reflexes | Brisk | Brisk | NA | NA | NA | Brisk |
| Tone | Spasticity | Spasticity | Spasticity | Spasticity | NA | Hypotonia (upper limbs and trunk) and spasticity of the lower limbs |
| Others | Movement disorder, seizures | NA | NA | Coordination disorder, ataxia | NA | Dysphagia, seizures |
| Delayed myelination | Yes | Yes | Yes | NA | NA | Yes |
| Other brain imaging findings | Mild cerebral atrophy, hyperintensities involving the long white matter tracts and globus pallidus | Mild cerebral atrophy | Marked cerebral atrophy | Pachygyria, periventricular leukomalacia | NA | Marked cerebral atrophy |
| Proteinuria (onset) | Yes (1 year 10 months) |
No | Yes (4 years 5 months) | Yes (3 years 8 months) | NA | Yes (significant at 6 months; nephrotic range at 2 years 8 months) |
| Renal function at last evaluation | Normal | Normal | ESRD (6 years 5 months) | Normal | NA | Deranged |
BERA: Brainstem Evoked Response Audiometry, Hom: Homozygous, ESRD: End-stage renal disease, NA: Not available, SD: Standard deviation, VEP: visual evoked potentials. Note: Clinical details were unavailable for P5.
Genetic testing
Singleton exome sequencing revealed a novel homozygous in-frame deletion c.92_94del in exon 2 of TPRKB (NM_016058.5; NC_000002.12:g.73734476_73734478del) in probands 1 and 2 (Figure 2A). Sanger sequencing confirmed the variant in a homozygous state in them and in a heterozygous state in their parents. This variant is absent in homozygous and heterozygous state in population databases gnomAD v4.1.0 and our in-house database of 3087 exomes. It was classified as a variant of uncertain significance (PS3_supporting, PM2) as per the American College of Medical Genetics and Genomics guidelines. On analysis, no additional plausible pathogenic variants, including in other KEOPS complex genes, relevant to the probands’ clinical phenotype were identified.
Figure 2.
(A) Graphical illustration of TPRKB gene along with the variants reported till date including this study. (B) Multiple sequence alignment using Clustal Omega showed that Arginine (R) at 31 position was conserved across species. (C) In silico analysis revealed that in the wild-type protein (i) Arg31 has hydrogen bonds with Gly27 but due to the deletion of Arg31 in mutant protein (ii), Arg30 forms two bonds with Gly27 and loses its contact with Ala26 (D) Relative quantification of TPRKB mRNA levels by RT-qPCR revealed a significant reduction in TPRKB transcript levels in the proband 1; levels are normalized to GAPDH. Bars represent the mean ±SE (n = 3).
Regions of Homozygosity (ROH) analysis
On ROH analysis, it was observed that P1 has 413Mb and P2 has 32.59Mb of ROH. The TPRKB variant lies in 28.8Mb of ROH on chromosome 2 for P1 and 13.63Mb for P2. Both probands share 13.63Mb of ROH in chromosome 2, and the variant, TPRKB:c.92_94del, lies in this stretch (Supplementary file 1).
In silico analysis
We carried out MSA, which showed that Arginine at the 31st position was conserved across species (Figure 2B). Analysis of in silico mutagenesis of the TPRKB protein showed alterations in the interactions with the neighboring residues due to Arg31 deletion (Figure 2C). In the wild-type TPRKB protein, Arg30 has hydrogen bonds with Ala26 (2.990 Å), and Arg31 has hydrogen bonds with Gly27 (3.383 Å). In the mutant TPRKB protein, due to the deletion of Arg31, there was a loss of hydrogen bonds of Ala26, while Gly27 formed two new bonds with Arg30 (Arg30 NE – Gly27 O, 3.476 Å and Arg30 N – Gly27 O, 3.280 Å) (Figure 2C-ii).
Gene expression analysis
TPRKB mRNA levels were significantly reduced compared to the control fibroblasts (Figure 2D).
Discussion
GAMOS is a clinically and genetically heterogeneous disorder. The phenotypic features of all GAMOS subtypes show varying degrees of renal and brain involvement. Until 2017, WDR73 (GAMOS1, MIM#251300) was the only subtype described [14]. However, the current spectrum is expanded to include variants in ten genes as causative of various subtypes of GAMOS viz. LAGE3 [GAMOS2, MIM#301006], OSGEP [GAMOS3, MIM#617729], TP53RK [GAMOS4, MIM#617730], TPRKB [GAMOS5, MIM#617731], WDR4 [GAMOS6, MIM#618347], NUP107 [GAMOS7, MIM#618348], NUP133 [GAMOS8, MIM#618349], GON7 [GAMOS9, MIM#619603], and YRDC [GAMOS10, MIM#619609] [5,7,15–17]. Additionally, variants in PRDM15 (*617692) have recently been implicated in GAMOS-like phenotype [6]. All GAMOS subtypes are inherited in an autosomal recessive manner, except GAMOS2, which follows an X-linked inheritance pattern. The clinical features of all subtypes of GAMOS have been compared and summarized in Table 2.
Table 2. Summary of the phenotypic characteristics associated with all GAMOS sub-types. AR: Autosomal recessive; XL: X-linked, ESRD: End-stage renal disease, NA: Not applicable, ND: No data.
| GAMOS Type | GAMOS1 | GAMOS2 | GAMOS3 | GAMOS4 | GAMOS5 | GAMOS6 | GAMOS7 | ?GAMOS8 | GAMOS9 | GAMOS10 | - |
| Gene | WDR73 | LAGE3 | OSGEP | TP53RK | TPRKB | WDR4 | NUP107 | NUP133 | GON7 | YRDC | PRDM15 |
| Pattern of inheritance | AR | XL | AR | AR | AR | AR | AR | AR | AR | AR | AR |
| Developmental delay | Yes(56/59) | Yes (8/10) | Yes (43/57) | Yes (11/11) | Yes (5/5) | Yes (7/7) | Yes (8/21) | Ys (4/8) | Yes (11/11) | NA | Yes (3/6) |
| Intellectual disability | Yes(56/62) | Yes (6/10) | Yes (3/57) | Yes (4/4) | Yes (5/5) | Yes (7/7) | Yes (26/40) | Yes (4/4) | No | NA | No |
| Microcephaly | Yes (59/62) | Yes (8/10) | Yes (49/57) | Yes (11/11) | Yes (5/5) | Yes (7/7) | Yes (26/29) | Yes (2/7) | Yes (11/11) | Yes (4/4) | Yes (2/6) |
| Dysmorhology | Yes (13/62) | Yes (6/10) | Yes (42/47 | Yes (10/11) | Yes (5/5) | Yes (2/7) | Yes (10/14) | Yes (2/8) | No | Yes (4/4) | Yes (4/6) |
| Tone | Spasticity (44/56) | Spasticity (1/10) Hypotonia (6/10) |
Spasticity (6/44) Hypotonia (23/44) | Spasticity (2/11) Hypotonia (5/11) | Spasticity (5/5) | ND | ND | Hypotonia (4/8) | ND | Hypotonia (1/4) | Hypotonia (1/6) |
| Seizures | Yes (20/56) | Yes (3/10) | Yes (20/45) | Yes (2/11) | Yes (2/5) | No | ND | Yes (3/8) | ND | Yes (1/4) | Yes (1/6) |
| Neuroimaging abnormalities | Yes (27/28) Include ventriculom egaly, cerebral and cerebellar atrophy, brainstem hypoplasia, gyral abnormaliti es and hypomyelin ation | Yes (6/10) include hypomyelination, cerebral atrophy, cerebellar atrophy and hypoplasia poly microgyria and thin corpus callosum. | Yes (25/40 include cerebral atrophy, myelination defects, gyral abnormalities and thin corpus callosum | Yes (11/11) Include cerebral atrophy, cerebellar atrophy and hypoplasia, myelination defects. | Yes (5/5) include cerebral atrophy. | Yes (2/7) include cerebellum atrophy. | Yes (2/59) include simplified gyral pattern and underdeveloped frontal lobes | Yes (3/7) include cerebral atrophy and hypomyelina tion | Yes (9/9) include cerebral and cerebellar atrophy, hypomyelination, and thin corpus callosum. | Yes (2/2) include cerebral and cerebellar atrophy and myelination defects. | Yes (4/6) include cerebral and cerebellum atrophy, cerebral hypoplasia, myelin defects and abnormal gyration. |
| Renal abnormalities | Proteinuria (30/55) Nephrotic syndrome (19/55) | Proteinuria (10/10) Nephrotic syndrome (9/10) | Proteinuria (48/50) Nephrotic syndrome (43/50) ESRD (13/32) | Proteinuria (8/11) Nephrotic syndrome (6/11) | Proteinuria (4/5) Nephrotic syndrome (3/5) ESRD (1/5) | Proteinuria (3/7) Nephrotic syndrome (2/7) | Proteinuria (54/58) Nephrotic syndrome (48/58) ESRD (30/58) | Proteinuria (7/7) Nephrotic syndrome (7/8) ESRD (8/8) | Proteinuria (11/11) Nephrotic syndrome (6/11) ESRD (8/8) | Proteinuria (4/4) Nephrotic syndrome (4/4) ESRD (4/4) | Proteinuria (6/6) Nephrotic syndrome (2/6) ESRD (1/6) |
| Skeletal abnormalities | Yes (4/62) | Yes (4/10) | Yes (36/46) | Yes (1/11) | No | Yes (2/7) | Yes (5/59) | No | Yes (3/11) | Yes (4/4) | Yes (4/6) |
| Others | Ocular abnormalities (52/60) | Intrauterine growth retardation (2/10) Ocular abnormalities (2/10) Endocrine Abnormalities (2/10) | Failure to thrive (10/51) Intrauterine growth retardation (19/32) | Intrauterine growth retardation (2/11) | Ocular abnormalities (3/5) | Endocrine Abnormaliti es(5/7) Behavioural abnormalities(2/7) Hearing abnormalities(1/7) | Cardiac abnormalities (4/59) | Hearing abnormalities (2/8) | Gastrointest inal abnormalities (3/11) Hearing abnormalities (1/11)) | Endocrine Abnormalities (4/4) | Cardiac abnormalities (3/6) Ocular abnormalities (4/6) Endocrine Abnormalities (1/6) Hearing abnormalities (1/6) |
Four subtypes of GAMOS are caused due to variants in genes encoding components of the KEOPS complex (GAMOS2, GAMOS3, GAMOS4 & GAMOS5). Of these subtypes, GAMOS5 is caused by bi-allelic disease-causing variants in TPRKB in an extremely rare and recently described condition with only four families reported till date.
Neurological manifestations account for the most common and debilitating features in individuals with GAMOS. Individuals with GAMOS5 consistently present with significant microcephaly, developmental regression, and progressive spasticity [5,9]. Seizures, as observed in proband 1 are described in GAMOS5 [9] and few other subtypes of GAMOS (Table 2) [5,18,19]. Extrapyramidal movement disorder seen in two individuals with GAMOS5 is a frequent manifestation in GAMOS1 and has been reported in 60% (37/62) individuals with this condition (Supplementary file 2) [19]. Neuroimaging abnormalities are also commonly observed in individuals with GAMOS (Table 2). As seen in our probands, deep cerebral white matter abnormalities and brain atrophy are the most reported neuroimaging findings in GAMOS5. However, finding of cerebellar involvement with cerebellar atrophy is one of the predominant neuroimaging findings in other GAMOS types (Table 2) [4,7,19,20].
Renal involvement in GAMOS includes variable amounts of proteinuria, frequently relapsing nephrotic syndrome, steroid-resistant nephrotic syndrome, and end-stage renal disease (ESRD). The nephrotic syndrome is frequently congenital or infantile-onset, treatment-resistant, progressing to ESRD and death. Renal biopsy findings include focal segmental glomerulosclerosis and diffuse mesangial sclerosis, with electron microscopy showing podocyte effacement. The onset of renal abnormalities in previously reported individuals with GAMOS5 varied from six months to 4 years of age [5,9]. Also, in few other types of GAMOS such as GAMOS1 and GAMOS9, the renal dysfunction is of later onset, ranging from 2 years to 8 years of age [7,17]. In the current study, P1 developed proteinuria at 1 year 10 months. However, P2 did not have any renal dysfunction till the last exam at 2 years of age. Both the probands with GAMOS5 described by Braun et al. (2017) too had late-onset proteinuria, emphasizing the need for frequent surveillance for renal disease [5]. Late-onset proteinuria is also reported in other GAMOS subtypes i.e. GAMOS1 and GAMOS9 [7,17]. GAMOS without renal involvement has been reported in only one individual who died at the age of 2 years 6 months with GAMOS3 [21].
Hearing impairment is one of the uncommon features in GAMOS reported in a few individuals with GAMOS6, GAMOS8 and GAMOS9 [16,17,22]. In our study, impaired hearing was noted in proband 2 and in one of the previously reported individuals with GAMOS5 as well [5]. The poor visual fixation observed in both probands has been previously reported in an individual with GAMOS5. Other ophthalmic abnormalities are reported in individuals with GAMOS1 and GAMOS6 [4,23]. Previously, retinopathy has been reported in individuals with GAMOS1 [4,20]. Though our probands and the proband reported by Hiraide et al. (2024) exhibited poor visual tracking, no retinopathy was observed in either of them [9]. Skeletal anomalies like arachnodactyly and contractures have been reported in all other subtypes except GAMOS5 and GAMOS8. Consistent with previous reports, no skeletal abnormalities were identified in our probands with GAMOS5 (Table 2).
TPRKB gene (MIM*608680) is located at 2p13.2 (Chr2:73729104-73737400) and has seven exons (Figure 2A). It encodes for TPRKB (TP53RK binding protein), a component of the evolutionarily conserved KEOPS (Kinase, Endopeptidase, and Other Proteins of Small Size) complex [24]. This complex plays a crucial role in modifying transfer RNA (tRNA) through the addition of N6-threonyl carbamoyl adenosine (t6A), a universally conserved chemical modification, necessary for proper ribosomal translation and normal cellular growth [25–29]. The function of the KEOPS complex has been extensively studied in budding yeast, which shows that deletion of any single KEOPS gene results in a variety of damaging phenotypes including impaired growth, telomere shortening, and transcriptional defects [28,30–32]. However, the precise role of TPRKB in the KEOPS complex is still unknown. Braun et al. (2017) showed that the knockdown of TPRKB in human podocyte cell lines resulted in increased DDR signaling, cell cycle arrest, followed by induction of cell apoptosis due to severe DNA damage [5].
Till date, seven variants in TPRKB have been reported, causing GAMOS5 (Table 2, Figure 2A). Earlier, structural analysis of TPRKB revealed that missense variants, p.(Leu136Pro) and p.(Tyr149Cys) might affect interaction of TPRKB and TP53RK [25]. Immunostaining of γH2AX in patient fibroblasts carrying the p.(Tyr149Cys) variant was shown to have elevated levels of γH2AX compared to control fibroblasts, suggesting that this variant may impair genome stability as well as cellular DNA damage response [5]. In silico analysis carried out for the variant p.(Arg31del) in our study showed that it is likely to disrupt the intramolecular interactions within TPRKB protein, potentially altering its overall conformation (Figure 2B). The change in conformation is likely to disrupt interactions within the subunits of KEOPS complex and possible impairment of the overall KEOPS complex function.
We observed that TPRKB mRNA levels were significantly reduced in patient fibroblasts. Previously, TPRKB knockout mice have been shown to present with primary microcephaly and died by 18th day post fertilization [5]. The authors also showed that knockdown of TPRKB in zebrafish larvae and mouse embryos led to microcephaly and early death. Notably, zebrafish and mouse models did not replicate a renal phenotype. Thus, we speculate that the in-frame deletion, c.92_94del p.(Arg31del) is a loss of function variant corroborating with the underlying disease mechanism of GAMOS5. Based on significantly reduced TPRKB mRNA levels in patient fibroblasts, the variant could be reclassified as likely pathogenic (PS3_moderate, PM2, PM4, PP3).
In conclusion, we report two unrelated individuals with a novel homozygous in-frame deletion in TPRKB, expanding the spectrum of GAMOS5. A continued renal surveillance is required to look for onset of renal involvement in the asymptomatic proband. Further studies are required to gain deeper insights into the role of TPRKB, establish genotype–phenotype correlation, and understand the disease progression with TPRKB variants.
Supplementary Material
Acknowledgements
We thank the families for participating in the study. We also thank the National Institutes of Health, USA, for funding the project titled ‘Genetic Diagnosis of Neurodevelopmental Disorders in India’ (1R01HD093570-01A1) and DBT/Wellcome Trust India Alliance for funding the study, “Centre for Rare Disease Diagnosis, Research and Training” (IA/CRC/20/1/600002).
Funding
Anju Shukla: National Institutes of Health (US) (1R01HD093570-01A1) and DBT/Wellcome Trust India Alliance (IA/CRC/20/1/600002).
Footnotes
Statement and Declarations
The authors have no relevant financial or non-financial interests to disclose.
Competing Interest declaration
The authors declare no competing interests.
Data availability
The variant c.92_94del p.(Arg31del) in TPRKB has been submitted to ClinVar and is available under accession [SCV004242315.2].
References
- 1.Galloway WH, Mowat AP. Congenital microcephaly with hiatus hernia and nephrotic syndrome in two sibs. J Med Genet. 1968 Dec;5(4):319–21. doi: 10.1136/jmg.5.4.319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cohen AH, Turner MC. Kidney in Galloway-Mowat syndrome: Clinical spectrum with description of pathology. Kidney International. 1994 May;45(5):1407–15. doi: 10.1038/ki.1994.184. [DOI] [PubMed] [Google Scholar]
- 3.Ekstrand JJ, Friedman AL, Stafstrom CE. Galloway-Mowat Syndrome: Neurologic Features in Two Sibling Pairs. Pediatric Neurology. 2012 Aug;47(2):129–32. doi: 10.1016/j.pediatrneurol.2012.04.011. [DOI] [PubMed] [Google Scholar]
- 4.Al-Rakan MA, Abothnain MD, Alrifai MT, Alfadhel M. Extending the ophthalmological phenotype of Galloway-Mowat syndrome with distinct retinal dysfunction: a report and review of ocular findings. BMC Ophthalmol. 2018 Jun 22;18(1):147. doi: 10.1186/s12886-018-0820-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Braun DA, Rao J, Mollet G, Schapiro D, Daugeron MC, Tan W, et al. Mutations in KEOPS-complex genes cause nephrotic syndrome with primary microcephaly. Nat Genet. 2017 Oct;49(10):1529–38. doi: 10.1038/ng.3933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Mann N, Mzoughi S, Schneider R, Kühl SJ, Schanze D, Klämbt V, et al. Mutations in PRDM15 Are a Novel Cause of Galloway-Mowat Syndrome. J Am Soc Nephrol. 2021 Mar;32(3):580–96. doi: 10.1681/ASN.2020040490. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Rosti RO, Dikoglu E, Zaki MS, Abdel-Salam G, Makhseed N, Sese JC, et al. Extending the mutation spectrum for Galloway-Mowat syndrome to include homozygous missense mutations in the WDR73 gene. Am J Med Genet A. 2016 Apr;170A(4):992–8. doi: 10.1002/ajmg.a.37533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kose M, Isik E, Aykut A, Durmaz A, Kose E, Ersoy M, et al. The utility of next-generation sequencing technologies in diagnosis of Mendelian mitochondrial diseases and reflections on clinical spectrum. Journal of Pediatric Endocrinology and Metabolism. 2021 Apr 27;34(4):417–30. doi: 10.1515/jpem-2020-0410. [DOI] [PubMed] [Google Scholar]
- 9.Hiraide T, Hayashi T, Ito Y, Urushibata R, Uchida H, Kitagata R, et al. Case Report: Novel compound heterozygous TPRKB variants cause Galloway-Mowat syndrome. Front Pediatr. 2024 Apr 3;12:1360867. doi: 10.3389/fped.2024.1360867. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kaur N, Arora K, Radhakrishnan P, Narayanan DL, Shukla A. Intragenic homozygous duplication in HEPACAM is associated with megalencephalic leukoencephalopathy with subcortical cysts type 2A. Neurogenetics. 2024 Jan 27; doi: 10.1007/s10048-024-00743-1. [DOI] [PubMed] [Google Scholar]
- 11.Quinodoz M, Peter VG, Bedoni N, Royer Bertrand B, Cisarova K, Salmaninejad A, et al. AutoMap is a high performance homozygosity mapping tool using next-generation sequencing data. Nat Commun. 2021 Jan 22;12(1):518. doi: 10.1038/s41467-020-20584-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 2010 Mar 15;26(6):841–2. doi: 10.1093/bioinformatics/btq033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, et al. UCSF Chimera—A visualization system for exploratory research and analysis. J Comput Chem. 2004 Oct;25(13):1605–12. doi: 10.1002/jcc.20084. [DOI] [PubMed] [Google Scholar]
- 14.Colin E, Huynh Cong E, Mollet G, Guichet A, Gribouval O, Arrondel C, et al. Loss-of-Function Mutations in WDR73 Are Responsible for Microcephaly and Steroid-Resistant Nephrotic Syndrome: Galloway-Mowat Syndrome. The American Journal of Human Genetics. 2014 Dec;95(6):637–48. doi: 10.1016/j.ajhg.2014.10.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Braun DA, Shril S, Sinha A, Schneider R, Tan W, Ashraf S, et al. Mutations in WDR4 as a new cause of Galloway–Mowat syndrome. American J of Med Genetics Pt A. 2018 Nov;176(11):2460–5. doi: 10.1002/ajmg.a.40489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Fujita A, Tsukaguchi H, Koshimizu E, Nakazato H, Itoh K, Kuraoka S, et al. Homozygous splicing mutation in NUP13 3 causes Galloway–Mowat syndrome. Annals of Neurology. 2018 Dec;84(6):814–28. doi: 10.1002/ana.25370. [DOI] [PubMed] [Google Scholar]
- 17.Arrondel C, Missoury S, Snoek R, Patat J, Menara G, Collinet B, et al. Defects in t6A tRNA modification due to GON7 and YRDC mutations lead to Galloway-Mowat syndrome. Nat Commun. 2019 Sep 3;10(1):3967. doi: 10.1038/s41467-019-11951-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Pezzella M, Yeghiazaryan NS, Veggiotti P, Bettinelli A, Giudizioso G, Zara F, et al. Galloway–Mowat syndrome: An early-onset progressive encephalopathy with intractable epilepsy associated to renal impairment. Two novel cases and review of literature Seizure. 2010 Mar;19(2):132–5. doi: 10.1016/j.seizure.2009.12.002. [DOI] [PubMed] [Google Scholar]
- 19.Jinks RN, Puffenberger EG, Baple E, Harding B, Crino P, Fogo AB, et al. Recessive nephrocerebellar syndrome on the Galloway-Mowat syndrome spectrum is caused by homozygous protein-truncating mutations of WDR73. Brain. 2015 Aug;138(Pt 8):2173–90. doi: 10.1093/brain/awv153. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Vodopiutz J, Seidl R, Prayer D, Khan MI, Mayr JA, Streubel B, et al. WDR73 Mutations Cause Infantile Neurodegeneration and Variable Glomerular Kidney Disease. Human Mutation. 2015 Nov;36(11):1021–8. doi: 10.1002/humu.22828. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Chen J, Ye GB, Huang JR, Peng M, Gu WY, Xiong P, et al. Novel TP53RK variants cause varied clinical features of Galloway–Mowat syndrome without nephrotic syndrome in three unrelated Chinese patients. Front Mol Neurosci. 2023 Feb 16;16:1116949. doi: 10.3389/fnmol.2023.1116949. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Teng H, Liang C, Liang D, Li Z, Wu L. Novel variants in OSGEP leading to Galloway-Mowat syndrome by altering its subcellular localization. Clinica Chimica Acta. 2021 Dec;523:297–303. doi: 10.1016/j.cca.2021.10.012. [DOI] [PubMed] [Google Scholar]
- 23.Shaheen R, Abdel-Salam GMH, Guy MP, Alomar R, Abdel-Hamid MS, Afifi HH, et al. Mutation in WDR4 impairs tRNA m7G46 methylation and causes a distinct form of microcephalic primordial dwarfism. Genome Biol. 2015 Dec;16(1):210. doi: 10.1186/s13059-015-0779-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Wan LCK, Maisonneuve P, Szilard RK, Lambert JP, Ng TF, Manczyk N, et al. Proteomic analysis of the human KEOPS complex identifies C14ORF142 as a core subunit homologous to yeast Gon7. Nucleic Acids Res. 2017 Jan 25;45(2):805–17. doi: 10.1093/nar/gkw1181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Li J, Ma X, Banerjee S, Chen H, Ma W, Bode AM, et al. Crystal structure of the human PRPK-TPRKB complex. Commun Biol. 2021 Feb 5;4(1):167. doi: 10.1038/s42003-021-01683-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Srinivasan M, Mehta P, Yu Y, Prugar E, Koonin EV, Karzai AW, et al. The highly conserved KEOPS/EKC complex is essential for a universal tRNA modification, t6A. EMBO J. 2011 Mar 2;30(5):873–81. doi: 10.1038/emboj.2010.343. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Wan LCK, Mao DYL, Neculai D, Strecker J, Chiovitti D, Kurinov I, et al. Reconstitution and characterization of eukaryotic N6-threonylcarbamoylation of tRNA using a minimal enzyme system. Nucleic Acids Research. 2013 Jul 1;41(12):6332–46. doi: 10.1093/nar/gkt322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Pollo-Oliveira L, Klassen R, Davis N, Ciftci A, Bacusmo J, Martinelli M, et al. Loss of Elongator- and KEOPS-Dependent tRNA Modifications Leads to Severe Growth Phenotypes and Protein Aggregation in Yeast. Biomolecules. 2020 Feb 18;10(2):322. doi: 10.3390/biom10020322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Costessi A, Mahrour N, Sharma V, Stunnenberg R, Stoel MA, Tijchon E, et al. The human EKC/KEOPS complex is recruited to Cullin2 ubiquitin ligases by the human tumour antigen PRAME. PLoS One. 2012;7(8):e42822. doi: 10.1371/journal.pone.0042822. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Downey M, Houlsworth R, Maringele L, Rollie A, Brehme M, Galicia S, et al. A Genome-Wide Screen Identifies the Evolutionarily Conserved KEOPS Complex as a Telomere Regulator. Cell. 2006 Mar;124(6):1155–68. doi: 10.1016/j.cell.2005.12.044. [DOI] [PubMed] [Google Scholar]
- 31.Kisseleva-Romanova E, Lopreiato R, Baudin-Baillieu A, Rousselle JC, Ilan L, Hofmann K, et al. Yeast homolog of a cancer-testis antigen defines a new transcription complex. EMBO J. 2006 Aug 9;25(15):3576–85. doi: 10.1038/sj.emboj.7601235. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Daugeron MC, Lenstra TL, Frizzarin M, El Yacoubi B, Liu X, Baudin-Baillieu A, et al. Gcn4 misregulation reveals a direct role for the evolutionary conserved EKC/KEOPS in the t6A modification of tRNAs. Nucleic Acids Research. 2011 Aug 1;39(14):6148–60. doi: 10.1093/nar/gkr178. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The variant c.92_94del p.(Arg31del) in TPRKB has been submitted to ClinVar and is available under accession [SCV004242315.2].