Skip to main content
G3: Genes | Genomes | Genetics logoLink to G3: Genes | Genomes | Genetics
. 2020 Sep 10;10(11):4159–4165. doi: 10.1534/g3.120.401689

Genetic and Physical Localization of the Gene Controlling Leaf Pigmentation Pattern in Medicago truncatula

Xiaocheng Yu 1, Qiulin Qin 1, Xia Wu 1, Dandan Li 1,1, Shengming Yang 1,1,2,3,4
PMCID: PMC7642937  PMID: 32912932

Abstract

In Medicago truncatula, some ecotypes form a black or purple stain in the middle of adaxial leaf surface due to accumulation of anthocyanins. However, this morphological marker is missing in some other ecotypes, although anthocyanin biosynthesis pathway is not disrupted. Genetic analysis indicated that the lack of the leaf spot of anthocyanins accumulation is a dominant trait, which is controlled by a single gene, LPP1. Genetic mapping indicated that the LPP1 gene was delimited to a 280 kb-region on Chromosome 7. A total of 8 protein-coding genes were identified in the LPP1 locus through gene annotation and sequence analysis. Of those, two genes, putatively encoding MYB-transcriptional suppressors, were selected as candidates for functional validation.

Keywords: Anthocyanin biosynthesis, M. truncatula, Genetic mapping, leaf pigmentation


Medicago truncatula is a model legume plant closely related to alfalfa (Medicago sativa), one of the most important forage crops worldwide. Due to its diploidy, small and deeply sequenced genome, abundance of natural variation and efficacy of gene transformation, M. truncatula has been widely used for genomic studies that are legume-specific, such as gene discovery in nodule symbiosis signaling (Cook 1999). The genome data of M. truncatula has also been translated to alfalfa improvement in disease resistance, forage quality, biomass yield and abiotic stress tolerance (Yang et al. 2008; Yang et al. 2013; Peng et al. 2018; Zhou et al. 2011b). In addition, M. truncatula has been a subject for studies of molecular mechanisms underlying organogenesis of leaf, flower, seed and root tissues (Franssen et al. 2015; Zhou et al. 2011a; Le Signor et al. 2018; Cheng et al. 2018). Some unique morphological traits, such as leaf pigmentation and pod helical coiling, make M. truncatula a special model plant for developmental studies.

Particularly at the seedling stage, plants of some M. truncatula accessions are characterized by a black or purple stain in the middle of the adaxial leaf surface, which results from the accumulation of anthocyanins. Among the flavonoids, anthocyanins are water-soluble vacuole pigments with strong antioxidant activities. Not only in leaves, anthocyanins are also accumulated in the stem, flower and seed coat. They can provide plants with bright flower colors for attracting pollinators and offer protection from microbial pathogens, insects and high light/UV-damage (Mouradov and Spangenberg 2014; Koes et al. 2005). Anthocyanins have also been recognized for their beneficial health effects on human chronic diseases due to their strong antioxidant activities (Khurana et al. 2013).

In Arabidopsis, anthocyanins and proanthocyanidins (PAs; also known as condensed tannins) share early steps in their biosynthetic pathways, but diverge after formation of anthocyanidin, the precursor of both anthocyanins and PAs. Expression of enzymes involved in anthocyanin and PA biosynthesis is regulated by MBW, a complex of transcription factors composed of R2R3-MYB, basic helix-loop-helix (bHLH), and WD40 repeat proteins(Gonzalez et al. 2008). The functional orthologs of the MBW complex components have been identified in M. truncatula. One R2R3-MYB protein known to regulate only anthocyanin biosynthesis in M. truncatula is MtLAP1 (Peel et al. 2009), while three (MtPAR, MtMYB14, and MtMYB5) have been shown to be involved in PA biosynthesis (Verdier et al. 2012; Liu et al. 2014). Screening of mutants with altered pigmentation patterns introduced by Tnt1 retrotransposon insertion led to the cloning of MtWD40-1 and MtTT8 (a bHLH gene), which are involved in both the PA and anthocyanin pathways (Pang et al. 2009; Li et al. 2016).

Interestingly, although disruption of MBW or other genes results in the disappearance of leaf pigmentation in M. truncatula accessions which have this morphological marker (Pang et al. 2009; Li et al. 2016; Carletti et al. 2013), genetic analysis with natural variation indicates that the lack of the leaf spot from anthocyanin accumulation is a dominant trait (Penmetsa and Cook 2000). The absence of this leaf marking is controlled by a single gene, which has not been identified or characterized yet.

In the present study, we finely mapped the gene regulating accumulation of anthocyanins in leaves (namely LPP1 for Leaf Pigmentation of Anthocyanins 1). The LPP1 gene was located on the chromosome 7. Sequence analysis and gene annotation enabled selection two MYB-transcription factor genes as candidates of LPP1.

Materials and methods

The mapping population

The M. truncatula genotype Jemalong A17 (A17 hereafter) displays the leaf marking, whereas A20 and F3005.5 (F83005 hereafter) exbibits the opposite phenotype on leaves. Three different segregating populations were used for genetic mapping of the LPP1 gene. Of those, 129 recombinant inbred lines (RILs) and 269 F2s were derived from a cross between the M. truncatula genotypes A17 and A20, and 203 F2s were derived from A17 × F83005. The phenotype of F2 recombinants were confirmed with at least 30 F3 plants. Seedlings of parents and the segregating populations were grown in a growth room with a 16 h light, 23°/8 h dark, 20° regime.

Phenotyping of leaf pigmentation

Leaf pigmentation pattern was visually determined three weeks after seed germination, which was double confirmed one week afterward.

Marker development and genetic mapping

CAPS (cleaved amplified polymorphic sequences) markers were developed based on SNPs (single nucleotide polymorphisms) identified between the two parents (Li et al. 2014). DNA sequencing-PCR was conducted with the Dye Terminator Cycle Sequencing (DTCS) Quick Start Kit (Beckman Coulter). After ethanol precipitation and purification, the PCR product was resuspended with 40µl Sample Loading Solution (SLS, Beckman Coulter) before loading into the sequencing instrument (CEQ8000 Genetic Analysis System, Beckman Coulter). The genetic map was constructed using the software JoinMap version 3.0 (You et al. 2010). All markers used in this study are given in Table 1.

Table 1. Sequences and locations for primers used in genetic mapping of LPP1.

Marker name Position Forward primer Reverse primer Restriction enzymes to distinguish A17 and A20 alleles Restriction enzymes to distinguish A17 and F83005 alleles
M1 12086486...12087011 TCATCAATTCCGTCCAACAA TATCCCTCGCGTATCCTCAC Hpy188I No polymorphism
M2 12109541...12109966 AAATGGGAATGGATGGTTGA ACTTGCATTGAAGGGGTGAC AflIII HinCII
M3 12816505...12816917 GTAGTCGCCCATCATTGGTC GAAACCGTCCTCGTTGATACA TaqI Dominant
M4 12971231...12971706 CCTGTGCGATTGAAGTTGTTT GCAATATTCCCTGAGCCAAG HinfI Hpy188I
M5 13100151...13100643 CAATGGCACAATGGGTAAAA CGGTGAGGAAAGAAAGTTAGAGA AvaII HincII
M6 13170690...13171159 CCTGGCGAGTTTTGTTTTGT AAAATGCAAATGCAACGACA Tsp509I BtgI
M7 13291032...13291523 GAGCTTCCAAATACCCTTTCAA TGCTAGCTTCCATGTTGTGC BglII AflII
M8 13294389...13294915 CTGGCGTAGAGGATCACTGG TGGGGGTGGTGAGAACTCTA ApoI ApoI
M9 13298918...13299373 GTGATGTTCCACTTCAACACG CATATCATAATAATGGGGGTTGG PshAI PshAI
M10 13309086...13309536 AAAGTGGCCACCACAGTAGG GAGAGGGAGAGGGGAGAATG AseI StyI
M11 13487194...13487665 AATGACCACTGGGGGTTAGA CGGTGATAATGATTTCCTTGC BclI No polymorphism
M12 13581669...13582122 CCGAAGCTTGTGGACAATTA CCACCGGTCACTGTCCTATT BstYI BstYI
M13 13606833...13607293 TTGGTTGGAAATAAGTGTCAAGG CCAAACAAGGGTAAACCAACA AflIII/ DraI
M14 13714308...13714799 CATCGACCTTGATAGCCACA AGTGCAGACGCTTACCACAA HpyCH4V HpyCH4V
M15 13807044...13807513 GAAAGCCACCGGTCAGAGTA CCTTGGACGAATAATTGAGACA Size polymorphism Size polymorphism
M17 13854196...13854645 AATACCAAATGGAGGGTGGA ATAAAGGCACAATTGGCAAAC Size polymorphism Size polymorphism
M18 13856315...13856782 TGTTCACTTCCAAAGGATTTCA GGCATGACTATGTGGGACCT Size polymorphism Size polymorphism
M20 14304994...14305467 AACCTCTAAACGGCCAAGGT GTGCAGGAGCATCAGACAAA Size polymorphism Size polymorphism
M21 14552501...14552956 CGCAGAGGATACCCGTTTAC CAAGTTGGGAAAATAGGGTGTT No polymorphism BsaBI

Genomic PCR analysis

Genomic DNA was isolated using the CTAB method and used for PCR with Taq DNA polymerase (New England Biolab). The thermal amplification program was as follows: denaturation at 95° for 2 min, followed by 35 cycles of 94° for 30 s, 55° for 30 s, and 72° for 60 s, with a final extension at 72° for 5 min.

Physical mapping and sequence analysis

The genome sequence of M. truncatula Mt4.0 was used for marker identification and physical mapping (Tang et al. 2014). Gene prediction and annotation provided by the M. truncatula genome database (http://www.medicagogenome.org) was confirmed with the programs FGENESH and Pfam 32.0, respectively (Bateman et al. 2004; Solovyev and Salamov 1997).

Phylogenetic analysis

Full-length protein sequences of 26 Myb transcription factors involved in anthocyanin biosynthesis and the allelic coding products of candidate genes were aligned using the Clustal X program (Larkin et al. 2007) (Table S1). NJplot was used to construct the phylogenetic tree. The bootstrap consensus tree inferred from 1,000 replicates was taken to represent the similarity of the analyzed protein sequences. Evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura et al. 2011) and are presented as the number of amino acid (aa) substitutions per site.

Real-time PCR (qRT-PCR) analysis

RNA isolated from young leaves and flowers of M. truncatula plants was used for qRT-PCR analysis for the candidate genes with four replicates, and each biological replicate consisted of tissues from at least 5 plants. Young leaves were sampled from seedlings three weeks after gemination. Open flowers were collected when they were in full bloom. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). First-strand cDNA was synthesized using M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Fluorescent PCR amplifications were performed in triplicate using the StepOne real-time PCR system (Applied Biosystems, Grand Island, NY, USA). Aliquots of each first strand cDNA (2 µL), equivalent to 20 ng of total RNA, were used for PCR amplification in 20 µL reactions containing 2 μL of each gene-specific primer (2.5 μM), 8.8 μL of water, and 10 μL of iTaq SYBR Green Supermix with ROX (Bio-Rad, Hercules, CA, USA). The actin gene was used as the internal control for real-time analysis and was amplified with forward (5′- TCAATGTGCCTGCCATGTATGT-3′) and reverse (5′- ACTCACACCGTCACCAGAATCC-3′) primers. Primers for candidate genes were given in Table S2. Amplification conditions were as follows: denaturation at 95° for 2 min, followed by 35 cycles of 95° for 30 s, 51° for 30 s, and 72° for 30 s, with a final extension at 72° for 5 min.

Data availability

All data are included in the paper, tables, figures or the associated supplemental materials. Figure S1 presented a phylogenetic tree based on the allelic products of the LPP1 candidate genes. Domain structure analysis of the Myb proteins was shown in Figure S2. Sequence information for the Myb proteins used for the phylogenetic analysis could be found in Table S1. Table S2 showed the primer sequences used in the present study. Tables S3, S4 and S5 included comparation of allelic sequences for the LPP1 candidate genes. The M. truncatula genome sequence and gene annotation are available from public repositories (http://www.medicagogenome.org). All other reagents are commercially available or can be sent upon request. Supplemental material available at figshare: https://doi.org/10.6084/m9.figshare.12846581.

Results and Discussion

Three weeks after germination, black or purple pigmentation was observed at the adaxial midvein in A17 plants, but not on the abaxial surface (Figure 1). The leaf marking is absent on both upper and lower leaf sides in F83005 plants, whereas A20 leaves display infrequent and randomly distributed flecks (Figure 1). Of the 129 RILs of A17 × A20, a total of 59 individuals displayed the leaf marking caused by anthocyanin accumulation. Consistent with previous results (Thoquet et al. 2002), the segregation ratio fits 1:1 for presence to absence of the leaf marking (χ2 = 1.1, df = 1, P = 0.29), indicating that the lack of anthocyanin accumulation on leaves is controlled by a single dominant gene (Table 2). The single-gene pattern was also evidenced by the segregation ratio of 3:1 within F2 populations (Table 2). This gene was named LPP1 (Leaf Pigmentation Pattern 1).

Figure 1.

Figure 1

Pigmentation patterns on A17, F83005 and A20 leaves. A black or purple stain is displayed on the middle of adaxial leaf surface in A17, but not in F83005 and A20 (A). Leaf pigmentation is not shown on the abaxial surface in these ecotypes (B).

Table 2. Segregation ratio and Chi-square test analysis of RILs and F2s.

Segregating population Number of plants with leaf pigmentation Number of plants without leaf pigmentation Expected segregation ratio Chi-square (χ2) P-value
RILs of A17 x A20 59 70 1:01 0.938 0.33
F2 of A17 x A20 76 193 1:03 1.518 0.22
F2 of A17 x F83005 45 158 1:03 0.869 0.35

The F2 populations of A17 × A20 and A17 × F83005 were used first for genetic mapping of the LPP1 gene. The same populations were also employed to localize the SPC (Sense of Pod Coiling) gene controlling pod coiling direction in M. truncatula (Yu et al. 2020). The SPC gene was anchored onto Chromosome 7 (Chr 7), and we found the phenotype markers of leaf pigmentation patten and pod coiling direction were closely linked (Yu et al. 2020). Therefore, we speculated that LPP1 localized on the same chromosome with the SPC gene. Genetic mapping with CAPS markers confirmed localization of LPP1 on Chr 7 (Figure 2A). Flanked by the Marker 7 (M7) and M15, LPP1 was delimited within a 516 kb-region (Chr 7:13291032-13807513). Assisted by RILs derived from A17 × A20, the LPP1 region was narrowed down to 287 kb bordered by M8 and M12 (Chr 7: 13294389-13582122) (Figure 2B and 2C). All the markers harbored in this 287 kb-region, such as M9, M10, and M11, are co-segregating with leaf pigmentation phenotypes (Figure 2C).

Figure 2.

Figure 2

Genetic and physical mapping of the LPP1 locus. A. Integrated genetic map generated with F2 populations derived and A17 × A20. LPP1 is located on the M. truncatula molecular linkage group 7 (as indicated by the hollow box). Numbers indicate the number of recombination breakpoints separating the marker from LPP1, with the top and the bottom numbers are for the A17 × F83005 and A17 × A20 populations, respectively. B. Genetic map generated with RILs of A17 × A20. The genetic region of LPP1 was narrowed by M8 and M12. Number of recombinant events were also indicated under markers. C. Physical map of the LPP1 locus. Total of 8 protein-coding genes were identified in LPP1 region. The maps are drawn to scale.

Based on the RNA-seq data and EST alignments provided by the M. truncatula genome database (V4.2) (Young et al. 2011; Tang et al. 2014), we identified a total of 8 protein-coding genes within the 287 kb-region in the reference genome (Figure 2C, Table 3). Of those, three (G2, G4 and G6) are predicted to encode MYB transcription factors (Table 3). As for the other genes, their coding products are homologous to glutaredoxin C4 (G2), putative transmembrane protein (G3), peptide deformylase 1 (G5), polygalacturonase (G7), and C3HC4-type RING zinc finger protein (G8). The result of gene prediction was also confirmed by the newly released M. truncatula genome assembly V5.0 (MtrunA17Chr7: 13545781-13807677) (Pecrix et al. 2018).

Table 3. Predicated genes in the LPP1 region.

Gene number Gene name Predicted gene product
G1 Medtr7g035075 MYB transcription factor
G2 Medtr7g035245 Glutaredoxin C4
G3 Medtr7g035290 Transmembrane protein, putative
G4 Medtr7g035300 MYB-like DNA-binding domain protein
G5 Medtr7g035310 Peptide deformylase 1A
G6 Medtr7g035350 MYB transcription factor
G7 Medtr7g035415 Polygalacturonase
G8 Medtr7g035445 C3HC4-type RING zinc finger protein

In view of anthocyanin accumulation in A17 leaves being a recessive trait, lack of leaf pigmentation in A20 and F83005 may be caused by enzymatic degradation of anthocyanins or active suppression of their biosynthesis. Three candidate enzyme families have been proposed in anthocyanin degradation: polyphenol oxidase, peroxidase and β-glucosidases (Oren-Shamir 2009). Enzymatic in planta degradation of anthocyanins have been substantiated in Solanaceae and other families. Anthocyanin can be directly oxidized and degraded by peroxidase (Zipor et al. 2015). The other pathway is a two-step process, comprising deglycosylation by β -glucosidase and oxidation by polyphenol oxidase or peroxidase (Oren-Shamir 2009; Liu et al. 2018; Barbagallo et al. 2007). All these enzyme family members are missing in the LPP1 genomic region.

Although some MYB transcription factors positively activate anthocyanin biosynthesis through the MBW complex, some are repressors that limit expression of the anthocyanin biosynthesis genes (Verdier et al. 2012; Liu et al. 2014; Peel et al. 2009). A series of R3- and R2R3-MYB repressors have been identified in Arabidopsis and other plants. Overexpression of AtMYBL2 repressed anthocyanin biosynthesis in Arabidopsis, and knocking out AtMYBL2 resulted in enhanced accumulation of anthocyanin (Matsui et al. 2008). Ectopic expression of AtMYB60 in lettuce inhibited anthocyanin accumulation as well (Park et al. 2008). In grape, VvMYBC2-L3, VvMYB4b, VvMYB4a, and VvMYB4-like down-regulated the structural genes involved in flavonoid biosynthesis and reduced both PA and anthocyanin levels (Cavallini et al. 2015; Pérez-Díaz et al. 2016). RNAi-mediated silencing of FcMYB1, an MYB repressor gene in strawberry, led to increased accumulation of anthocyanins (Salvatierra et al. 2013). In Medicago truncatula, an R2R3-MYB protein, MtMYB2, was discovered as a transcriptional repressor in the regulation of both anthocyanin and PA biosynthesis (Jun et al. 2015).

Given that MYB transcription factor can be negative regulators of anthocyanin biosynthesis, three MYB genes in the LPP1 region, G1, G4, and G6, were selected for sequence analysis. DNA sequencing did not identify any stop codons in the open reading frames of all three candidates in A17, A20 and F83005 (Table S3, S4, and S5). It is noteworthy that the allelic products of G1 in A17 and A20 share identical amino acid sequences, although their cDNAs vary with 2 single bp-substitutions (Table S3). It suggested that G1 may not be a candidate for the LPP1 gene. Phylogenetic analysis indicated that for G4 and G6 allelic products of A20 and F83005 are more closely related to each other than to that of A17 (Figure S1). Moreover, G4 and G6 putatively encode R2R3-MYB transcription factors (Li et al. 2019). Therefore, G4 and G6 may be the LPP1 candidates.

To further strengthen their candidacy for these MYB transcription factor-coding genes, we conducted qRT-PCR analysis to characterize their expression profiles (Figure 3). Although leaf pigmentation is missing, anthocyanin accumulate in A20 and F83005 flowers to attract pollinators (Mouradov and Spangenberg 2014). We anticipate that the LPP1 gene expresses highly in leaf but not in flower. As for G1, similar expression in leaf (Figure 3A) and upregulation in flower for three alleles, in combination with same allelic products, may exclude G1 as one of the LPP1 candidates. On the contrary, both G4 (Figure 3B) and G6 (Figure 3C) were downregulated in flower, even though they highly express in leaf of all the three ecotypes. Thus, G4 and G6 were selected as strong candidates of LPP1. It is noteworthy that G4 and G6 are not differentially expressed in the leaf among genotypes (Figure 3). Therefore, the phenotypic difference between A17 and F83005/A20 may be caused by the protein sequence polymorphisms in the allelic products of G4 and G6 (Tables S4 and S5).

Figure 3.

Figure 3

qRT-PCR analysis of gene expression levels for G1/Medtr7g035075 (A) and G4/Medtr7g035300 (B) and G6/Medtr7g035350 (C) in leaf, open flower. The actin gene was used as internal control. The error bars indicate the standard errors (SEs).

MYB proteins directly or indirectly bind to cis-regulatory sequences of DNA to activate or inhibit gene expression, and conserved MYB-recognition elements are widely distributed throughout plant genomes (Hartmann et al. 2005). Suppression of transcription by R2R3-MYB repressors is achieved through a repression motif (TLLLFR) in their C termini (Matsui et al. 2008; Albert et al. 2014). AtMYBL2 or MtMYB2 competes with MYB-activators and forms suppressive MBW complex, and thus the suppression motif in these R2R3-MYB repressors inhibit expression of structural genes involved in anthocyanin biosynthesis (Matsui et al. 2008; Jun et al. 2015). Domain structure analysis based on the sequences of functionally investigated R3-/R2R3-Myb repressors and R2R3-Myb activators from various species indicated that the TLLLFR motif is missing in G1, G2 and G6 (Figure S2). However, this motif was only identified in 5 of the 16 R2R3-Myb repressors, suggesting that the TLLLFR motif may not be necessary for the suppression activity. A phylogenetic analysis was conducted to evaluate if a suppressive activity is associated with the R2R3-Myb proteins identified in the LPP1 region (Figure 4). Although G1, G4 and G6 were grouped in an independent subclade, they were phylogenetically related to the R2R3-Myb repressors lacking the TLLLFR motif (Figure 4).

Figure 4.

Figure 4

Phylogenetic tree based on a Neighbor-Joining (NJ) analysis of known MYB proteins with 1000 bootstrap pseudoreplicates. The tree was built using sequences from 6 R3-Myb repressors, 6 R2R3-Myb activators, 14 R2R3-Myb suppressors, and three allelic products of G1, G4 and G6. Protein sequences are given in Table S2. Branches with support of 200 or more are indicated. Values shown above the branches are the estimated amino acid substitutions per site (bar = 0.05).

The anthocyanin biosynthesis pathway is completely present in A20 and F83005 plants, demonstrated by the normal color of the seed coat and flower. Therefore, spatiotemporal expression of MYB repressors in A20 and F83005 leaves is finely tuned, which is in line with the expression profile of candidate genes (Figure 3). Identification of the LPP1 gene will further our understanding of the regulatory mechanisms underlying anthocyanin biosynthesis, and it may provide new perspective for the enrichment of vegetable, fruit, and forage with increased anthocyanins. Nevertheless, the identity of LPP1 will be confirmed with genetic transformation or CRISPR/Cas9-mediated mutagenesis in A17 and A20, respectively.

Acknowledgments

This work was supported by the College of Agriculture of the University of Kentucky (to S.Y.) and a grant from KTRDC Summit (to S.Y.).

Footnotes

Communicating editor: S. Pearce

Literature Cited

  1. Albert N. W., Davies K. M., Lewis D. H., Zhang H., Montefiori M. et al. , 2014.  A conserved network of transcriptional activators and repressors regulates anthocyanin pigmentation in eudicots. Plant Cell 26: 962–980. 10.1105/tpc.113.122069 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Barbagallo R. N., Palmeri R., Fabiano S., Rapisarda P., and Spagna G., 2007.  Characteristic of β-glucosidase from Sicilian blood oranges in relation to anthocyanin degradation. Enzyme Microb. Technol. 41: 570–575. 10.1016/j.enzmictec.2007.05.006 [DOI] [Google Scholar]
  3. Bateman A., Coin L., Durbin R., Finn R. D., Hollich V. et al. , 2004.  The Pfam protein families database. Nucleic Acids Res. 32: D138–D141. 10.1093/nar/gkh121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Carletti G., Lucini L., Busconi M., Marocco A., and Bernardi J., 2013.  Insight into the role of anthocyanin biosynthesis-related genes in Medicago truncatula mutants impaired in pigmentation in leaves. Plant Physiol. Biochem. 70: 123–132. 10.1016/j.plaphy.2013.05.030 [DOI] [PubMed] [Google Scholar]
  5. Cavallini E., Matus J. T., Finezzo L., Zenoni S., Loyola R. et al. , 2015.  The phenylpropanoid pathway is controlled at different branches by a set of R2R3-MYB C2 repressors in grapevine. Plant Physiol. 167: 1448–1470. 10.1104/pp.114.256172 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cheng X., Li G., Tang Y., and Wen J., 2018.  Dissection of genetic regulation of compound inflorescence development in Medicago truncatula. Development 145: dev158766 10.1242/dev.158766 [DOI] [PubMed] [Google Scholar]
  7. Cook D. R., 1999.  Medicago truncatula–a model in the making! Curr. Opin. Plant Biol. 2: 301–304. 10.1016/S1369-5266(99)80053-3 [DOI] [PubMed] [Google Scholar]
  8. Franssen H. J., Xiao T. T., Kulikova O., Wan X., Bisseling T. et al. , 2015.  Root developmental programs shape the Medicago truncatula nodule meristem. Development 142: 2941–2950. 10.1242/dev.120774 [DOI] [PubMed] [Google Scholar]
  9. Gonzalez A., Zhao M., Leavitt J. M., and Lloyd A. M., 2008.  Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings. Plant J. 53: 814–827. 10.1111/j.1365-313X.2007.03373.x [DOI] [PubMed] [Google Scholar]
  10. Hartmann U., Sagasser M., Mehrtens F., Stracke R., and Weisshaar B., 2005.  Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes. Plant Mol. Biol. 57: 155–171. 10.1007/s11103-004-6910-0 [DOI] [PubMed] [Google Scholar]
  11. Jun J. H., Liu C., Xiao X., and Dixon R. A., 2015.  The Transcriptional Repressor MYB2 Regulates both spatial and temporal patterns of proanthocyandin and anthocyanin pigmentation in Medicago truncatula. Plant Cell 27: 2860–2879. 10.1105/tpc.15.00476 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Khurana S., Venkataraman K., Hollingsworth A., Piche M., and Tai T. C., 2013.  Polyphenols: benefits to the cardiovascular system in health and in aging. Nutrients 5: 3779–3827. 10.3390/nu5103779 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Koes R., Verweij W., and Quattrocchio F., 2005.  Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 10: 236–242. 10.1016/j.tplants.2005.03.002 [DOI] [PubMed] [Google Scholar]
  14. Larkin M. A., Blackshields G., Brown N. P., Chenna R., McGettigan P. A. et al. , 2007.  Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. 10.1093/bioinformatics/btm404 [DOI] [PubMed] [Google Scholar]
  15. Le Signor C., Vernoud V., Noguero M., Gallardo K., and Thompson R. D., 2018.  Functional genomics and seed development in Medicago truncatula: An Overview. Methods Mol. Biol. 1822: 175–195. 10.1007/978-1-4939-8633-0_13 [DOI] [PubMed] [Google Scholar]
  16. Li D., Bao Y., Wu X., Jack A., and Yang S., 2014.  The use of CAPS and dCAPS markers in marker-assisted selection for tobacco breeding, pp. 137–150 in Cleaved Amplified Polymorphic Sequences (CAPS) markers in plant biology, edited by Shavrukov Y. Nova Science Publishers, Incorporated, Hauppauge, NY. [Google Scholar]
  17. Li P., Chen B., Zhang G., Chen L., Dong Q. et al. , 2016.  Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bHLH transcription factor MtTT8. New Phytol. 210: 905–921. 10.1111/nph.13816 [DOI] [PubMed] [Google Scholar]
  18. Li W., Liu Y., Zhao J., Zhen X., Guo C. et al. , 2019.  Genome-wide identification and characterization of R2R3-MYB genes in Medicago truncatula. Genet. Mol. Biol. 42: 611–623. 10.1590/1678-4685-gmb-2018-0235 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Liu C., Jun J. H., and Dixon R. A., 2014.  MYB5 and MYB14 play pivotal roles in seed coat polymer biosynthesis in Medicago truncatula. Plant Physiol. 165: 1424–1439. 10.1104/pp.114.241877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Liu Y., Tikunov Y., Schouten R. E., Marcelis L. F. M., Visser R. G. F. et al. , 2018.  Anthocyanin biosynthesis and degradation mechanisms in solanaceous vegetables: A Review. Front Chem. 6: 52 10.3389/fchem.2018.00052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Matsui K., Umemura Y., and Ohme-Takagi M., 2008.  AtMYBL2, a protein with a single MYB domain, acts as a negative regulator of anthocyanin biosynthesis in Arabidopsis. Plant J. 55: 954–967. 10.1111/j.1365-313X.2008.03565.x [DOI] [PubMed] [Google Scholar]
  22. Mouradov A., and Spangenberg G., 2014.  Flavonoids: a metabolic network mediating plants adaptation to their real estate. Front Plant. Sci. 5: 620 10.3389/fpls.2014.00620 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Oren-Shamir M., 2009.  Does anthocyanin degradation play a significant role in determining pigment concentration in plants? Plant Sci. 177: 310–316. 10.1016/j.plantsci.2009.06.015 [DOI] [Google Scholar]
  24. Pang Y., Wenger J. P., Saathoff K., Peel G. J., Wen J. et al. , 2009.  A WD40 repeat protein from Medicago truncatula is necessary for tissue-specific anthocyanin and proanthocyanidin biosynthesis but not for trichome development. Plant Physiol. 151: 1114–1129. 10.1104/pp.109.144022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Park J. S., Kim J. B., Cho K. J., Cheon C. I., Sung M. K. et al. , 2008.  Arabidopsis R2R3-MYB transcription factor AtMYB60 functions as a transcriptional repressor of anthocyanin biosynthesis in lettuce (Lactuca sativa). Plant Cell Rep. 27: 985–994. 10.1007/s00299-008-0521-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Pecrix Y., Staton S. E., Sallet E., Lelandais-Briere C., Moreau S. et al. , 2018.  Whole-genome landscape of Medicago truncatula symbiotic genes. Nat. Plants 4: 1017–1025. 10.1038/s41477-018-0286-7 [DOI] [PubMed] [Google Scholar]
  27. Peel G. J., Pang Y., Modolo L. V., and Dixon R. A., 2009.  The LAP1 MYB transcription factor orchestrates anthocyanidin biosynthesis and glycosylation in Medicago. Plant J. 59: 136–149. 10.1111/j.1365-313X.2009.03885.x [DOI] [PubMed] [Google Scholar]
  28. Peng T., Qiao M., Liu H., Teotia S., Zhang Z. et al. , 2018.  A resource for inactivation of microRNAs using short tandem target mimic technology in model and crop plants. Mol. Plant 11: 1400–1417. 10.1016/j.molp.2018.09.003 [DOI] [PubMed] [Google Scholar]
  29. Penmetsa R. V., and Cook D. R., 2000.  Production and characterization of diverse developmental mutants of Medicago truncatula. Plant Physiol. 123: 1387–1398. 10.1104/pp.123.4.1387 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Pérez-Díaz J. R., Perez-Diaz J., Madrid-Espinoza J., Gonzalez-Villanueva E., Moreno Y. et al. , 2016.  New member of the R2R3-MYB transcription factors family in grapevine suppresses the anthocyanin accumulation in the flowers of transgenic tobacco. Plant Mol. Biol. 90: 63–76. 10.1007/s11103-015-0394-y [DOI] [PubMed] [Google Scholar]
  31. Salvatierra A., Pimentel P., Moya-Leon M. A., and Herrera R., 2013.  Increased accumulation of anthocyanins in Fragaria chiloensis fruits by transient suppression of FcMYB1 gene. Phytochemistry 90: 25–36. 10.1016/j.phytochem.2013.02.016 [DOI] [PubMed] [Google Scholar]
  32. Solovyev V., and Salamov A., 1997.  The Gene-Finder computer tools for analysis of human and model organisms genome sequences. Proc. Int. Conf. Intell. Syst. Mol. Biol. 5: 294–302. [PubMed] [Google Scholar]
  33. Tang H., Krishnakumar V., Bidwell S., Rosen B., Chan A. et al. , 2014.  An improved genome release (version Mt4.0) for the model legume Medicago truncatula. BMC Genomics 15: 312 10.1186/1471-2164-15-312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Tamura K., Peterson D., Peterson N., Stecher G., Nei M. et al. , 2011.  MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739. 10.1093/molbev/msr121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Thoquet P., Gherardi M., Journet E. P., Kereszt A., Ane J. M. et al. , 2002.  The molecular genetic linkage map of the model legume Medicago truncatula: an essential tool for comparative legume genomics and the isolation of agronomically important genes. BMC Plant Biol. 2: 1 10.1186/1471-2229-2-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Verdier J., Zhao J., Torres-Jerez I., Ge S., Liu C. et al. , 2012.  MtPAR MYB transcription factor acts as an on switch for proanthocyanidin biosynthesis in Medicago truncatula. Proc. Natl. Acad. Sci. USA 109: 1766–1771. 10.1073/pnas.1120916109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yang S., Gao M., Xu C., Gao J., Deshpande S. et al. , 2008.  Alfalfa benefits from Medicago truncatula: the RCT1 gene from M. truncatula confers broad-spectrum resistance to anthracnose in alfalfa. Proc. Natl. Acad. Sci. USA 105: 12164–12169. 10.1073/pnas.0802518105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Yang S., Tang F., Caixeta E. T., and Zhu H., 2013.  Epigenetic regulation of a powdery mildew resistance gene in Medicago truncatula. Mol. Plant 6: 2000–2003. 10.1093/mp/sst106 [DOI] [PubMed] [Google Scholar]
  39. You E. M., Liu K. F., Huang S. W., Chen M., Groumellec M. L. et al. , 2010.  Construction of integrated genetic linkage maps of the tiger shrimp (Penaeus monodon) using microsatellite and AFLP markers. Anim. Genet. 41: 365–376. 10.1111/j.1365-2052.2009.02014.x [DOI] [PubMed] [Google Scholar]
  40. Young N. D., Debelle F., Oldroyd G. E., Geurts R., Cannon S. B. et al. , 2011.  The Medicago genome provides insight into the evolution of rhizobial symbioses. Nature 480: 520–524. 10.1038/nature10625 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yu X., Qin Q., Wu X., Li D., and Yang S., 2020.  Genetic localization of the SPC gene controlling pod coiling direction in Medicago truncatula. Genes Genomics 42: 735–742. 10.1007/s13258-020-00947-3 [DOI] [PubMed] [Google Scholar]
  42. Zhou C., Han L., Hou C., Metelli A., Qi L. et al. , 2011a Developmental analysis of a Medicago truncatula smooth leaf margin1 mutant reveals context-dependent effects on compound leaf development. Plant Cell 23: 2106–2124. 10.1105/tpc.111.085464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Zhou C., Han L., Pislariu C., Nakashima J., Fu C. et al. , 2011b From model to crop: functional analysis of a STAY-GREEN gene in the model legume Medicago truncatula and effective use of the gene for alfalfa improvement. Plant Physiol. 157: 1483–1496. 10.1104/pp.111.185140 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zipor G., Duarte P., Carqueijeiro I., Shahar L., Ovadia R. et al. , 2015.  In planta anthocyanin degradation by a vacuolar class III peroxidase in Brunfelsia calycina flowers. New Phytol. 205: 653–665. 10.1111/nph.13038 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data are included in the paper, tables, figures or the associated supplemental materials. Figure S1 presented a phylogenetic tree based on the allelic products of the LPP1 candidate genes. Domain structure analysis of the Myb proteins was shown in Figure S2. Sequence information for the Myb proteins used for the phylogenetic analysis could be found in Table S1. Table S2 showed the primer sequences used in the present study. Tables S3, S4 and S5 included comparation of allelic sequences for the LPP1 candidate genes. The M. truncatula genome sequence and gene annotation are available from public repositories (http://www.medicagogenome.org). All other reagents are commercially available or can be sent upon request. Supplemental material available at figshare: https://doi.org/10.6084/m9.figshare.12846581.


Articles from G3: Genes|Genomes|Genetics are provided here courtesy of Oxford University Press

RESOURCES