High prevalence and extended deletions in Plasmodium falciparum hrp2/3 genomic loci in Ethiopia

Abstract

Deletions in Plasmodium falciparum histidine rich protein 2(pfhrp2) gene threaten the usefulness of the most widely used HRP2-based malaria rapid diagnostic tests (mRDTs) that cross react with its structural homologue, PfHRP3. Parasites with deleted pfhrp2/3 genes remain undetected and untreated due to ‘false-negative’ RDT results. As Ethiopia recently launched malaria elimination by 2030 in certain selected areas, the availability of RDTs and the scale of their use have rapidly increased in recent years. Thus, it is important to explore the presence and prevalence of deletion in the target genes, pfhrp2 and pfhrp3. From a total of 189 febrile patients visited Adama Malaria Diagnostic centre, sixty-four microscopically-and polymerase chain reaction (PCR)-confirmed P. falciparum clinical isolates were used to determine the frequency of pfhrp2/3 gene deletions. Established PCR assays were applied to DNA extracted from blood spotted onto filter papers to amplify across pfhrp2/3 exons and flanking regions. However, analysis of deletions in pfhrp2, pfhrp3 and flanking genomic regions was successful for 50 of the samples. The pfhrp2 gene deletion was fixed in the population with all 50(100%) isolates presenting a deletion variant. This deletion extended downstream towards the Pf3D7 0831900 (MAL7PI.230) gene in 11/50 (22%) cases. In contrast, only 2/50 (4%) of samples had deletions for the Pf3D7 0831700 (MALPI.228) gene, upstream of pfhrp2. Similarly, the pfhrp3 gene was deleted in all isolates (100%), while 40% of the isolates had an extension of the deletion to the downstream flanking region that codes for Pf3D7 13272400 (MAL13PI.485).The pfhrp3 deletion also extended upstream to Pf3D7 081372100 (MAL13PI.475) region in 49/50 (95%) of the isolates, exhibiting complete absence of the locus. Although all samples showed deletions of pfhrp2 exon regions, amplification of an intron region was successful in five cases. Two different repeat motifs in the intron regions were observed in the samples tested. Pfhrp2/3 gene deletions are fixed in Ethiopia and this will likely reduce the effectiveness of PfHRP2-based mRDTs. It will be important to determine the sensitivity PfHRP 2/3-based RDTs in these populations and conduct a countrywide survey to determine the extent of these deletions and its effect on routine RDT-based malaria diagnosis.

Introduction

In Ethiopia, Plasmodium falciparum and Plasmodium vivax are co-transmitted and respectively accounted for 60% and 40% of all malaria cases [1,2]. Nearly 68% of the landmass of Ethiopia is favourable for malaria transmission [1] and endemicity is heterogeneous with varied epidemiological presentation in different geographic settings [3]. Like in many parts of Africa, the incidence of malaria has substantially declined with a reported 40% reduction between 2000 and 2015 [4,5]. Ethiopia is on track to achieve the 2020 milestone to reduce the incidence of malaria by 40%. This also aligns with the World Health Organization (WHO) Global Technical Strategy (GTS) to intensify existing malaria interventions towards elimination by 2030 [5].

Rapid diagnostic tests (RDTs) were also introduced to improve early diagnosis of malaria in remote areas where microscopic examination of blood smears remains impractical. A majority of commercially available mRDTs are designed to detect malaria specific antigens such as lactate dehydrogenase or aldolase for pan-malaria diagnosis and PfHRP2 for P. falciparum specific diagnosis [6]. RDTs have become extremely essential for implementing early diagnosis and prompt effective treatment of malaria and for the continuous reduction of its burden.

In Ethiopia, mRDTs were introduced as one of the diagnostic methods following the revision of malaria diagnosis and treatment guideline in 2004 in the country. Depending on the antigen they target, different types of RDTs exist. Those that target histidine-rich protein-2 (HRP-2) only detect P. falciparum, while those that target the parasite enzyme lactate dehydrogenase (LDH) and aldolase can detect non-falciparum from mixed infection [7,8]. PfHRP2/3-based RDTs have been widely used for detection of P. falciparum at health posts/community levels in Ethiopia since 2005 [9].

PfHRP2 is a non-essential protein encoded by pfhrp2 gene located on chromosome 8 of P. falciparum. Its structural homologue, PfHRP3, is coded by a locus on chromosome 13 [10]. Pfhrp3 antigen epitopes are recognised by some PfHRP2-based RDTs [11] and may influence the diagnostic performance of these mRDTs. Hence, PfHRP3 contributes to reactivity of PfHRP2-based RDTs. Although PfHRP2-based RDTs have been widely used, its performance is complicated by the natural deletion of pfhrp2 gene in parasite populations in some geographical regions. Variation in the performance of RDTs has been observed, probably driven by polymorphisms in gene loci targeted, such as the recently described deletions in the Pfhrp2/3 loci. The prevalence and dynamics of these pfhrp2/3 deleted P. falciparum strains and their impact on diagnosis has not been extensively investigated in Ethiopia. Following the first report detailing the deletion of the pfhrp2 gene in P. falciparum isolates from Peru, several studies have shown the global spread of malaria parasites lacking pfhrp2 gene and the flanking chromosomal regions [12]. This generated anxiety on possible reduced sensitivity of PfHRP2-based RDTs. In Eritrea, P. falciparum lacking pfhrp2 now constitute a major threat to malaria control [13,14] as they are not detected by PfHRP2-based RDTs and remain untreated. It has been suggested that these strains with deletions at pfhrp2/3 genes have a fitness advantage and pose a challenge to progress made in malaria control and elimination [15] as these parasites will escape detection by PfHRP2-based RDTs and may be selected to expand due to routine use of RDTs leading to increasing frequencies of parasite population with pfhrp2/3 deleted genes in the communities. Though P. falciparum strains without these loci continue to thrive, the role of PfHRP2/3 loci in parasite virulence and fitness is not clear as these are expressed in all stages of development of parasite, probably contributing to survival advantage [16–18].

A substantial proportion of parasite isolates with both pfhrp2 and pfhrp3 gene deletions have been reported across malaria endemic countries in Africa with the highest prevalence of deletion from Eritrea (62%) [14] and the lowest from Angola (0.4%) [19]. Indeed, in some hospitals in Eritrea the levels of gene deletions were as high as 80% [14]. As the malaria transmission intensity and intervention history in Ethiopia is similar to that in Eritrea, it is therefore possible that pfhrp2/3 deleted isolates may be in circulation in Ethiopia at similarly high frequencies. Following the WHO recommendation for pfhrp2/3 surveys and cross border surveillance activities, this study investigates the extent of pfhrp2/3 deleted P. falciparum parasites in an Ethiopian P. falciparum population. Molecular analyse targeting the region across exons and flanking genes were used to provide evidence of gene deletions in the pfhrp2/3 genes.

Materials and methods

Study area

The study was conducted in Adama town, East Shoa Zone, Oromia, Ethiopia. The town is located at 8.54°N and 39.27°E, at an elevation of 1,712 meters above sea levels and is 99 km southeast of Ethiopia’s capital, Addis Ababa. Located between the base of an escarpment in the West and the Great Rift Valley in the East, Adama town experiences rainfall from mid-June to mid-September with short rains in March. Adama Malaria diagnostic center is the oldest laboratory exclusively committed to malaria diagnosis. As a matter of fact, people from the Adama town and the surrounding rural areas preferentially use this laboratory as far as malaria diagnosis is concerned over hospitals and other surrounding health centers in the town. The study site exhibits high malaria transmission with both P.falciparum and P.vivax malaria are co-endemic. In the study area, major and minor transmission seasons exist. The major malaria transmission season is from September through November and the minor from April to May. Anopheles arabiensis is the dominant malaria vector.

Sample collection and diagnosis of malaria

The study was initiated to explore the genetic variation and deletions in the pfhrp2/3 genes. Finger-prick blood samples were collected from 64 febrile patients attending Adama Malaria Diagnostic Centre from September through December 2015. Thick and thin blood smears were prepared for microscopic diagnosis of malaria parasite infections and identification of species. Parasite densities were calculated according to described standard methods (Parasites/μL = no. of asexual parasites X 8000/no. of WBC counted) [1]. Infected blood samples were spotted onto Whatman 3MM filter papers for parasite DNA extraction.

PCR confirmation of Plasmodium falciparum infections

Parasite DNA was extracted from dried blood spots using the chelex100 extraction method as described earlier [20]. The presence of Plasmodium species was confirmed by targeting 18S rRNA by a nested polymerase chain reaction (nPCR) using genus-specific primers rPLU 6: (5’TTAAAATTGTTGCAGTTAAAACG3’), rPLU 5: (5’CCTGTTGTTGCCTTAAACTTC3’) followed by species-specific primers rFAL 1: (5’TTAAACTGGTTTGGGAAAACCAAATATATT3’), rFAL2: (5’ACACAATGAACTCAATCATGACTACCCGTC3’) as described by Snounou [21]. The cycling conditions were as follows: denaturation, 95°C for 5 min; 35 cycles of 94°C for 30 s, 56°C for 30 s, and 60°C for 60 s; and a final extension at 60°C for 5 min. The presence of amplification product is detected by simple ethidium bromide staining following agarose gel electrophoresis and a 205 bp size of the PCR product confirms P. falciparum.

PCR-based genotyping of pfhrp2/3 deletions

Amplifications of exons 2 and their flanking regions of pfhrp2/3 genes were done by semi-nested PCR [22] using published protocols and primers (Table 1). Nest-1 PCR targets repeat sequences within the most variable part of the genes while the second primer set targets an intron region. For pfhrp2, PCR nest-1 product sizes of 720–830 bp were expected while for Pfhrp3, the expected PCR product size was< 500 bp. The PCR products were purified by the GeneJet PCR Cleanup Kit from Thermo Fisher Scientific and sent for sequence determination at Eurofins genomics, Germany. Sequences were analysed by the 4peaks program (A. Griekspoor and Tom Groothuis, nucleobytes.com).

Table 1. Primers name and sequences used to amplify pfhrp2/3 genes including the flanking regions.

Primer name	Gene	Sequence (5’ → 3’)
Hrp-2 outer (reverse primer)	HRP2	5'-TCT ACA TGT GCT TGA GTT TCG-3'
Hrp-2 outer (forward primer)	HRP2	5'-GGT TTC CTT CTC AAA AAA TAA AG-3'
Hrp-2 inner (forward primer)	HRP2	5'- GTA TTA TCC GCT GCC GT TTT GCC-3'
Hrp-2 inner (reverse primer)	HRP2	5'-CTA CAC AAG TTA TTATTA AAT GCG GAA- 3'
pfhrp2newoutfw	HRP2	Fw: ATA TTT GCA CAT CTT GC
pfhrp2newoutrev	HRP2	Rev: ATG GTT TCC TTC TCA AA
pfhrp2newnestfw	HRP2	Fw: TCG CTA TCC CAT AAA TTA CA
pfhrp2newnestrev	HRP2	Rev: GAT TAT TAC ACG AAA CTC AAG C
228 outer-forward	228	Fw: CAA TAG TTG CTT GTG CGG ATG
228 outer-reverse	228	Rev AGA AGT TGC AGA GAC ATA CTT AGG
228 nested-forward	228	Fw: AGA CAA GCT ACC AAA GAT GCA GGT
228 nested-reverse	228	Rev: TAA ATG TGT ATC TCC TGA GGT AGC
230 outer-forward	230	Fw: CCC TGC TAT ATA GAT GAG GAA A
230 outer-reverse	230	Rev: CTA CCA CTT CTG TTG CTA CC
230 nested forward	230	Fw: TAT GAA CGA AAT TTA AGT GAG GCA
230 nested-reverse	230	Rev: TAT CCA ATC CTT CCT TTG CAA CAC C
Hrp3 out rev new	HRP3	5´-CCA TAC ACT TAT GCT GTA TTTA- 3´
Hrp3 outfw new	HRP3	5´- TGG TAA TTT CTG TGT TTA TG- 3´
Hrp3-2 nestfw	HRP3	5´- TAT CCG CTG CCG TTT TTG CTT CC- 3´
Hrp3 nest rev	HRP3	5´- TGG TGT AAG TGA TGC GTA GT- 3´
MAL 475 REV set1 (out-rev)	475	5´-TCC CAC ATC GTA TAT CTC AGT TTC- 3´
MAL 475 FWD set1 (out-fw)	475	5´-GGA AAG CAC AAC AAG ATG GAT AC- 3´
MAL 13PI 475 rev (nest-rev)	475	5´-TCG TAC AAT TCA TCA TAC TCA CC- 3´
MAL 13PI 475 fw (nest-fw)	475	5´-TTC ATG AGT AGA TGT CCT AGG AG- 3´
MAL 485 REV set1 (out-rev)	485	5´-GCT TCT TTC CAC ATT TCT CAC AT- 3´
MAL 485 FWD set5 (out-fw)	485	5´-GTG TGT TTC CAT GTA TTA CGG AAG- 3´
MAL 12PI 485 rev (nest-rev)	485	5´-AAA TCA TTT CCT TTT ACA CTA GTG C- 3´
MAL 12PI 485 fw (nest-fw)	485	5´-TTG AGT GCA ATG ATGATG GGA G- 3´

Amplification of pfhrp2/3 flanking regions

For amplifications of genes immediately flanking pfhrp2 (MAL7P1.230 (5.535 kb upstream) and MAL7P1.228 (6.49 kb downstream)), and pfhrp3 (MAL13P1.485 (4.404 kb upstream) and MAL13P1.475 (1.684 kb downstream)), the following primers and PCR conditions were used (Table 2).

Table 2. PCR conditions and expected product sizes of the pfhrp2/3 flanking regions.

Gene	PCR conditions	Expected PCR product size
MAL7P1_228	94°C for 10 min, followed by 94°C for 30 sec, 60°C for 30 sec, 68°C for 1 min	227 bp
MAL7P1_230	94°C for 10 min, followed by 94°C for 30 sec, 60°C for 30 sec, 68°C for 1 min	346 bp
MAL13P1_475	94°C for 10 min, followed by94°Cfor 30 sec, 60°C for 30 sec, 68°C for 1 min	260 bp
MAL12P1_485	94°C for 10 min, followed by 94°C for 30 sec, 60°C for 30 sec, 68°C for 1 min	287 bp

To rule out the possibility that the absence of amplification in pfhrp2/3 may be an artifact of the PCR, alternative primers with different binding sites and amplification conditions were used. All primers were used on samples from Tanzania with intact pfhrp2/3 genes with good results. In addition, amplifications of pfmdr1 and pfubp-1 genes were successful in all samples suggesting the deletion of pfhrp2/3 genes.

Ethical issue

The study was approved by Aklilu Lemma Institute of Pathobiology, Addis Ababa University, Institutional review Board. Written consent and/or assent were obtained from each study participant.

Results

PCR confirmation of Plasmodium falciparum infections

Of 189 self-reporting febrile patients seeking malaria diagnosis at Adama Malaria Diagnostic Centre, 33.9% (64/189) were positive for P. falciparum as confirmed by expert microscopy which was later proven positive by PCR. The male: female ratio was 3.1:1. Participant’s mean age was 25.2 years (range 11–48). The minimum parasite density reported was 400 parasites/μL. Although all microscopically confirmed cases tested positive by PCR, only 50 samples had enough DNA for further analysis of deletion in pfhrp2/3 genes and the flanking regions.

By targeting six regions in the pfhrp2/3 genes and their flanking genes, different deletion patterns were observed in Ethiopian P. falciparum clinical samples. Most parasite isolates had deleted the gene located 3’ of pfhrp2, PF3D7_0831900, compared to the flanking gene5’, PF3D7_0831700. In contrast, the 5’ flanking PF3D7_1372100 gene, upstream of pfhrp3, showed more deletions than the downstream 3’ flanking PF3D7_1372400 region. Combining deletions in the genes and flanking regions, the most common pattern exhibited in the isolates was the presence of the two flanking regions for pfhrp2 in combination with the downstream flanking region for pfhrp3. This was followed by isolates that had a deleted downstream flanking region of pfhrp3 but with the two flanking regions of pfhrp2 retained. Notably, only one isolate showed intact flanking regions for both gene loci. Amplifications of pfmdr1 and pfubp-1 genes in these samples are an indication that the absence of PCR products in the pfhrp2/3 genes and the respective flanking regions are due to deletions.

Genetic deletion of pfhrp2 and pfhrp3 and their flanking genes

The deletion variant at pfhrp2 gene was fixed in the population analysed as the gene was deleted in all 50(100%) isolates assessed. The deletion extended downstream pfhrp2 gene flanking region towards the Pf3D7 0831900(MAL7PI.230) gene in 11/50 (22%) of the cases (Table 3). In contrast, only 2/50(4%) of samples had deletions for the upstream gene Pf3D7 0831700(MALPI.228).

Table 3. Extension of deletions of pfhrp 2 and pfhrp3 genes, the respective flanking regions and exon primers used in Ethiopian isolates.

DNA sample ID.	Gene 228	pfhrp2	Gene 230	Gene 475	pfhrp3	Gene 485
1	+	-	-	-	-	+
2	+	-	-	-	-	+
3	+	-	+	-	-	-
4	+	-	+	-	-	+
5	+	-	+	-	-	+
6	+	-	+	-	-	+
7	+	-	+	-	-	+
8	+	-	+	(+)	-	+
9	+	-	+	-	-	+
10	+	-	+	-	-	+
11	+	-	+	-	-	+
12	+	-	+	-	-	-
13	+	-	+	-	-	-
14	+	-	-	-	-	-
15	+	-	+	-	-	+
16	+	-	-	-	-	+
17	+	-	-	-	-	+
18	+	-	-	-	-	+
19	+	-	+	-	-	+
20	+	-	+	-	-	-
21	+	-	+	-	-	-
22	+	-	+	-	-	-
23	+	-	+	-	-	-
24	+	-	+	-	-	-
25	+	-	-	-	-	-
26	+	-	+	-	-	+
27	+	-	+	-	-	+
28	+	-	-	-	-	+
29	+	-	+	-	-	+
30	+	-	+	-	-	-
31	+	-	+	-	-	-
32	+	-	+	-	-	-
33	-	-	+	-	-	-
34	-	-	+	-	-	-
35	+	-	+	-	-	-
36	+	-	-	-	-	-
37	+	-	+	-	-	+
38	+	-	+	-	-	-
39	+	-	-	-	-	+
40	+	-	-	-	-	+
41	+	-	+	-	-	+
42	+	-	+	-	-	+
43	+	-	+	-	-	+
44	+	-	+	-	-	+
45	+	-	+	-	-	+
46	+	-	+	-	-	-
47	+	-	+	-	-	-
48	+	-	+	-	-	-
49	+	-	+	-	-	+
50	+	-	+	-	-	+

Similar results were observed for pfhrp3 and flanking regions. Here, all the isolates had deletions in the pfhrp3 gene (100%). Like for pfhrp2 gene, pfhrp3 deletion extended to the downstream flanking region to include Pf3D7 13272400 (MAL13PI.485) in 40% of samples. However, the extension of the deletion was more prevalent upstream towards Pf3D7 081372100 (MAL13PI.475), with 49/50 (95%) of isolates deleted at these loci.

The summary of deletions in pfhrp2 and pfhrp3 genes and the respective flanking regions are indicated in S1 File.

In addition to the exon primers that cover the normally analysed variable region, a set of primers targeting an intron sequence with a varying number of AT repeats. In spite of the negative results for all samples in exon-based PCR, five samples actually gave PCR products for the intron region. The samples contained different numbers of AT repeat sequence motif (one sample with 10 repeats, and four samples with 17 repeats) and suggest that the deletion in this region did not involve the entire region (Table 4).

Table 4. Repeat sequences in pfhrp2 intron, in 50 Ethiopian samples tested, those not listed did not give PCR products.

Sample ID. (No. tested = 50 samples)	AT repeats intron
2	17
24	17
25	10
27	17
34	17

Discussion

As per WHO which hosted a technical consultation on pfhrp2/3 gene deletions and drafted interim guidance for investigating false-negative RDTs [23], understanding the distribution and evolution of these mutant parasites is a priority. However, it is yet unknown whether reliance on PfHRP2-based RDTs to guide treatment across malaria endemic countries is exerting evolutionary pressure favouring the spread of this mutation. At present, PfHRP2-based RDTs are central to malaria control programmes in spite of the threat by parasites that do not express PfHRP2. This study is the first to report the presence of extensive deletion of pfhrp2 gene including deletion in its structural homolog, pfhrp3, in clinical isolates in Ethiopia

All 50 samples (100%) yielded deletion for pfhrp2 and pfhrp3 genes. In pfhrp2 gene, the deletion extended to 4% (2/50) of flanking region gene 228. Flanking region gene 230 contained deletions in 22% (11/50) of the samples. Around pfhrp3 genes 475 and 485 were deleted for 95% and 40% of the samples, respectively. The fact that HRP2-based RDTs tests accounted for 74% of malaria diagnostic testing in the sub-Saharan Africa in 2017 [24], such massive utilization of RDTs could lead to selection and spread of P. falciparum strains that can evade detection through the deletion of the pfhrp2 genes.

Nowadays, a great concern with the use of PfHRP2-based RDTs malaria diagnosis has been the evolving reports of P. falciparum isolates lacking the pfhrp2 and pfhrp3 genes, which respectively encode the PfHRP2 and the PfHRP3 proteins [12,25,26]. The deletion assay includes six targets of pfhrp2/3 and flanking regions, and at least one locus was amplified for 50 samples out of 64 microscopically and PCR confirmed P. falciparum clinical samples collected. While the deletion in pfhrp2 gene extended downstream in 11/50 (22%) of the isolates, the deletion was only 4% in upstream of pfhrp2. However, it is unclear if these pfhrp2 deletions are recent events or emerged prior to the introduction of PfHRP2-based RDTs in Ethiopia. In Peru, for instance, pfhrp2-deleted parasites were present before the introduction of RDTs, but the sweep in the population that occurred after RDT introduction shows the strength of selection against this new diagnostic tool [27]. It is indicated that the extensive use of PfHRP2-based RDTs is sufficient to select P. falciparum parasites lacking this protein [15].

Similarly, deletion was evident in 100% of the isolates analysed in pfhrp3 gene and extended to the downstream flanking region that codes for Pf3D7 13272400 (MAL13PI.485) gene in 40% of the isolates. The pfhrp3 deletion also extended upstream to Pf3D7 081372100 (MAL13PI.475) region in 49/50 (95%) of the isolates, exhibiting complete absence of the locus. Two distinct repeat motifs were observed for pfhrp2 intron region in 50 of the samples tested suggesting that the deletion in this region did not involve the entire region.

Interestingly, PfHRP2-based RDTs are far more popular in Ethiopia than pLDH-based RDTs, partly because of their higher sensitivity for P. falciparum diagnosis. The presence of deletions in both pfhrp2 and pfhrp3 genes suggest that this could have been a result of a recent selection as a consequence of the widely used PfHRP2-based RDTs. The possible spread of pfhrp2/3 deleted parasite from a neighbour country like Eritrea can’t be overlooked for the presence high deletions in Ethiopian P. falciparum populations. Very high frequencies of these deletions have also been reported in Eritrea, a close geographic population and neighbour to Ethiopian parasite populations [13,14]. Deletions in both genes are less frequent in other African populations, though this phenomenon is quite prevalent in South American countries [27,28]. Recent whole genome analysis of P. falciparum across Africa countries found isolates from Ethiopia to be highly divergent from the rest of continent, defining a genomic background that could respond differently to selective forces such as RDTs and drugs [20]. These deletion isolates formed a closely related cluster probably from clonal proliferation of a recent pfhrp2-deleted ancestor [27]. Expansion of these deleted isolates could jeopardise the effectiveness of PfHRP2-based RDTs.

RDT-based malaria diagnosis followed by treatment could be selectively clearing infections with parasites retaining the pfhrp2/3 genes and hence increase the rate of spread of parasites with deletions [29]. When the pfhrp2 gene deletion was reported in 2010 in South America, this led to the recommendation against the use of PfHRP2-based RDTs in these areas [30–32]. If the results here are corroborated in a larger study across Ethiopia, a similar recommendation may be warranted. Unfortunately, patient recruitment in this study was based on microscopy and this does not allow us to determine the outcome of PfHRP2/3-based RDT for P. falciparum population with complete deletion of pfhrp2/3 genes. Hence, further large-scale studies using microscopy and PfHRP2/3-based RDTs are required to validate these high frequencies of pfhrp2/3 gene deletions and their effect on RDT malaria diagnosis in Ethiopia. For now, polymorphisms in pfhrp2/3 genes in Ethiopian isolates don’t seem to influence performance of currently used PfHRP2 RDTs given that they have been widely used in the country. Furthermore, as the samples were collected from one location in Ethiopia, a geographically expanded study would better inform the national malaria control program (NMCP) on need for reviewing policy on type of mRDTs in the country and the extent of pfhrp2/3 genes deletions.

This study has several important limitations. The samples were collected during a single malaria transmission season spanning September through December 2015 from one study site. Hence, the results here can’t be generalized to the clinical isolates from other endemic areas of Ethiopia. The number of isolates analysed was also small in number (50 P. falciparum clinical isolates). The fact that the clinical samples were collected using microscopy alone, it is impossible to know if the deleted isolates would test negative or positive for RDTs in the absence of pfhrp2/3 genes as we didn’t perform RDT-based diagnosis.

In summary, P. falciparum parasite populations with deletions of the pfhrp2 and pfhrp3 genes are present in Adama site of Ethiopia. Continuous monitoring of deletions among clinical isolates in the target regions is important in this era of malaria elimination, which largely depends on RDTs.

Supporting information

S1 File. Summary of pfhrp2, pfhrp3 amplification and their respective flanking genes in P. falciparum samples collected in Ethiopia.

(PDF)

S2 File. PCR protocol used for amplification of Plasmodium DNA.

(DOC)

S3 File. Pfhrp2/3 gene amplification for Tanzanian samples (both positive and negative) and Ethiopian samples (all negatives).

a). Tanzanian samples tested positives for hrp2/3 genes. b). Ethiopian samples tested negatives for hrp2/3 genes (please note that no positive control is included).

(DOC)

Abbreviations

DNA

Deoxyribonucleic acid

GTS

Global Technical Strategy

Hrp2/3

Histidine rich protein 2/3

NMCP

National malaria control program

PfHRP2/3

Plasmodium falciparum histidine rich protein 2

nPCR

Nested polymerase chain reaction

PCR

Polymerase chain reaction

pLDH

Plasmodium lactate dehydrogenase

mRDT

Malaria rapid diagnostic test

RDTs

Rapid diagnostic tests

RNA

Ribonucleic acid

rRNA

Ribosomal RNA

WHO

World Health Organization

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

This work was supported through the DELTAS Africa Initiative [DELGEME grant 107740/Z/15/Z]. The DELTAS Africa Initiative is an independent funding scheme of the African Academy of Sciences (AAS)’s Alliance for Accelerating Excellence in Science in Africa (AESA) and supported by the New Partnership for Africa’s Development Planning and Coordinating Agency (NEPAD Agency) with funding from the Wellcome Trust [DELGEME grant 107740/Z/15/Z] and the UK government. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.