Skip to main content
Cancer Science logoLink to Cancer Science
. 2013 Oct 1;104(11):1468–1475. doi: 10.1111/cas.12271

Alteration of cancer stem cell‐like phenotype by histone deacetylase inhibitors in squamous cell carcinoma of the head and neck

Kazuaki Chikamatsu 1,✉, Hiroki Ishii 2,3, Takaaki Murata 1, Koichi Sakakura 1, Masato Shino 1, Minoru Toyoda 1, Katsumasa Takahashi 1, Keisuke Masuyama 2
PMCID: PMC7654248  PMID: 23992541

Abstract

Recent progression in the understanding of stem cell biology has greatly facilitated the identification and characterization of cancer stem cells (CSCs). Moreover, evidence has accumulated indicating that conventional cancer treatments are potentially ineffective against CSCs. Histone deacetylase inhibitors (HDACi) have multiple biologic effects consequent to alterations in the patterns of acetylation of histones and are a promising new group of anticancer agents. In this study, we investigated the effects of two HDACi, suberoylanilide hydroxamic acid (SAHA) and trichostatin A (TSA), on two CD44+ cancer stem‐like cell lines from squamous cell carcinoma of the head and neck (SCCHN) cultured in serum‐free medium containing epidermal growth factor and basic fibroblast growth factor. Histone deacetylase inhibitors inhibited the growth of SCCHN cell lines in a dose‐dependent manner as measured by MTS assays. Moreover, HDACi induced cell cycle arrest and apoptosis in these SCCHN cell lines. Interestingly, the expression of cancer stem cell markers, CD44 and ABCG2, on SCCHN cell lines was decreased by HDACi treatment. In addition, HDACi decreased mRNA expression levels of stemness‐related genes and suppressed the epithelial‐mesencymal transition phenotype of CSCs. As expected, the combination of HDACi and chemotherapeutic agents, including cisplatin and docetaxel, had a synergistic effect on SCCHN cell lines. Taken together, our data indicate that HDACi not only inhibit the growth of SCCHN cell lines by inducing apoptosis and cell cycle arrest, but also alter the cancer stem cell phenotype in SCCHN, raising the possibility that HDACi may have therapeutic potential for cancer stem cells of SCCHN.


Evidence has accumulated indicating that only a minority of cancer cells with stem cell properties, cancer stem cells (CSCs), are responsible for the maintenance and growth of tumors.1, 2, 3 These CSC subpopulations show a capacity for high tumorigenicity, self‐renewal, and differentiation. To date, human CSCs have been identified, purified, and characterized in a variety of tumors.4, 5, 6, 7, 8 In squamous cell carcinoma of the head and neck (SCCHN), since Prince et al.9 first demonstrated that the purified CD44+ population possessed the properties of CSCs, various cell surface markers, including CD133 and ALDH1, have been identified for the isolation of CSCs.10, 11, 12 Moreover, numerous studies have demonstrated that conventional cancer treatments are potentially ineffective against CSCs, which are subsequently responsible for tumor relapse and distant metastases.13, 14, 15 Therefore, the development of novel therapeutic strategies to overcome treatment resistance of CSCs is urgently needed.

Recent studies have demonstrated that not only genetic but also epigenetic changes, including DNA methylation and histone modifications, play an essential role in cancer development.16, 17 Of histone modifications, acetylation and deacetylation affect the chromatin structure and gene expression, and they are regulated by the antagonistic activities of two enzymes, histone acetyltransferases (HATs) and histone deacetylases (HDACs). The aberrant expression of HDACs has been found in a variety of malignancies, which can alter gene transcription and enhance cell proliferation, indicating that HDACs are a promising target for cancer therapy. To date, several HDAC inhibitors (HDACi) have been developed and used in clinical trials for the treatment of cancers, and have been shown to induce differentiation, growth arrest, or apoptosis in tumor cells.18, 19 In addition to these known anti‐tumor effects, since HDACi are involved in the acetylation of non‐histone proteins, the functions of various transcription factors, including p53, STAT3, and NFκB, are also modulated.20, 21, 22 Thus, HDACi have multiple biologic effects, and therefore, their diverse effects have not been fully elucidated.

To explore the possibility of targeting epigenetics changes for treatment against CSCs, we investigated the effects of two HDACi, suberoylanilide hydroxamic acid (SAHA) and trichostatin A (TSA), on SCCHN cell lines. In previous studies, we and others have demonstrated that a small population possessing CSC properties was increased by culturing in serum‐free medium (SFM) with epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF).23, 24, 25 Using these culture conditions, we first examined the sensitivity of CD44+ cancer stem‐like cells to HDACi. We then focused on whether the CSC properties are altered by treatment with HDACi. Interestingly, the expression of cancer stem cell markers, CD44 and ABCG2, on SCCHN cell lines was decreased by HDACi treatment. Furthermore, HDACi have demonstrated not only downregulation of the mRNA expression levels of stemness‐related genes and sphere formation, but a synergistic effect with chemotherapeutic agents. Thus, our data revealed that HDACi may have therapeutic potential for CSCs in SCCHN.

Materials and Methods

Cell lines and culture conditions

Two human cultured SCCHN cell lines, HSC‐2 and KUMA‐1, were used in this study. HSC‐2, which was established from an oral cancer, was purchased from the Japanese Collection of Research Bioresources (Osaka, Japan). KUMA‐1 was established from a squamous cell carcinoma of the maxillary sinus. These cell lines were cultured in Serum‐Free Expansion medium (StemCell Technologies, Vancouver, Canada) supplemented with epidermal growth factor (EGF; Calbiochem, Darmstadt, Germany) and basic fibroblast growth factor (bFGF; Calbiochem; 20 ng/mL) each, as described previously.23 Two HDACi, SAHA and TSA, were purchased from Wako (Osaka, Japan) and Sigma‐Aldrich (St. Louis, MO, USA), respectively.

Flow cytometry

Trypsinized cells were resuspended, incubated with monoclonal antibodies for 30 min at 4°C, washed twice with PBS containing 1% FBS and 0.1% NaN3, and fixed with 1% paraformaldehyde in PBS. The antibodies used were anti‐CD44‐ FITC (BD Pharmingen, San Diego, CA, USA) and anti‐ABCG2‐phycoerythrin (PE) (BD Pharmingen). Respective immunoglobulin G isotype‐matched controls (BD Pharmingen) were used as negative controls.

Cell growth assays

Cell proliferation was determined using a CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI, USA). Trypsinized cells were plated at a density of 1 × 104 cells/well in 96‐well flat‐bottomed plates, incubated overnight, and then exposed to various concentrations of HDACi for 48 h. Finally, 20 μL of 3‐(4,5‐dimethylthiazol‐2‐yl)‐5‐(3‐carboxymethoxyphenyl)‐2‐(4‐sulfophenyl)‐2H‐tetrazolium, inner salt; MTS solution was added to each well and the plate was incubated for 1 h at 37°C, and viable cells were quantified by measuring absorbance at 490 nm.

Apoptosis assay

Apoptosis was assessed by flow cytometry as described previously.26 Briefly, cells were treated with HDACi for 48 h. Floating cells and adherent cells were harvested, washed, and assayed for apoptosis using a CaspACE FITC‐VAD‐FMK In Situ Maker (Promega). To determinate apoptotic and necrotic cells, 7‐amino‐actinomycin D (7‐ADD) was added before analysis.

Cell cycle analysis

The cells incubated with HDACi for 48 h were trypsinized, washed, and fixed in ice‐cold 70% ethanol, stained with propidium iodide RNase staining buffer (BD Pharmingen), and analyzed by flow cytometry. The population of subG1 including debris was deleted when gating singlet cells. The percentage of cells in G0/G1, S, or G2/M phase was determined using modfit lt software provided by Verity Software House (Topsham, ME, USA).

Sphere formation assay

The sphere formation assay was performed as described by Hong et al.27 Briefly, trypsinized cells were washed and then cells were seeded at a density of 1 × 103 cells/mL in 24‐well ultra‐low attachment plates in the presence or absence of HDACi. After 7 days' culture, spheres were counted using a microscope.

Real‐time qRT‐PCR

Total RNA was extracted from trypsinized cells using an RNeasy mini kit (Qiagen, Valencia, CA, USA). Quantitative (q)RT‐PCR was performed using a Power SYBR Green RNA‐to‐CT 1‐Step Kit on an Applied Biosystems StepOne (Applied Biosystems, Foster City, CA, USA). The melting curve was recorded at the end of every run to assess product specificity. Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used as an internal control gene. PCR primers used in this study were as follows: CD44 forward primer, 5′‐CGGACACCATGGACAAGTTT‐3′, reverse primer, 5′‐GAAAGCCTTGCAGAGGTCAG‐3′; ABCG2 forward primer, 5′‐GCTGCAAGGAAAGATCCAAG‐3′, reverse primer, 5′‐CCGAAGAGCTGCTGAGAACT‐3′; BMI1 forward primer, 5′‐CAACTGGTTCGACCTTTGCAGATA‐3′, reverse primer, 5′‐GATGTGCCAATTGCTTCTAATGGA‐3′; Notch forward primer, 5′‐CACGCGGATTAATTTGCATCTG‐3′, reverse primer, 5′‐TGGGTGCACTCTTGGCATACA‐3′; Nanog forward primer, 5′‐TCCAACATCCTGAACCTCAGCTA‐3′, reverse primer, 5′‐AGGTTCCCAGTCGGGTTCAC‐3′; Oct‐4 forward primer, 5′‐GCAATTTGCCAAGCTCCTGAA‐3′, reverse primer, 5′‐GCAGATGGTCGTTTGGCTGA‐3′; transforming >growth factor‐β (TGF‐β) forward primer, 5′‐AGCGACTC‐GCCAGAGTGGTTA‐3′, reverse primer, 5′‐GCAGTGTGTTATCCCTGCTGTCA‐3′, and GAPDH forward primer, 5′‐GCACCGTCAAGGCTGAGAAC‐3′; reverse primer, 5′‐ATGGTGGTGAAGACGCCAGT‐3′. The relative expression level of the target gene in HDACi‐treated cells to that in control cells was determined by the 2−(ΔΔCt) method.

Immunoblotting

For immunoblot analysis of cultured cells, the cells were washed three times with PBS and lysed on ice in 1 mL lysis buffer (20 mM Tris‐HCl [pH 7.6], 140 mM NaCl, 1 mM EDTA, 1% NP‐40) containing aprotinin (10 μg/mL), and subjected to ultrasonic treatment. The lysates were subjected to immunoblot analysis as described by Miyashita et al.28 The following primary antibodies were used: CD44, ABCG2, α‐tublin, E‐cadherin, and β‐actin (Cell Signaling Technology, Danvers, MA, USA).

Isobologram analysis

Synergy between HDACi and chemotherapeutic agents, including cisplatin (kindly supplied by NIPPON KAYAKU) and Docetaxel (kindly supplied by Sanofi‐Aventis) was assessed by the isobologram method, as described by Fivelman et al.29 Briefly, dose response assays were first carried out to obtain the 50% inhibitory concentration (IC50) of the individual drugs. For the combination assay, drug dilutions were made to allow the IC50 of the individual drugs to fall at about the fourth twofold serial dilution. Then, dilutions of each of the two drugs were prepared in fixed ratios. Tumor cells were seeded in 96‐well flat‐bottomed plates (BD Falcon, Franklin Lakes, NJ, USA) and treated with the combination of varying concentrations of HDACi and chemotherapeutic agent for 48 h. Two IC50s for each of the four combination curves were calculated separately, the fractional inhibitory concentration of two drugs was calculated for each point, and isobolograms were plotted.

Statistical analysis

Two‐tailed Student's t‐test was used for statistical analysis of data. P < 0.05 was considered significant. Analyses were performed using stata 9.0 (Stata Corp., College Station, TX, USA).

Results

HDACi inhibit the growth of SCCHN cells and induce apoptosis to SCCHN cells

Two SCCHN cell lines, HSC‐2 and KUMA‐1, were first cultured in serum‐free medium containing EGF and bFGF. As reported previously,23 both cell lines expressed CD44 abundantly under this culture condition (data not shown). We then examined the effect of two HDACi, SAHA and TSA, against SCCHN cell lines. As shown in Figure 1, SAHA and TSA inhibited the growth of SCCHN cell lines in a dose‐dependent manner as measured by MTS assays. The concentrations of SAHA and TSA that caused 50% inhibitory concentration (IC50) were as follows: HSC‐2, 12.1 μM; KUMA‐1, 7.1 μM for SAHA and HSC‐2, 1.9 μM; KUMA‐1, and 1.4 μM for TSA. Based on these data, subsequent experiments except the sphere formation assay were performed with 4 μM SAHA and 1 μM TSA, respectively.

Figure 1.

Figure 1

Effects of suberoylanilide hydroxamic acid (SAHA) and trichostatin A (TSA) on growth of squamous cell carcinoma of the head and neck (SCCHN) cell lines. HSC‐2 and KUMA‐1 were cultured in serum‐free medium supplemented with epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF). Trypsinized cells were plated in 96‐well flat‐bottomed plates, incubated overnight, and then exposed to various concentrations of histone deacetylase inhibitors (HDACi) for 48 h. Cell viability was assessed using an MTS assay as described in Materials and Methods. Representative data are shown from at least three experiments performed in triplicate.

To further evaluate whether HDACi could induce apoptosis in SCCHN cell lines, tumor cells were cultured with HDACi for 48 h and then analyzed for the proportion of apoptotic cells by flow cytometry. As shown in Figure 2, tumor cells treated with HDACi showed higher rates of apoptosis as compared with the control. It has been reported that CSCs derived from SCCHN could form tumor spheres, indicating that CSCs have self‐renewal capacity. Therefore, we measured the sphere‐forming ability of SCCHN cells by treatment with HDACi. As compared with the control, treatment with HDACi showed significantly lower numbers of tumor spheres (Fig. 3).

Figure 2.

Figure 2

Flow cytometry analysis of apoptosis in squamous cell carcinoma of the head and neck (SCCHN) cell lines, HSC‐2 and KUMA‐1. Tumor cells were incubated for 72 h and then treated with suberoylanilide hydroxamic acid (SAHA) (4 μM) or trichostatin A (TSA) (1 μM). After a further 48 h, the cells were harvested and analyzed for apoptosis as described in Materials and Methods.

Figure 3.

Figure 3

Effect of suberoylanilide hydroxamic acid (SAHA) and trichostatin A (TSA) on sphere formation of squamous cell carcinoma of the head and neck (SCCHN) cell lines, HSC‐2 and KUMA‐1. Cells were seeded at a density of 1 × 103 cells/mL in 24‐well ultra‐low attachment plates. After 7 days' culture, spheres were counted. Asterisks indicate a significant difference in the number of spheres (*P < 0.05 and **P < 0.01).

HDACi induced cell cycle arrest

Histone deacetylase inhibitors have been reported to induce cell cycle arrest at G1 or G2/M phase. We analyzed cell cycle distribution following HDACi treatment for 48 h by flow cytometry. Figure 4(a) shows representative diagrams of cell cycle distribution in each SCCHN cell line. In both SCCHN cell lines, the proportion of cells in G2/M phase was increased by HDACi treatment as compared with the control (Fig. 4b). At the same time, in KUMA‐1, SAHA increased the proportion of cells in G0/G1 phase. Thus, we could confirm that HDACi showed inhibition of cell growth and induction of apoptosis and cell cycle arrest, as shown by numerous studies.30

Figure 4.

Figure 4

Cell cycle distribution in squamous cell carcinoma of the head and neck (SCCHN) cell lines, HSC‐2 and KUMA‐1. Cells were incubated with histone deacetylase inhibitors (HDACi) for 48 h and analyzed by flow cytometry as described in Materials and Methods. (a) Representative diagrams of cell cycle distribution in cells treated with HDACi. (b) Analyses were performed in triplicate and are expressed as bar graphs.

HDACi decreased the expression of CD44 and ABCG2 on SCCHN cells

CD44 and ABCG2 are known as cancer stem cell markers in SCCHN. We analyzed the expression of these two stem cell markers by flow cytometry, immunoblotting, and real‐time quantitative RT‐PCR. As indicated in Figure 5(a), HSC‐2 and KUMA‐1 cultured in serum‐free medium containing EGF and bFGF expressed a high level of CD44 molecule, while KUMA‐1 but not HSC‐2 expressed ABCG2. Interestingly, treatment with each HDACi for 48 h decreased the expression level of CD44 and ABCG2 in both flow cytometric analysis and immunoblotting assay (Fig. 5a,b). Moreover, as expected, CD44 and ABCG2 mRNA expression levels were lower in HSC‐2 and KUMA‐1 treated with HDACi (Fig. 5c). Thus, the data in Figure 5 show that HDACi decreases the expression of cancer stem cell markers in SCCHN.

Figure 5.

Figure 5

Suppression of CD44 and ABCG2 expression on squamous cell carcinoma of the head and neck (SCCHN) cell lines, HSC‐2 and KUMA‐1, treated with histone deacetylase inhibitors (HDACi). Flow cytometry, immunoblotting, and real‐time quantitative RT‐PCR were performed as described in Materials and Methods. Treatment with each HDACi for 48 h decreased the expression level of CD44 and ABCG2 in both flow cytometric analysis (a) and immunoblotting assay (b). CD44 and ABCG2 mRNA expression levels were also lower in SCCHN cell lines treated with HDACi (c). HSC‐2 did not obviously detect ABCG2 expression. MFIR, mean fluorescence intensity ratio.

HDACi change the expression of stemness‐related genes and EMT‐related molecules in SCCHN cells

The key features of CSCs are activation of self‐renewal and pluripotency genes; therefore, we analyzed the expression of BMI1, Notch, Nanog, and Oct‐4 genes by treatment with HDACi using real‐time qRT‐PCR. As expected, HDACi downregulated the expression levels of four stemness‐related genes in both HSC‐2 and KUMA‐1; however, the extent of downregulation varied (Fig. 6). On the other hand, epithelial‐mesenchymal transition (EMT), which is characterized by the gain of stem cell properties, has been reported to play an important role in initiating CSCs. The hallmark of EMT is the loss of the E‐cadherin, and TGF‐β can induce EMT. Therefore, we determined the expression of E‐cadherin using immunoblotting and TGF‐β using real‐time qRT‐PCR. Treatment of SCCHN cell lines with HDACi showed increased expression of E‐cadherin and decreased expression of TGF‐β (Fig. 7), indicating that HDACi might act to suppress the EMT phenotype of CSCs.

Figure 6.

Figure 6

Downregulation of stemness genes in squamous cell carcinoma of the head and neck (SCCHN) cell lines, HSC‐2 and KUMA‐1. Total RNA was extracted from SCCHN cells treated with HADCi, and the expression level of BMI1, Notch, Nanog, and Oct‐4 was detected by real‐time quantitative RT‐PCR as described in Materials and Methods.

Figure 7.

Figure 7

Histone deacetylase inhibitors (HDACi) suppress epithelial‐mesenchymal transition (EMT)‐related molecules in squamous cell carcinoma of the head and neck (SCCHN) cell lines. (a) Cell lysates from HSC‐2 and KUMA‐1, untreated or treated with HDACi were immunoblotted with anti‐E‐cadherin. (b) Real‐time quantitative RT‐PCR was performed to detect transforming growth factor‐β (TGF‐β) mRNA levels on SCCHN cell lines, HSC‐2 and KUMA‐1 treated with HDACi. GAPDH (glyceraldehyde 3‐phosphate dehydrogenase) gene expression was evaluated as a control for mRNA normalization.

HDACi enhance chemosensitivity of SCCHN cells

Finally, we examined whether HDACi enhanced the chemosensitivity of SCCHN cells. If HDACi induced the reduction of CSC properties, HDACi might be able to enhance the sensitivity of chemotherapeutic agents. The effects of combined of HDACi and chemotherapeutic agents were assessed by the isobologram method. As shown in Figure 8, when HDACi were combined with cisplatin and docetaxel, which are frequently used for the treatment of SCCHN clinically, synergistic effects were observed.

Figure 8.

Figure 8

Effects of combined histone deacetylase inhibitors (HDACi) (suberoylanilide hydroxamic acid [SAHA] and trichostatin A [TSA]) and chemotherapeutic agents (docetaxel and cisplatin) on squamous cell carcinoma of the head and neck (SCCHN) cell lines, HSC‐2 and KUMA‐1, assessed by MTS assay. The effect of combined treatment was analyzed at the 50% growth inhibition rate. Isoborogram of the interactions between SAHA and docetaxel (a), SAHA and cisplatin (b), TSA and docetaxel (c), and TSA and cisplatin (d), respectively.

Discussion

In previous studies, we reported that a subpopulation of CD44+ cells enriched under serum‐free medium culture conditions possessed not only a marked capacity for forming tumor spheres, proliferation, migration, and invasion, but also resistance to apoptosis‐inducing stimuli, including chemotherapeutic agents, as compared with that of CD44‐ cells.23, 26 Based on these findings, we here investigated the possibility of HDACi for the treatment of CSCs in SCCHN, and we made the following important observations of CD44 +  enriched SCCHN cell lines: (i) Two HDACi, SAHA and TSA, showed cytotoxic activity, induction of apoptosis, and cell cycle arrest as reported in other malignancies; (ii) HDACi were able to alter CSC phenotypes: decrease CD44 and ABCG2 expression, suppress sphere formation, decrease stemness gene expression, and inhibit EMT; and (iii) HDACi had synergistic effects in combination with chemotherapeutic agents.

In general, HDACi induce hyperacetylation of core histone proteins, resulting in relaxation of the chromatin structure, promoting access to transcription factors, and changing gene expression. In addition to such epigenetic effects, HDACi also induces the reversible acetylation of non‐histone proteins, including transcription factors, DNA repair enzyme, and signal transduction mediators.30 So far, it has been demonstrated that as many as 7–10% of expressed genes are altered by treatment with HDACi using cDNA arrays.31, 32, 33 Although the multiple mechanisms mediated by HDACi have not been completely elucidated, it has been shown that the main anti‐cancer effects of HDACi are the induction of apoptosis and differentiation, and cell cycle arrest in G1 or G2/M. In our experiments, two HDACi, SAHA and TSA, showed cytotoxic activity, induction of apoptosis, and cell cycle arrest to SCCHN cell lines, confirming that these HDACi also act on SCCHN cells, as demonstrated in other tumor cells. With regard to the cell cycle arrest induced by HDACi in tumor cells, Richon et al.34 have demonstrated that low concentrations of HDACi predominantly induce G1 arrest, while high concentrations induce both G1 and G2/M arrest. Under our experimental conditions, HSC‐2 treated with HDACi showed predominantly G2/M arrest rather than G1 arrest. On the other hand, KUMA‐1 treated with TSA showed similar findings; however, treatment with SAHA induced cell cycle arrest in both G1 and G2/M. Besides the concentrations, various factors, such as exposure time, types of HDACi, and types of cell lines, affect cell cycle effects.

In addition to these anti‐cancer effects, HDACi have been demonstrated to have multiple biological activities, including the induction of differentiation, inhibition of angiogenesis, and immunomodulatory activity. Interestingly, HDACi suppressed various CSC properties of CD44+‐enriched SCCHN cell lines. Self‐renewal is one of the well‐known properties of CSCs and is regulated by interactions among a variety of stem cell regulators. Histone deacetylase inhibitors suppressed the expression of Bmi1, Notch, Nanog, and Oct‐4, which are essential for stem cell self‐renewal. Downregulation of each gene at the concentration used in this study was relatively modest; however, the suppression of multiple genes may lead to a strong inhibiting effect on self‐renewal capacity. Indeed, tumor sphere formations reflecting self‐renewal capacity were effectively inhibited by treatment with HDACi.

In this study, inhibition of CD44 and ABCG2 expression on tumor cells by treatment with HDACi are of particular importance. It has been shown that these molecules are not only cell surface markers of CSCs, but are also responsible for maintenance of the CSC phenotype. CD44 is a multifunctional transmembrane glycoprotein receptor that binds to hyaluronan. It has been shown that CD44‐hyaluronan interaction induces signaling events, which promote tumor cell proliferation, migration, invasion, angiogenesis, and metastases.35, 36 In fact, Bourguignon et al.37 have demonstrated that hyaluroan‐CD44 interaction activates cancer stem markers, Nanog, Oct‐4, and Sox2, and leads to multidrug transporter, ABCB1 (MDR1) gene expression. ABCB1 is related to the efflux of chemotherapeutic agents, including doxorubicin and paclitaxel, and its overexpression induces the acquisition of chemotherapy resistance. Meanwhile, ABCG2 is another well‐known multidrug resistant protein, which effluxes not only chemotherapeutic agents, but also Hoechst 33342. In a variety of cases, the cells expressing ABCG2 appear as side population (SP) cells in a Hoechst‐based flow cytometry profile, and SP cells have also been identified as stem/progenitor cells.38, 39 The SP cells obtained from freshly isolated tumor cells and tumor cell lines enrich the cell with cancer stem cell phenotypes as compared with the corresponding non‐SP cells. Thus, the inhibition of CD44 and/or ABCG2 expression on tumor cells is closely related to loss of stem cell properties and chemotherapy resistance. Contrary to our findings, To et al.40 have demonstrated that ABCG2 expression in some tumor cell lines was upregulated after treatment with another HDACi, depsipeptide, where ABCG2 promoter has a reproducible pattern of histone modification due to HDACi. Further studies are required to elucidate these differences.

Evidence has accumulated indicating that induction of EMT, which promotes invasion and metastases, plays an important role in the acquisition of CSC properties in a variety of cancers.41, 42, 43, 44 In SCCHN, Chen et al.45 have shown that ALDH+ putative CSCs enriched from SCCHN cell lines using an anchorage‐independent culture technique increased EMT‐related marker expression. In our studies, upon treatment with HDACi, E‐cadherin, which acts as a master regulator of EMT, was upregulated, and the mRNA expression level of TGF‐β, which is known to be an important inducer of EMT was downregulated, indicating that HDACi acts to inhibit EMT characteristics in CD44 + SCCHN cell lines. So far, SAHA has been shown to have reverted the mesenchymal phenotype by inducing E‐cadherin and downregulating vimentin in SCCHN.46 Similarly, in renal epithelial cells, TSA has been able to prevent TGF‐β1‐induced ENT.47 Conversely, several studies have shown that in prostate cancer cells and endometrial adenocarcinoma cells, HDACi could induce EMT.48, 49 The EMT phenomenon is regulated by a complex network consisting of a variety of EMT‐related molecules, including epithelial and mesenchymal‐related factors, and therefore such controversies may occur depending on the type of markers tested. Additionally, culture and treatment conditions and the type of cell line in each experiment vary, and therefore the clinical utility of HDACi should proceed carefully. Indeed, in a phase I trial of SAHA, a partial response was observed in a patient with laryngeal carcinoma50; however, in a phase II trial, SAHA could not show any efficacy as defined by tumor responses.51

Taken together, our studies indicated at least cell cycle arrest, downregulation of stemness‐related genes, decreased CD44 and ABCG2 expression, and inhibition of EMT, and thereby HDACi would lead to decreased drug resistance. Based on such pleiotropic effects, two HDACi combined with cisplatin or docetaxel would show synergistic effects. Our data suggest the further possible use of HDACi in combination with chemotherapy, radiotherapy, and/or immunotherapy. Currently, to overcome the treatment resistance of CSCs, various approaches, such as immunotherapy, molecularly targeted drugs, and gene therapy are being developed. Better understanding of epigenetic mechanisms as well as interplay among epigenetic factors may provide new insights for developing new pharmacological strategies.

Disclosure Statement

The authors have no conflict of interest.

Acknowledgments

This work was supported in part by grants‐in‐aid (23592523 to KC, 24791820 to KS, 24791744 to MS, 25861525 to MT, and 25462626 to KT) from the Ministry of Education, Culture, Sport, Science and Technology of Japan.

(Cancer Sci 2013; 104: 1468–1475)

References

  • 1. Clevers H. The cancer stem cell: premises, promises and challenges. Nat Med 2011; 17: 313–9. [DOI] [PubMed] [Google Scholar]
  • 2. Shipitsin M, Polyak K. The cancer stem cell hypothesis: in search of definitions, markers, and relevance. Lab Invest 2008; 88: 459–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Shackleton M, Quintana E, Fearon ER, Morrison SJ. Heterogeneity in cancer: cancer stem cells versus clonal evolution. Cell 2009; 138: 822–9. [DOI] [PubMed] [Google Scholar]
  • 4. Al‐Hajj M, Wicha MS, Benito‐Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003; 100: 3983–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 2005; 65: 10. [DOI] [PubMed] [Google Scholar]
  • 6. Li C, Heidt DG, Dalerba P et al Identification of pancreatic cancer stem cells. Cancer Res 2007; 67: 1030–7. [DOI] [PubMed] [Google Scholar]
  • 7. Singh SK, Clarke ID, Terasaki M et al Identification of a cancer stem cell in human brain tumors. Cancer Res 2003; 63: 5821–8. [PubMed] [Google Scholar]
  • 8. Schatton T, Murphy GF, Frank NY et al Identification of cells initiating human melanomas. Nature 2008; 451: 345–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Prince ME, Sivanandan R, Kaczorowski A et al Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma. Proc Natl Acad Sci U S A 2007; 104: 973–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Zhou L, Wei X, Cheng L, Tian J, Jiang JJ. CD133, one of the markers of cancer stem cells in Hep‐2 cell line. Laryngoscope 2007; 117: 455–60. [DOI] [PubMed] [Google Scholar]
  • 11. Chen YC, Chen YW, Hsu HS et al Aldehyde dehydrogenase 1 is a putative marker for cancer stem cells in head and neck squamous cancer. Biochem Biophys Res Commun 2009; 385: 307–13. [DOI] [PubMed] [Google Scholar]
  • 12. Prince MEP, Ailles LE. Cancer stem cells in head and neck squamous cell cancer. J Clin Oncol 2008; 26: 2871–5. [DOI] [PubMed] [Google Scholar]
  • 13. Shah AN, Summy JM, Zhang J, Park SI, Parikh NU, Gallick GE. Development and characterization of gemcitabine‐resistant pancreatic tumor cells. Ann Surg Oncol 2007; 14: 3629–37. [DOI] [PubMed] [Google Scholar]
  • 14. Kang MK, Kang SK. Tumorigenesis of chemotherapeutic drug‐resistant cancer stem‐like cells in brain glioma. Stem Cells Dev 2007; 16: 837–47. [DOI] [PubMed] [Google Scholar]
  • 15. Dylla SJ, Beviglia L, Park IK et al Colorectal cancer stem cells are enriched in xenogeneic tumors following chemotherapy. PLoS ONE 2008; 3: e2428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Rodriguez‐Paredes M, Esteller M. Cancer epigenetics reaches mainstream oncology. Nat Med 2011; 17: 330–9. [DOI] [PubMed] [Google Scholar]
  • 17. Sharma S, Kelly TK, Jones PA. Epigenetics in cancer. Carcinogenesis 2010; 31: 27–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Lane AA, Chabner BA. Histone deacetylase inhibitors in cancer therapy. J Clin Oncol 2009; 27: 5459–68. [DOI] [PubMed] [Google Scholar]
  • 19. Marks PA, Xu WS. Histone deacetylase inhibitors: potential in cancer therapy. J Cell Biochem 2009; 107: 600–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Gu W, Roeder RG. Activation of p53 sequence‐specific DNA binding by acetylation of the p53 C‐terminal domain. Cell 1997; 90: 595–606. [DOI] [PubMed] [Google Scholar]
  • 21. Chen L‐F, Fischle W, Verdin E, Greene WC. Duration of nuclear NF‐kappaB action regulated by reversible acetylation. Science 2001; 293: 1653–7. [DOI] [PubMed] [Google Scholar]
  • 22. Yuan ZL, Guan YJ, Chatterjee D, Chin YE. Stat3 dimerization regulated by reversible acetylation of a single lysine residue. Science 2005; 307: 269–73. [DOI] [PubMed] [Google Scholar]
  • 23. Okamoto A, Chikamatsu K, Sakakura K, Hatsushika K, Takahashi G, Masuyama K. Expansion and characterization of cancer stem‐like cells in squamous cell carcinoma of the head and neck. Oral Oncol 2009; 45: 633–9. [DOI] [PubMed] [Google Scholar]
  • 24. Ricci‐Vitiani L, Lombardi DG, Pilozzi E et al Identification and expansion of human colon‐cancer‐initiating cells. Nature 2007; 445: 111–5. [DOI] [PubMed] [Google Scholar]
  • 25. Lee J, Kotliarova S, Kotliarov Y et al Tumor stem cells derived from glioblastomas cultured in bFGF and EGF more closely mirror the phenotype and genotype of primary tumors than do serum‐cultured cell lines. Cancer Cell 2006; 9: 391–403. [DOI] [PubMed] [Google Scholar]
  • 26. Chikamatsu K, Ishii H, Takahashi G et al Resistance to apoptosis‐inducing stimuli in CD44 +  head and neck squamous cell carcinoma cells. Head Neck 2012; 34: 336–43. [DOI] [PubMed] [Google Scholar]
  • 27. Hong SP, Wen J, Bang S, Park S, Song SY. CD44‐positive cells are responsible for gemcitabine resistance in pancreatic cancer cells. Int J Cancer 2009; 125: 2323–31. [DOI] [PubMed] [Google Scholar]
  • 28. Miyashita M, Ohnishi H, Okazawa H et al Promotion of neurite and filopodium formation by CD47: roles of integrins, Rac, and Cdc42. Mol Biol Cell 2004; 15: 3950–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Fivelman QL, Adagu IS, Warhurst DC. Modified fixed‐ratio isobologram method for studying in vitro interactions between atovaquone and proguanil or dihydroartemisinin against drug‐resistant strains of Plasmodium falciparum. Antimicrob Agents Chemother 2004; 48: 4097–102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Xu WS, Parmigiani RB, Marks PA. Histone deacetylase inhibitors: molecular mechanisms of action. Oncogene 2007; 26: 5541–52. [DOI] [PubMed] [Google Scholar]
  • 31. Glaser KB, Staver MJ, Waring JF, Stender J, Ulrich RG, Davidsen SK. Gene expression profiling of multiple histone deacetylase (HDAC) inhibitors: defining a common gene set produced by HDAC inhibition in T24 and MDA carcinoma cell lines. Mol Cancer Ther 2003; 2: 151–63. [PubMed] [Google Scholar]
  • 32. Peart MJ, Smyth GK, van Laar RK et al Identification and functional significance of genes regulated by structurally different histone deacetylase inhibitors. Proc Natl Acad Sci U S A 2005; 102: 3697–702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Mitsiades N, Mitsiades CS, Richardson PG et al Molecular sequelae of histone deacetylase inhibition in human malignant B cells. Blood 2003; 101: 4055–62. [DOI] [PubMed] [Google Scholar]
  • 34. Richon VM, Sandhoff TW, Rifkind RA, Marks PA. Histone deacetylase inhibitor selectively induces p21WAF1 expression and gene‐associated histone acetylation. Proc Natl Acad Sci U S A 2000; 97: 10014–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Marhaba R, Zoller M. CD44 in cancer progression: adhesion, migration and growth regulation. J Mol Histol 2004; 35: 211–31. [DOI] [PubMed] [Google Scholar]
  • 36. Jothy S. CD44 and its partners in metastasis. Clin Exp Metastasis 2003; 20: 195–201. [DOI] [PubMed] [Google Scholar]
  • 37. Bourguignon LYW, Peyrollier K, Xia W, Gilad E. Hyaluronan‐CD44 interaction activates stem cell marker Nanog, Stat‐3‐mediated MDR1 gene expression, and ankyrin‐regulated multidrug efflux in breast and ovarian tumor cells. J Biol Chem 2008; 283: 17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Hadnagy A, Gaboury L, Beaulieu R, Balicki D. SP analysis may be used to identify cancer stem cell populations. Exp Cell Res 2006; 312: 3701–10. [DOI] [PubMed] [Google Scholar]
  • 39. Wu C, Alman BA. Side population cells in human cancers. Cancer Lett 2008; 268: 1–9. [DOI] [PubMed] [Google Scholar]
  • 40. To KKW, Polgar O, Huff LM, Morisaki K, Bates SE. Histone modifications at the ABCG2 promoter following treatment with histone deacetylase inhibitor mirror those in multidrug‐resistant cells. Mol Cancer Res 2008; 6: 151–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Mani SA, Guo W, Liao M‐J et al The epithelial‐mesenchymal transition generates cells with properties of stem cells. Cell 2008; 133: 704–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Morel AP, Lievre M, Thomas C, Hinkal G, Ansieau S, Puisieux A. Generation of breast cancer stem cells through epithelial‐mesenchymal transition. PLoS ONE 2008; 3: e2888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Santisteban M, Reiman JM, Asiedu MK et al Immune‐induced epithelial to mesenchymal transition in vivo generates breast cancer stem cells. Cancer Res 2009; 69: 2887–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Kabashima A, Higuchi H, Takaishi H et al Side population of pancreatic cancer cells predominates in TGF‐beta‐mediated epithelial to mesenchymal transition and invasion. Int J Cancer 2009; 124: 2771–9. [DOI] [PubMed] [Google Scholar]
  • 45. Chen CC, Wei Y, Hummel M et al Evidence for epithelial‐mesenchymal transition in cancer stem cells of head and neck squamous cell carcinoma. PLoS ONE 2011; 6: e16466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Bruzzese F, Leone A, Rocco M et al HDAC inhibitor vorinostat enhances the antitumor effect of gefitinib in squamous cell carcinoma of head and neck by modulating ErbB receptor expression and reverting EMT. J Cell Physiol 2011; 226: 2378–90. [DOI] [PubMed] [Google Scholar]
  • 47. Yoshikawa M, Hishikawa K, Marumo T, Fujita T. Inhibition of histone deacetylase activity suppresses epithelial‐to‐mesenchymal transition induced by TGF‐β1 in human renal epithelial cells. J Am Soc Nephrol 2007; 18: 58–65. [DOI] [PubMed] [Google Scholar]
  • 48. Kong D, Ahmad A, Bao B, Li Y, Banerjee S, Sarkar FH. Histone deacetylase inhibitors induce epithelial‐to‐mesenchymal transition in prostate cancer cells. PLoS ONE 2012; 7: e45045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Uchida H, Maruyama T, Nishikawa‐Uchida S et al Studies using an in vitro model show evidence of involvement of epithelial‐mesenchymal transition of human endometrial epithelial cells in human embryo implantation. J Biol Chem 2012; 287: 4441–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Kelly WK, O'Connor OA, Krug ML et al Phase I study of an oral histone deacetylase inhibitor, suberoylanilide hydroxamic acid, in patients with advanced cancer. J Clin Oncol 2005; 23: 3923–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Blumenschein GR Jr, Kies MS, Papadimitrakopoulou VA et al Phase II trial of the histone deacetylase inhibitor vorinostat (Zolionza™, suberoylanilide hydroxamic acid, SAHA) in patients with recurrent and/or metastatic head and neck cancer. Invest New Drugs 2008; 26: 81–7. [DOI] [PubMed] [Google Scholar]

Articles from Cancer Science are provided here courtesy of Wiley

RESOURCES