Abstract
Background
Salmonella Paratyphi A causes paratyphoid A, a severe systemic disease of people and remains a major public health problem in many parts of the world. In the interest of researching the roles of sptP on Salmonella Paratyphi A and developing a live‐attenuated vaccine candidate, an sptP mutant of Salmonella Paratyphi A SPA017 (SPA017ΔsptP) was constructed, and then its characterization, immunogenicity, and protective ability were evaluated.
Results
The deletion of sptP had no effect on growth and biochemical properties. Adhesion and invasion assays showed that the lack of sptP did not affect the adhesion of Salmonella Paratyphi A, but the invasive ability of the mutant strain was significantly decreased, the half‐lethal dose (LD50) of the mutant strain was 1.43 × 104 times of the parent strain in intraperitoneally injected mice. Single intraperitoneal vaccination with SPA017ΔsptP (1 × 105 CFU) in mice did not affect the body weight or elicit clinical symptoms relative to the control group, SPA017ΔsptP bacteria were isolated from livers and spleens of vaccinated mice at 14 days postvaccination. Notably, specific humoral and cellular immune responses were significantly induced. The protective assessment showed that the mutant strain could provide high‐level protection against subsequent challenge with the wild‐type SPA017 strain.
Conclusions
These results demonstrated that SptP plays an essential role in the pathogenicity of Salmonella Paratyphi A, and Salmonella Paratyphi A lacking sptP is immunogenic and protective in mice.
Keywords: paratyphoid fever, pathogenicity, Salmonella Paratyphi A, sptP, vaccine
Salmonella Paratyphi A lacking sptP is attenuated, immunogenic, and protective in mice. The sptP mutant SPA017ΔsptP has the potential of being a live‐attenuated vaccine candidate.
Abbreviations
- LB
Luria‐Bertani
- LD50
half‐lethal dose
- SI
stimulation index
- SPI1
Salmonella pathogenicity island 1
- T3SS
type III secretion system
1. INTRODUCTION
Pathogenic bacteria belonging to the genus Salmonella can cause a series of diseases in humans and animals. 1 Salmonella Paratyphi A is the pathogen of paratyphoid A which can cause typhoid‐like clinical symptoms characterized by prolonged fever, headache, loss of appetite, nausea/vomiting, abdominal pain, and diarrhea, which can be life‐threatening. 2 People are generally susceptible to Salmonella Paratyphi A, but the incidence is highest in children and young adults, and in severe cases, death may occur. 3 , 4 Also, it has been reported that the bacteria of Salmonella Paratyphi A can transmit vertically and results in abortion. 5 In recent years, the incidence of paratyphoid A has increased and remains high in many parts of the world, and has become a major public health problem. 2 , 6
Drug therapy is a standard option to deal with Salmonella Paratyphi A infection, but the increase of drug resistance and the emergence of multi‐drug resistance has become a thorny problem in the treatment of Salmonella Paratyphi A infection. 7 Currently, there are no commercial vaccines specifically targeting Salmonella Paratyphi A infection in the market. Therefore, it is necessary to carry out the research and development of Salmonella Paratyphi A vaccine. Type III secretion system (T3SS), whose central function is to deliver the bacterial protein into host cells is a vital strategy evolved by Salmonella to infect host cells. 8 Salmonella encodes two T3SSs (T3SS1 and T3SS2), they are encoded on Salmonella pathogenicity island 1 (SPI1) and SPI2, respectively. The function of T3SS1 and T3SS2 is different, T3SS1 can translocate a set of effectors to promote the invasion of Salmonella into host cells, then T3SS2 is induced and mediates systemic infection of Salmonella in the host. 9 As a Salmonella protein tyrosine phosphatase, SptP encoded within SPI1 is one of the T3SS1 effectors, and plays essential roles in downregulating membrane ruffling and Salmonella‐containing vacuole maintenance. 10 SptP is also a modular protein, including two distinct domains: (1) the N‐terminal domain, which acts as a GTPase‐activating protein for Rac1 and Cdc42. It mediates the reversion of the actin cytoskeleton changes; and (2) the C‐terminal half of SptP, which has a similar sequence with prokaryotic tyrosine phosphatase YopH of Yersinia and eukaryotic tyrosine phosphatases. 11 , 12 A chaperone, SicP, is required for the stability within the bacterial cytosol and secretion of SptP. 13 , 14 The virulence of Salmonella enteritidis was reduced considerably with the absence of sptP, the mutant could be applied as a vaccine to protect against Salmonella enteritidis infection. 15 This provides an idea for the development of paratyphoid A vaccine based on the lack of sptP.
Herein, a sptP deletion mutant of Salmonella Paratyphi A was established. Subsequently, we assessed its features, including growth rate and biochemical properties. Thus, we conducted adhesion and invasion assays to examine its virulence. Furthermore, we evaluated the protective and immunogenicity of the mutant to develop a live‐attenuated vaccine candidate against Salmonella Paratyphi A.
2. MATERIALS AND METHODS
2.1. Bacterial strains, plasmids, and primers
The wild‐type Salmonella Paratyphi A strain SPA017 was stored in our laboratory, 16 the sptP deletion mutant SPA017ΔsptP and SPA017ΔsptP::cat (chloramphenicol resistance, Cmr) were constructed using lambda Red recombination system with the primer sptP‐cat‐F/sptP‐cat‐R, and plasmids pKD3, pKD46, and pCP20, 17 the complementation CoSPA017ΔsptP (ampicillin resistance, Ampr) was constructed with the plasmid of pBR322 through ClonExpressTM II One Step Cloning Kit (Vazyme Biotech Co., Ltd). Bacteria were grown in Luria‐Bertani (LB) broth, LB agar (solidified with 1.5% (wt/vol) agar), or XLT4 (Difco) agar media according to different needs. The media were supplemented with Amp (100 μg ml−1)/Cm (34 μg ml−1) depending on the need. The primers used herein are listed in Table 1.
Table 1.
Primers used in this study
| Primers | Sequences (5′−3′) | Production size (bp) | Usage | Source |
|---|---|---|---|---|
| sptP‐cat‐F | TTGAGTCATTTGTGAATAAGCAGGAAGCGCTCAAAAACATACTACAGGAATtgtgtaggctggagctgcttcg | 1115 | Capital letter: sptP homologous arm; small letter: Cmr cassette amplification | This study |
| sptP‐cat‐R | ACAGAAATAGCTTACTTTCAGATAGTTCTAAAAGTAAGCTATGTTTTTAcatatgaatatcctccttag | |||
| sptP‐out‐F | CCATTGGTCATAACCGAGAT | 2178 or 631 | Identification of sptP mutant | This study |
| sptP‐out‐R | GGCTGCGAATAATGAAGGT | |||
| sptP‐in‐F | TTGGTCTATCGCACCTCCC | 269 or 0 | Identification of sptP mutant and its complementation | This study |
| sptP‐in‐R | GAATGCCTGTGCCAGTGAA | |||
| CoΔsptP‐F | cagcttatcatcgataagcttTCAGCTTGCCGTCGTCATAAGCA | 1773 | Small letter: homologous sequences of pBR322; capital letter: sptP cassette amplification; bold: restriction sites | This study |
| CoΔsptP‐R | tgcgtccggcgtagaggatccTACATGCAATTACCGATCTGAC |
2.2. Growth and biochemical testing
The influence of sptP gene on the growth rate of Salmonella Paratyphi A was determined as previously described. 16 Briefly, bacteria SPA017, SPA017ΔsptP, and CoSPA017ΔsptP were inoculated in 5 ml LB broth, then maintained in a shaker (180 rpm) overnight at 37°C. Subsequently, each culture was diluted to OD600 of 0.05 with LB broth, and this was used as the starting concentration (0 h). The culture was grown for 16 h, and the OD600 was determined every 2 h. Then the biochemical characteristics of SPA017, SPA017ΔsptP, and CoSPA017ΔsptP were performed using micro‐biochemical tubes (Qingdao Hopebio‐Technology Co., Ltd.) as described previously. 16
2.3. Invasion and adhesion assays
We conducted the assays mentioned above using Caco‐2 BBE (human epithelial cells) and RAW264.7 (mouse macrophage cells), as previously described. 15 In brief, cells (2 × 105) from each cell line were seeded into 24‐well plates 24 h before infection, then each cell lines were infected with SPA017, SPA017ΔsptP, and CoSPA017ΔsptP for 30 min (RAW264.7) or 1 h (Caco‐2 BBE) at a multiplicity of infection of 100:1, respectively. For adhesion, the cells were rinsed three times and lysed in 1 ml of phosphate‐buffered saline (PBS) with 0.5% Triton X‐100 at 37°C for 10 min, for invasion, the plates were incubated for an additional 30 min in culture medium with 100 μg ml−1 gentamicin after adhesion and the cells were washed and lysed in PBS with 0.5% Triton X‐100 at 37°C for 10 min, then the bacteria number was counted. The results of adhesion and invasion were expressed as the fold change compared to the bacterial number of SPA017ΔsptP, respectively.
2.4. Virulence assessment
Female BALB/c mice (8‐weeks‐old) were obtained from the Experimental Animal Center of Xinxiang Medical University. The animal experiments were approved by the Animal Care and Ethics Committee of Xinxiang University, Xinxiang, China.
To determine the virulence of SPA017ΔsptP in BALB/c mice, 24 mice were divided randomly into four groups (n = 6), each group was inoculated intraperitoneally with 10X dilutions of SPA017ΔsptP from 1 × 108 to 1 × 105 CFU in 100 μl PBS; another 36 mice were injected intraperitoneally with SPA017 or CoSPA017ΔsptP; six control mice were given 100 μl of PBS in the same manner (Table 2). Records of deaths were taken over 14 days. The Karber and Behrens method was applied in the calculation of the half‐lethal dose (LD50) as described previously. 18
Table 2.
LD50 of SPA017, SPA017ΔsptP, and CoSPA017ΔsptP in mice after intraperitoneal injection
| Strains | Challenge dose (CFU) | No. of deaths/total no. of mice | LD50 (CFU) |
|---|---|---|---|
| SPA017 | 1 × 103 | 6/6 | 1.00 × 102 |
| 1 × 102 | 3/6 | ||
| 1 × 101 | 0/6 | ||
| SPA017ΔsptP | 1 × 108 | 6/6 | 1.43 × 106 |
| 1 × 107 | 5/6 | ||
| 1 × 106 | 3/6 | ||
| 1 × 105 | 0/6 | ||
| CoSPA017ΔsptP | 1 × 103 | 6/6 | 1.00 × 102 |
| 1 × 102 | 3/6 | ||
| 1 × 101 | 0/6 | ||
| PBS | – | 0/6 | – |
Abbreviations: CFU, colony‐forming unit; LD50, half‐lethal dose; PBS, phosphate‐buffered saline.
2.5. Changes in body weight and clinical symptoms
To assess the effects of the mutant SPA017ΔsptP on the growth of the mice, twenty‐seven 8‐weeks‐old female BALB/c mice were divided randomly into Group 1 (n = 11, received 2 × 105 CFU of SPA017ΔsptP in 100 μl PBS intraperitoneally) and Group 2 (n = 16, received 100 μl PBS). We measured the body weights of the mice at 3, 7, and 14 days postinoculation (dpi). Clinical symptoms (such as diarrhea, anorexia, depression, mortality, and morbidity) were also observed, and daily records taken from Day 1 to 14 postinoculation.
2.6. Colonization and persistence assay
To assess the persistence of the mutant SPA017ΔsptP in immunized mice, three mice from per group were euthanized at 7 and 14 dpi, liver and spleen samples were aseptically collected for bacterial recovery. The weight of the samples was weighed, and PBS was added to make a suspension. One‐hundred microliters of homogenates of different dilutions were inoculated on XLT4 agar counted after 20 h at 37°C. The result was expressed as log10 CFU/g, and the negative sample was considered as 0 CFU/g.
2.7. SPA017ΔsptP‐mediated immune responses
At 3, 7, and 14 dpi, the serum immunoglobulin G (IgG) levels were determined using heat‐inactivated Salmonella Paratyphi A SPA017 as a coating antigen. 16 Blood samples were collected from mouse tail veins, and then serum samples were separated, serum samples (diluted 1:50) and horseradish peroxidase‐conjugated goat anti‐mouse IgG (diluted 1:10,000) were used as the primary antibody and the secondary antibody, respectively. The result was shown using absorbance at 492 nm using an ELISA reader.
The cellular immune responses were determined by peripheral mononuclear cell proliferation assay at 7 and 14 dpi. 19 , 20 The wild‐type Salmonella Paratyphi A strain SPA017 was used to prepare a soluble antigen. Peripheral lymphocytes were separated from three blood samples per group at each time point. After Trypan blue dye exclusion testing, each well of a 96‐well plate was inoculated with 100 μl of a lymphocyte suspension at a concentration of 5 × 106 cells/ml suspended in Roswell Park Memorial Institute 1640 medium (supplemented with 10% fetal calf serum, 50 U/ml penicillin, 50 μg/ml streptomycin, and 2 mM l‐glutamine) for 48 h at 37°C in a humidified 5% CO2 atmosphere. Lymphocyte proliferation activity was measured by adenosine triphosphate bioluminescence, and the result was expressed by the stimulation index (SI). 20
2.8. Protection assessment
At 14 dpi, five animals were randomly taken from Group 1 and named Group A, and 10 mice were randomly taken from Group 2 and divided into Groups B and C with five animals in each group. Group A and B were subjected to intraperitoneal injection of Salmonella Paratyphi A strain SPA017 at a dose of 1 × 103 CFU per mouse. Group C was inoculated with 100 μl PBS per mouse. Subsequently, daily records of surviving animals and clinical symptoms, such as anorexia, depression, diarrhea, mortality, and morbidity were taken daily for 15 days postchallenge.
2.9. Data analysis
Data are presented as the mean ± SEM. All the analyses were performed using GraphPad Prism. *p < .05 and **p < .01 represented two levels of statistical significance when using a one‐way analysis of variance.
3. RESULTS
3.1. Growth and biochemical characteristics of the mutant SPA017ΔsptP
Growth curve analysis revealed that the wild‐type strain SPA017, the mutant SPA017ΔsptP, and the complementation CoSPA017ΔsptP grew at a very similar rate in LB broth at 37°C (Figure 1).
Figure 1.
Growth curves of the parental strain SPA017, the mutant strain SPA017ΔsptP and the complementation strain CoSPA017ΔsptP in LB broth. All strains showed an identical growth response. Values represent the mean ± SEM. LB, Luria‐Bertani; OD, optical density
The biochemical tests showed that the mutant SPA017ΔsptP were positive in arabinose, mannitol, glucose, methyl‐red, rhamnose, and ornithine decarboxylase, and negative in citrate, glycerol, H2S, indole, lysine decarboxylase, lactose, oxidase, sucrose, phenylalanine, urea, xylose, and Voges–Proskauer in the same fashion to the wild‐type strain SPA017 and the complementation CoSPA017ΔsptP.
3.2. Adhesion and invasion analysis in cells
Adhesion and invasion assays were performed in RAW264.7 and Caco‐2 BBE. The deletion of sptP gene did not affect the ability of adhesion of Salmonella Paratyphi A in cells of RAW264.7 and Caco‐2 BBE. However, the ability of invasion of the mutant SPA017ΔsptP is significantly lower than that of SPA017 and CoSPA017ΔsptP (Figure 2), implying the deletion of sptP gene from Salmonella Paratyphi A could decrease the ability of invasion (p < .01) significantly.
Figure 2.
Bacterial adhesion (A) and invasion (B) of the parental strain SPA017, the mutant strain SPA017ΔsptP and the complementation strain CoSPA017ΔsptP in human epithelial Caco‐2 BBE cells and mouse macrophage RAW264.7. The result is expressed as the fold change compared to the bacterial number of SPA017ΔsptP. Values represent the mean ± SEM. **p < .01
3.3. Determination of LD50
The LD50 of SPA017, SPA017ΔsptP, and CoSPA017ΔsptP were 1.00 × 102 CFU, 1.43 × 106 CFU, and 1.00 × 102 CFU, respectively (Table 2). The LD50 of the mutant SPA017ΔsptP was 1.43 × 104 times higher compared to that of the wild‐type strain SPA017, indicating that the mutant virulence reduced remarkably in comparison to the wild‐type strain.
3.4. Effect of vaccination on body weight and associated clinical symptoms
No significant difference was observed regarding the mean body weight of mice in Group 1 (immunized with SPA017ΔsptP) and Group 2 (mock group) at 3, 7, and 14 dpi (Table 3). Observation of the clinical symptoms showed that the immunized mice were in a normal state relative to the control group, without symptoms of diarrhea, anorexia, depression, mortality, and morbidity.
Table 3.
Mean body weights of mice after vaccination
| Group | Mean body weight per mouse at dpi (g) | ||
|---|---|---|---|
| 3 | 7 | 14 | |
| 1 | 21.554 ± 0.473 | 22.382 ± 0.664 | 22.936 ± 0.516 |
| 2 | 20.848 ± 0.716 | 21.597 ± 0.690 | 22.988 ± 0.847 |
Abbreviation: dpi, days postinoculation.
3.5. Bacterial colonization and persistence in mice
Bacteria were not isolated from spleen and liver samples of control mice. SPA017ΔsptP was isolated from the spleen and liver samples of the immunized mice at 7 and 14 dpi, the number of SPA017ΔsptP has significantly decreased from 7 to 14 dpi in both liver and spleen (p < .05), as shown in Figure 3.
Figure 3.
Bacterial recovery from the liver and spleen of the inoculated mice. Group 1 was intraperitoneally inoculated with 2 × 105 CFU SPA017ΔsptP in BALB/c mice, and Group 2 only received 100 μl PBS. Values represent the mean ± SEM log10 CFU/g. All liver and spleen samples of Group 2 were negative. CFU, colony‐forming unit; dpi, days postinoculation; PBS, phosphate‐buffered saline. *p < .05
3.6. Cellular and humoral immune responses
Cellular and humoral immune responses were measured after intraperitoneal inoculation with SPA017ΔsptP. The mice in Group 1 (inoculated with SPA017ΔsptP) showed significantly higher serum IgG levels and elevated SI values at 7 and 14 dpi compared to Group 2, as shown in Figure 4A,B (p < .05).
Figure 4.
Humoral and cellular immune responses after vaccination. (A) Determination of serum IgG levels. (B) Stimulation index (SI) of mice lymphocyte samples. Groups 1 and 2 refer to Figure 3. Values represent the mean ± SEM. *Significant difference compared to Group 2, p < .05. dpi, days postinoculation; IgG, immunoglobulin G; OD, optical density
3.7. Evaluation of protection
The percent survival of mice intraperitoneally immunized with the mutant SPA017ΔsptP, followed by intraperitoneal challenge with the parent Salmonella Paratyphi A strain SPA017 at 14 days postimmunization was shown in Table 4. The survival rate of immunized mice (Group A) was 100%; all mice of Group B died following challenge with SPA017. Compared with mice in Group C, the immunized mice exhibited minor and brief clinical symptoms. Severe clinical symptoms, including anorexia, depression, diarrhea, morbidity, as well as high mortality, were observed in Group B. Effective protection was offered by SPA017ΔsptP.
Table 4.
Protective rates of SPA017ΔsptP in mice via intraperitoneal vaccination
| Group | Vaccination | Number | Challenge | Survivors/total | Survival rate (%) | |||
|---|---|---|---|---|---|---|---|---|
| Strain | Dose (CFU) | Strain | Route | Dose (CFU) | ||||
| A | SPA017ΔsptP | 2 × 105 | 5 | SPA017 | Intraperitoneally | 1 × 103 | 5/5 | 100** |
| B | PBS | – | 5 | SPA017 | Intraperitoneally | 1 × 103 | 0/5 | 0 |
| C | PBS | – | 5 | PBS | Intraperitoneally | – | 5/5 | 100 |
p < .01 for comparison of Group A with Group B.
Abbreviations: CFU, colony‐forming unit; PBS, phosphate‐buffered saline.
4. DISCUSSION
In the present study, an sptP gene deletion mutant (SPA017ΔsptP) of Salmonella Paratyphi A SPA017 was constructed successfully, and then its characterization was analyzed based on growth, biochemical testing, adhesion and invasion assays, virulence assay. Finally, the protective efficacy of SPA017ΔsptP was assessed in mice.
We all know that the sptP gene was obtained through horizontal gene transfer with SPI1, 21 so we suspect that SptP is not an essential metabolic factor for Salmonella. After the mutant SPA017ΔsptP of Salmonella Paratyphi A and its complementation CoSPA017ΔsptP were successfully constructed, growth curves and biochemical testing indicated that the mutant of sptP gene did not affect the growth and biochemical properties of Salmonella Paratyphi A. Also, the loss of sptP gene did not influence the growth of Salmonella enteritidis, 15 this result was consistent with that of us.
Adhesion is essential and initial for Salmonella infection; invasion is the second step following adhesion, and then results in diseases. 21 Our results showed that loss of sptP did not affect the ability of adhesion of Salmonella Paratyphi A in RAW264.7 and Caco‐2 BBE, but lack of sptP gene can decrease the invasive ability of Salmonella Paratyphi A into these two cell lines significantly. Similar results were also observed after the loss of sptP in Salmonella enteritidis and Salmonella typhimurium. 11 , 15 However, a few studies found that lack of sptP from S. typhi did not affect the invasive efficiency into HeLa cells due to the transcriptional regulator, TviA, which can be found in only Salmonella typhi and repress T3SS1 and flagella in Salmonella typhi. 11 , 20 , 21 , 22 , 23 To determine the influence of the sptP on virulence in Salmonella Paratyphi A in mice, the LD50 of the mutant SPA017ΔsptP was measured. Our result demonstrated that loss of sptP can significantly reduce the virulence of Salmonella Paratyphi A; it was consistent with previous studies. 11 , 15
Vaccination is an ideal choice to control and prevent Salmonella infection. 24 Finally, we measured the protective efficacy of SPA017ΔsptP in mice after intraperitoneal vaccination based on changes in body weight and clinical symptoms, SPA017ΔsptP colonization and persistence, cellular and humoral immune responses, as well as protective rates. Our results show that SPA017ΔsptP had no influence on the growth of the inoculated mice and did not cause any adverse reactions in mice, which is an important indicator for evaluating the safety of vaccines. The mutant SPA017ΔsptP can persist at least 14 days in immunized mice. It provided the condition for SPA017ΔsptP to induce the immune responses. Induction of effective cellular and humoral immune responses is an important indicator of the Salmonella vaccine. 24 Our results showed that the mutant SPA017ΔsptP considerably induced specific cellular and humoral immune responses in mice. Finally, to evaluate the protective efficiency of SPA017ΔsptP in mice, the parental virulent strain SPA017 was used for the challenge. Our results demonstrated that the mutant SPA017ΔsptP offered efficient protection against the infection of Salmonella Paratyphi A. A previous study had shown that the loss of sptP from Salmonella enteritidis could also provide efficient protection in BABL/c mice. 15 Also, based on the mutant SPI2, yncD and/or htrA from Salmonella Paratyphi A also showed the potential of being a live‐attenuated vaccine candidate. 16 , 25 , 26 Next, further trials are needed for us to evaluate in detail the protective efficacy of the mutant SPA017ΔsptP based on other aspects, such as the doses, and pathway of vaccination, and so on.
Overall, our research shows that the sptP mutant (SPA017ΔsptP) of Salmonella Paratyphi A is attenuated, immunogenic, and protective in mice, and SPA017ΔsptP has the potential to become a live‐attenuated vaccine.
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.
AUTHOR CONTRIBUTIONS
Qunli He and Junlei Yin designed the experiments; Pengtao Pan, Qunli He, and Junlei Yin conducted the experiments; Pengtao Pan, Fanyu Zou, and Chuanshan He performed the experiments; Pengtao Pan, Fanyu Zou, Chuanshan He, and Junlei Yin analyzed the data and drafted the manuscript; Qunli He and Junlei Yin finalized the manuscript.
ACKNOWLEDGMENTS
This study was supported by the National Natural Science Foundation of China (Grant No. 81702074), Henan of Programs for Science and Technology Development (Grant No. 192102310416), PhD Programs Foundation of Xinxiang University (Grant No. 1366020121).
Pan P, Zou F, He C, He Q, Yin J. Characterization and protective efficacy of a sptP mutant of Salmonella Paratyphi A. Immun Inflamm Dis. 2020;8:774–781. 10.1002/iid3.369
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available from the corresponding author upon reasonable request.
REFERENCES
- 1. Wain J, House D, Parkhill J, Parry C, Dougan G. Unlocking the genome of the human typhoid Bacillus . Lancet Infect Dis. 2002;2:163‐170. [DOI] [PubMed] [Google Scholar]
- 2. Gibani MM, Britto C, Pollard AJ. Typhoid and paratyphoid fever: a call to action. Curr Opin Infect Dis. 2018;31:440‐448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Gupta S, Singh B, Kapoor H, Minocha SK, Jain AK. Ventricular septal defect with endocarditis caused by Salmonella Paratyphi A. Trop Doct. 1994;24:40. [DOI] [PubMed] [Google Scholar]
- 4. Arndt MB, Mosites EM, Tian M, et al. Estimating the burden of paratyphoid A in Asia and Africa. PLoS Negl Trop Dis. 2014;8:e2925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Sethi S, Gautam V, Gupta K, Suri V, Angrup A. Vertical transmission of Salmonella enterica serotype Paratyphi A leading to abortion. JMM Case Rep. 2017;4:e005127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Saleh S, Van Puyvelde S, Staes A, et al. Salmonella typhi, Paratyphi A, enteritidis and typhimurium core proteomes reveal differentially expressed proteins linked to the cell surface and pathogenicity. PLoS Negl Trop Dis. 2019;13:e0007416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Wain J, Hendriksen RS, Mikoleit ML, Keddy KH, Ochiai RL. Typhoid fever. Lancet. 2015;385:1136‐145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Galan JE, Collmer A. Type III secretion machines: bacterial devices for protein delivery into host cells. Science. 1999;284:1322‐1328. [DOI] [PubMed] [Google Scholar]
- 9. Hapfelmeier S, Hardt WD. A mouse model for S. typhimurium‐induced enterocolitis. Trends Microbiol. 2005;13:497‐503. [DOI] [PubMed] [Google Scholar]
- 10. Humphreys D, Hume PJ, Koronakis V. The Salmonella effector SptP dephosphorylates host AAA+ATPase VCP to promote development of its intracellular replicative niche. Cell Host Microbe. 2009;5:225‐233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Johnson R, Byrne A, Berger CN, et al. The type III secretion system effector SptP of Salmonella enterica serovar Typhi. J Bacteriol. 2017;199:e00647‐16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Kaniga K, Uralil J, Bliska JB, Galán JE. A secreted protein tyrosine phosphatase with modular effector domains in the bacterial pathogen Salmonella typhimurium . Mol Microbiol. 1996;21:633‐641. [DOI] [PubMed] [Google Scholar]
- 13. Fu Y, Galan JE. Identification of a specific chaperone for SptP, a substrate of the centisome 63 type III secretion system of Salmonella typhimurium . J Bacteriol. 1998;180:3393‐3399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Lee SH, Galan JE. Salmonella type III secretion‐associated chaperones confer secretion‐pathway specificity. Mol Microbiol. 2004;51:4834‐4895. [DOI] [PubMed] [Google Scholar]
- 15. Lin Z, Tang P, Jiao Y, et al. Immunogenicity and protective efficacy of a Salmonella enteritidis sptP mutant as a live attenuated vaccine candidate. BMC Vet Res. 2017;13:194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Yin J, Cheng Z, Wu Y, et al. Characterization and protective efficacy of a Salmonella pathogenicity island 2 (SPI2) mutant of Salmonella Paratyphi A. Microb Pathog. 2019;137:103795. [DOI] [PubMed] [Google Scholar]
- 17. Datsenko KA, Wanner BL. One‐step inactivation of chromosomal genes in Escherichia coli K‐12 using PCR products. Proc Natl Acad Sci USA. 2000;97:6640‐6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Gilles HJ. Calculation of the index of acute toxicity by the method of linear regression. Comparison with the method of "Karber and Behrens". Eur J Toxicol Hyg Environ. 1974;7:77‐84. [PubMed] [Google Scholar]
- 19. Yin J, Cheng Z, Wang X, et al. Evaluation of Salmonella enterica Serovar Pullorum pathogenicity island 2 mutant as a candidate live attenuated oral vaccine. Clin Vaccine Immunol. 2015;22:706‐710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Rana N, Kulshreshtha RC. Cell‐mediated and humoral immune responses to a virulent plasmid‐cured mutant strain of Salmonella enterica serotype gallinarum in broiler chickens. Vet Microbiol. 2006;115:156‐162. [DOI] [PubMed] [Google Scholar]
- 21. Arricau N, Hermant D, Waxin H, Popoff MY. Molecular characterization of the Salmonella typhi StpA protein that is related to both Yersinia YopE cytotoxin and YopH tyrosine phosphatase. Res Microbiol. 1997;148:21‐26. [DOI] [PubMed] [Google Scholar]
- 22. Groisman EA, Ochman H. How Salmonella became a pathogen. Trends Microbiol. 1997;5:343‐349. [DOI] [PubMed] [Google Scholar]
- 23. Winter SE, Winter MG, Poon V, et al. Salmonella enterica Serovar Typhi conceals the invasion‐associated type three secretion system from the innate immune system by gene regulation. PLoS Pathog. 2014;10:e1004207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Winter SE, Winter MG, Atluri V, et al. The flagellar regulator TviA reduces pyroptosis by Salmonella enterica serovar Typhi. Infect Immun. 2015;83:1546‐1555. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Mastroeni P, Chabalgoity JA, Dunstan SJ, Maskell DJ, Dougan G. Salmonella: immune responses and vaccines. Vet J. 2001;161:132‐164. [DOI] [PubMed] [Google Scholar]
- 26. Xiong K, Chen Z, Zhu C, et al. Safety and immunogenicity of an attenuated Salmonella enterica serovar Paratyphi A vaccine candidate. Int J Med Microbiol. 2015;305:563‐571. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon reasonable request.