The immunoglobulin G antibody response to malaria merozoite antigens in asymptomatic children co-infected with malaria and intestinal parasites

Crespo’o Mbe-cho Ndiabamoh; Gabriel Loni Ekali; Livo Esemu; Yukie Michelle Lloyd; Jean Claude Djontu; Wilfred Mbacham; Jude Bigoga; Diane Wallace Taylor; Rose Gana Fomban Leke

doi:10.1371/journal.pone.0242012

. 2020 Nov 10;15(11):e0242012. doi: 10.1371/journal.pone.0242012

The immunoglobulin G antibody response to malaria merozoite antigens in asymptomatic children co-infected with malaria and intestinal parasites

Crespo’o Mbe-cho Ndiabamoh ^1,^2,^*, Gabriel Loni Ekali ^2,³, Livo Esemu ^2,⁴, Yukie Michelle Lloyd ⁵, Jean Claude Djontu ², Wilfred Mbacham ^1,^2,⁴, Jude Bigoga ^2,⁴, Diane Wallace Taylor ⁵, Rose Gana Fomban Leke ^2,^*

Editor: Luzia Helena Carvalho⁶

PMCID: PMC7654760 PMID: 33170876

Abstract

Background

Co-infection with malaria and intestinal parasites is common in children in Africa and may affect their immune response to a malaria parasite infection. Prior studies suggest that co-infections may lead to increased susceptibility to malaria infection and disease severity; however, other studies have shown the reverse. Knowledge on how co-morbidities specifically affect the immune response to malaria antigens is limited. Therefore, this study sought to determine the prevalence of co-infection of malaria and intestinal parasites and its association with antibody levels to malaria merozoite antigens.

Methods

A cross sectional study was carried out in two villages with high transmission of malaria in Cameroon (Ngali II and Mfou) where mass drug administration (MDA) had been administered at ~6-month intervals (generally with albendazole or mebendazole). Children aged 1–15 years were enrolled after obtaining parental consent. A malaria rapid diagnostic test was used on site. Four (4) ml of peripheral blood was collected from each participant to determine Plasmodium falciparum infections by microscopy, haemoglobin levels and serology. Fresh stool samples were collected and examined by wet mount, Kato-Katz method and modified Ritchie concentration techniques. A Multiplex Analyte Platform assay was used to measure antibody levels.

Results

A total of 320 children were enrolled. The prevalence of malaria by blood smear was 76.3% (244/320) and prevalence of malaria and intestinal parasites was 16.9% (54/320). Malaria prevalence was highest in young children; whereas, intestinal parasites (IP+) were not present until after 3 years of age. All children positive for malaria had antibodies to MSP1₄₂, MSP2, MSP3 and EBA175. No difference in antibody levels in children with malaria-co infections compared to malaria alone were found, except for antibody levels to EBA-175 were higher in children co-infected with intestinal protozoa (p = 0.018), especially those with Entamoeba histolytica infections (p = 0.0026).

Conclusion

Antibody levels to EBA175 were significantly higher in children co-infected with malaria and E. histolytica compared to children infected with malaria alone. It is important to further investigate why and how the presence of these protozoans might modulate the immune response to malaria antigens.

Introduction

In sub-Saharan Africa, malaria caused by Plasmodium falciparum (Pf) remains an important public health threat, killing over 271,000 children under the age of five each year [1]. In malaria endemic areas, individuals exposed to malaria infections gradually develop clinical immunity [2] and commonly experience asymptomatic infections without fever or symptoms and do not require antimalarial treatment. Asymptomatic infection results from partial immunity that controls, but does not completely eliminate, malaria parasites, thus allowing for constant presence of circulating parasites [2].

The prevalence of intestinal parasitic infections in children is fairly constant across sub-Saharan Africa with an average prevalence of 26% [3,4]. In Cameroon, the prevalence in children less than 18 years is 26.8% [5], while that for the general population is more than 28% The major intestinal parasites are Ascaris lumbricoides, T. trichiura and Entamoeba histolytica complex [6–8], but many cases of intestinal parasites go undetected.

Co-infections with malaria and intestinal parasites (IP) are common in malaria endemic areas in sub-Saharan Africa [7,8] and infections with IP and Pf are both ranked among the major cause of mortality and morbidity in sub-Saharan Africa. Several studies conducted on IP (intestinal helminths) and Pf have shown conflicting results. Some helminths suppress different T-helper types and favor an increase in regulatory T (Treg) cell [9]. Studies on concomitant infections in humans suggest that A. lumbricoides infection may protect against cerebral malaria [10,11], while other studies suggest that children infected by Schistosoma mansoni may be more susceptible to P. falciparum infections and develop acute malaria episodes [12,13]. Also, it has been shown that the levels of TNF-α, IL-2, IL-10, IL-6 in Plasmodium-helminth co-infected individuals were significantly higher than the malaria-positive (MP) group [14] dampening the immune response to malaria. However, to our knowledge, no studies have been conducted regarding host immune responses to malaria in children co-infected with protozoan pathogens.

A previous study suggests that children co-infected with malaria and intestinal helminths had significantly decreased antibody levels to the malarial antigen apical merozoite antigen 1 (AMA-1) compared to those with P. falciparum or IP alone [15]. Hence, infections with intestinal helminths can stifle protective anti-plasmodial antibody responses [15]. However, increase in MSP3 IgG1–4 levels were significantly associated with children infected with malaria alone compared to children co-infected with both parasites [15].

Malaria and other intestinal parasites overlap extensively in their epidemiological distributions causing polyparasitism. Polyparasitism with intestinal parasites has been reported as one of the contributing factors to hypo-responsiveness [16], dampening of the immune response by inducing a strong Treg response, which could in turn, blunt a strong response to vaccines [17]. Equally, some studies have suggested an effect of IP on antibody responses to P. falciparum gametocyte antigens that may have consequences on transmission-blocking immunity [18].

Effective elimination and future eradication of malaria will require not only vector control, but also managing asymptomatic malaria patients and developing an effective vaccine. Given the high burden and concomitant nature of both malaria and intestinal parasites in the same geographical setting, it has been suggested that polyparasitism might interfere with the efficacy of future malaria vaccines [19]. To our knowledge, since limited information is available on whether and how co-infections of intestinal parasites and malaria affect the specific immune response to malaria antigens [20], the goal of this study was to investigate the prevalence and relationship between co-infections of malaria (MAL+) and intestinal parasites (IP+) (infections with protozoans and/or helminths) on naturally acquired antibodies to malaria merozoite, as they are one of the main target sites for most vaccine candidates under clinical trials.

Methods

Ethical consideration

Ethical clearance used for the study was obtained from the Cameroon National Ethics Committee (IRB approval: N^o2016/12/845/CE/CNERSH/SP). Administrative authorizations were obtained from authorities of the Ngali II and Mfou health districts (023/UYI/BTC/2016).

Participation in the study was voluntary with a written (English and French) informed consents obtained from parents of all participants after a clear explanation. A clinical examination was performed for all eligible participants by a medical doctor.

All participants positive for any Plasmodium spp by RDT at the time of blood collection and those who were found to have PI by stool analysis were treated for free following the protocol recommended by the Cameroonian Ministry of Health by the medical doctor. All children with mild anaemia were given an iron supplement free of charge.

Study area description

The study was conducted in Ngali II and Mfou, two villages in the central region of Cameroon (located at 4°27′N and 11°38′E) with a total population of about 1,000 children per squared Km (about 4000 in Ngali II and 6000 in Mfou) under the age of 15 years. The climate is typically equatorial with two discontinuous dry and rainy seasons. The annual average rainfall measures about 1600 mm³ with an annual average temperature of 23°C [21].

Most children in Ngali II and Mfou over 3 years of age accompany their parents to the farm and return home late at night. The use of mosquito bed nets is rare in the two villages and residents have minimal access to portable water with approximately one well per 500 inhabitants. Currently, mass drug administration with albendazole is being performed twice a year by the Ministry of Health, that is usually conduced in schools and symptomatic cases are sent to the local clinic or hospital for follow up treatment.

Study population

A cross sectional study was carried out in Ngali II and Mfou from January to May 2017, a transitional period from the dry to wet season. Children who had lived in either of the villages for at least six months and whose parents gave informed consent were included in the study. All participants were systematically examined by a physician for clinical systems of malaria and IP. Children who presented with symptoms of malaria, e.g., fever, headaches or intestinal illnesses, e.g., diarrhea, vomiting were not enrolled. A total of 320 participants (140 from Ngali II and 180 from Mfou) aged 1–15 years participated in the study. Since both villages have the same demographic features, data for the two villages were combined.

Blood collection and on-site testing for malaria

Venous peripheral blood (about 4mL) was collected by venipuncture using a butterfly needle (G22) and a 5mL labeled EDTA tube from all 320 participants. Haemoglobin (Hb) was measured using the HemoCue (AB Leo Diagnostics, Helsingborg, Sweden). On site, after collecting the venous blood from the participants, a drop from the same collected blood was placed on a CareStart^TM Malaria pLDH/HRP-2 Combo Test (Access Bio Inc. USA) to detect histidine-rich protein-2 (HRP-2) specific to Plasmodium falciparum and Plasmodium lactate dehydrogenase (pLDH) pan-specific to Plasmodium spp. (P. falciparum, P. vivax, P. malariae, P. ovale). Results were read according to manufacturer instructions and recorded after 5 minutes.

Laboratory detection of malaria parasites

Ten microliters of whole blood were used to prepare thick and thin smears for malaria parasite identification, speciation and quantification. The slides were air-dried overnight, and the thin blood smears were fixed in absolute (100%) methanol. Both thick and thin smears were stained using 10% Giemsa solution, washed with water and air-dried. Slides were then microscopically examined (thin and thick smear) for the presence of malaria parasites by two experienced microscopists. The parasite density was determined by counting the number of parasites against 200 leucocytes. The counts were expressed as the number of P. falciparum-infected erythrocytes (IE) per microliter of blood (Pf IE/μl), assuming an average leukocyte count of 8,000 cells/μl of blood [22]. When the difference in parasitaemia between the two readers was greater than 5 Pf IE/μl of blood, a third reader re-examined the slide and the mean of the two closest values were considered. Also, a differential count for eosinophil, lymphocytes, monocytes, neutrophils was obtained alongside parasitaemia and different malaria species (by microscopy)

Antibody analysis

The antigens (Ags)

The recombinant Ags used included MSP1₄₂ of the FVO and 3D7 strains expressed in Escherichia coli and coupled at 0.2 μg per million beads, recombinant EBA-175 RII expressed in yeast coupled at 2.5 μg per million beads, recombinant MSP-3 C-terminal region expressed in E. coli coupled at 5 μg per million beads and recombinant MSP-2 (FC27 strain) coupled at 1 μg per million beads [23].

The multiplex immunoassay

Plasma samples were tested for antibodies to the merozoite antigens using a multi-analyte platform assay with antigen-coupled to magnetic beads with different spectral addresses. Details of this assay used has been described previously [23] and optimized [24,25] In brief, plasma samples were diluted 1:100 with PBS, 50μl of plasma was incubated with 50μl antigen-coupled microspheres (2000 microspheres/test) for 60 minutes in the dark, washed with PBS, and then incubated at 500rpm for 60minutes at 25°C on a rotating shaker and using a magnet plate separator. Then, 100 μl of secondary Ab (R-phycoerythrin-conjugated, Affini Pure F(ab′)₂ fragment, Goat anti-human IgG Fc fragment specific, Jackson Immuno-research, West Grove, PA, USA, Cat no. 109-116-170) diluted to 2 μg/mL in PBS-1% BSA was added to each well and incubated as above in the dark for 1 h. The mixture is then washed and a minimum of 100 beads were read in a MAGPIX® reader. A minimum bead count of 100 per spectral address recorded as Median Fluorescence Intensity (MFI).

Controls included on each plate were: PBS to determine background fluorescence, the negative control (NC) consisted of pooled plasma from four malaria-naïve US individuals, and the positive control (PC) was pooled plasma from Cameroonians with high antibody levels to Plasmodium falciparum. Results were exported to Excel for analysis. The cut-off for positivity was calculated as mean of MFI + 3 standard deviation of the negative control as shown in the results sections.

Stool sample collection and analysis

Sterile labelled stool collection vials were given to the parents along with instructions for proper stool collection. All samples were analyzed within 7 hours of collection to avoid missing hookworm eggs and minimize chances of under reporting. Approximately, 4 mg of feces was suspended in 5ml PBS and a drop examine by wet mount. The Kato Katz technique was used for morphological identification of helminths eggs, e.g., A. lumbricoides, T. trichiura, or larval stage of Strongyloides stercoralis [26] while the modified Ritchie’s concentration stool technique was used to identify all protozoans and cestodes [27]. The smears were read at objective 10X for eggs and larvae and objective 40X for cysts and vegetative forms of protozoan. All stool slides were read by 2 technicians and in 2 different laboratories under supervision of a microbiologist and parasitologists.

Data analysis

Data were analyzed using Microsoft Excel 2013, and GraphPad^® prism 8. Standard summary statistics were used to describe the study population and results are presented as proportions. Fischer’s exact test was used to compare antibody levels between the malaria-negative, IP-positive (MAL-,IP+) and malaria-positive, IP-negative (MAL+,IP-) groups, because of the small sample sizes of the groups. The one-way-ANOVA test was used to compare all 4 groups after checking for normality (e.g., age). An unpaired t test was used to compare the means of the MAL-,IP- vs. MAL+,IP- groups. Kruskal-Wallis test was used to compare antibody levels, which are not normally distributed, among the groups or within the MAL+IP+ groups. An individual was considered to have a co-infection if at least one IP species and P. falciparum were present. Anaemia was considered when Hb values were < 11.5 g/dL and classified according to WHO [28,29]. To search DNA sequences of P. falciparum EBA-175 and those of E. histolytica for possible cross-reactive epitopes, PfEBA175 (ncbi.nlm.nih.gov/gene/2654998) was compared with E. histolytica (ncbi.nlm.nih.gov/assembly/GCF_000208925.1) using Megablast for highly similar sequences and discontinuous megablast for more dissimilar sequences.

Results

The study population

A total of 320 children were enrolled (Table 1). Among the children, 76.3% were slide-positive for malaria (MAL+), with 59.4% having malaria without intestinal parasites (MAL+, IP-) and 16.9% being coinfected with malaria and intestinal parasites (MAL+, IP+). All subjects who tested positive for malaria using the rapid diagnostic field test were confirmed positive by microscopy. Among children who were infected with malaria, 71.3% were infected with only P. falciparum and 5% had P. falciparum and P. malariae. Interestingly, only 2.2% of the children had IP without malaria and 21.6% were negative for both malaria and IP.

Table 1. Description of 320 children infected with malaria and intestinal parasites (IP).

	MAL-,IP-	MAL+IP-	MAL-,IP+	Co-infections (MAL+,IP+)	P values
Number (%) of children	69 (21.6)	190 (59.4)	7 (2.2)	54 (16.9)
Mean years of age (range)	6.4 (1–14)	7.9 (1–15)	8.6(4–12)	9.3(4–15)	0.0001^*
Parasitaemia: (median # infected erythrocytes/μl (range)	0	420 (40–96,000)	0	900 (40–30,970	0.1599^**
Measures of anaemia
Hb (g/dL) (mean ±SD)	12.1 ±1.6	11.6 ± 2.2	12.2 ± 1.4	12.4±1.8	0.0658^*
Prevalence of anaemia
# (%) of children with Hb <11.5 g/dL	21 (30.4)	87 (45.8)	2 (28.6)	17 (31.5)	0.0324^***

Open in a new tab

*comparison among the 4 groups (ordinary one-way ANOVA).

** comparison among the 4 groups (Mann-Whitney test).

*** comparison between MAL-,IP- vs. MAL+,IP- (Fisher’s exact test).

The mean age of the children changed with infection status among the 4 groups (p = 0.0001) with the lowest age found in uninfected children (6.4 years) and highest in children with co-infections (9.3 years) (Table 1). Malaria infections were found in all age groups; whereas, none of the children under age 4 years had intestinal parasites. Mean haemoglobin levels were lower in children infected with malaria, but the difference was no significant (p = 0.08; MAL-,IP- vs MAL+,IP-). The prevalence of anaemia was higher in children who were infected with malaria (MAL+,IP-)(p = 0.032), but not those with co-infections (p >0.999) compared to children who were parasite-negative (MAL-,IP-).

Prevalence of intestinal parasites

Overall, 19.1% (61/320) of the children were positive for intestinal parasites, 16.9% of whom were also infected with malaria and 2.2% were IP+ but MAL- (Table 2). The most frequent helminthic parasites detected were A. lumbrioides (2.8%) and single cases of T. trichiura and Strongyloides sp. Among the 320 children, 14.7% had detectable protozoan infections, including 7.8% infected with Giardia lamblia, 5.9% with E. histolytica complex, and 0.9% with Isospora sp. No hookworm infections were detected in this study. Very few children had intestinal cestodes (Table 2). Interestingly, all of the children had single parasite infections, and polyparasitism was not found.

Table 2. Prevalence of intestinal parasites (IP+) in the 320 children, ages 1 to 15 years.

	Number of Children
	MAL-, IP+	MAL+, IP+	Total IP+(% positive)
Intestinal Parasites
Helminths			11 (3.4%)
Ascaris lumbricoides	2	7	9 (2.8%)
Trichuris sp.	0	1	1 (0.44%)
Strongyloides sp	0	1	1 (0.44%)
Protozoans			48 (14.7%)
Giradia lamblia	3	22	25 (7.8%)
Entamoeba histolytica complex	1	18	19 (5.9%)
Isospora sp.	1	3	4 (0.9%)
Cestodes			2 (0.63%)
Hymenolepis nana	0	2	2 (0.63%)
Total IP	7 (2.2%)	54 (16.9%)	61 (19.1%)

Open in a new tab

Influence of age on malaria, intestinal parasites, anaemia and moderate eosinophilia

As expected, children aged 1 through 2 years did not have soil-transmitted IP and had normal eosinophil levels; whereas, 63% of 1-2-year old children were infected with malaria and had the highest prevalence of anaemia (Table 3). In contrast, in children 9–15 years of age ~80% were slide-positive for malarial parasites, 24%-29% had intestinal parasites, and 10–38% had moderate eosinophilia. Thus, as children living in these villages increased with age, they began developing partial immunity to malaria symptoms and anaemia declined; whereas, the prevalence of IP and eosinophilia increased.

Table 3. Influence of age on malaria, intestinal parasites, anaemia and percentage of peripheral eosinophils.

Age (years)	N =	% Mal+	% IP+	^* % with anaemia	^**% with eosinophilia
1–2	27	63.0	0	55.6	0
3–4	47	61.7	6.4	48.9	4.3
5–6	40	62.5	15.0	40.0	7.5
7–8	63	88.9	28.6	36.5	9.5
9–10	55	83.6	21.8	38.2	20.0
11–12	54	79.6	25.9	38.9	22.2
13–15	34	82.4	23.5	26.5	38.3

Open in a new tab

*Anaemia: Children with haemoglobin less than 11.5 g/dL.

**Moderate eosinophilia: ≥1,500 eosinophils/mm³ or ≥18.7% peripheral eosinophils.

A comparison of anaemia and eosinophilia among the 4 groups of children shown in Table 1 was made (S1 Table). Results showed that anaemia was associated with malaria infections and eosinophilia was associated with IP.

Antibody levels to malaria merozoite antigens

With repeated exposure to malaria, Ab prevalence and levels increased with age to the four merozoite antigens (Fig 1). Among 1- to 2-year-olds, only 25% of the infants had Ab to EBA-175 and MSP3, 30% had Ab to MSP2, but 80% had Ab to MSP1 (Fig 1). However, by age 13–15 years, 60% had acquired Ab to MSP3 and >80% had Ab EBA-175, MSP2 and MSP3 (Fig 1A). Among Ab-positive children, Ab levels also increased with age (Fig 1B–1E). Although different amounts of Ab were ultimately obtained to the different antigens, the overall trend was for an increase in median Ab with age. Thus, it was important to take age into consideration when making comparison between children infected with malaria (MAL+,IP-), co-infected with malaria and IP (MAL+,IP+) and those who were not infected (MAL-,IP-) at the time the study was conducted.

Comparison of Ab levels in participants with and without malaria and IP

Since children below 3 years of age were not infected with IP, they were not included in the comparative studies described below. Given that Ab prevalence and levels increased with age, the study population was divided into 2 groups: children aged 3–10 years, a time period when children were becoming infected with IP (Table 3) and those 11–15 years, mainly children who had been infected repeatedly with malaria and may had lived with IP for a period of time. As predicted, Ab levels were slightly higher in MAL+ children due to current boosting compared to MAL-, but the differences were not significant (all p values >0.05) (Fig 2).

Fig 2 — Distribution of Ab levels in MFI among malaria negative (MAL-) and malaria-positive (MAL+) and those co-infected with malaria plus Intestinal (Int.) protozoa (n = 25); malaria plus G. *lamblia* (n = 15); and malaria plus E. *histolytica* (n = 10). The number of datapoints varied because not all participants had Ab to all antigens. Horizontal lines represent medians for the group. MFI = median florescence intensity; MSP = merozoite surface proteins, EBA = erythrocytes binding antigen (EBA).

A comparison between Ab levels in children infected with malaria and co-infected with IP was conducted. Children with helminths and cestodes were not included in the analysis because the sample sizes were too small (n = 11). Regarding age, Ab levels were compared between children aged 3–10 years infected with malaria (n = 112) and co-infected with flagellate and intestinal protozoan (n = 25 children), including G. lamblia (n = 15) and E. histolytica (n = 10 children) (Fig 2). Antibody levels did not differ between malaria-infected children with or without intestinal protozoan for MSP1, MSP2 and MSP3; however, there were significantly higher Ab levels to EBA-175 in children co-infected with malaria and intestinal protozoans (p = 0.018) (Fig 2D). The higher Ab levels were due to E. histolytica infections (p = 0.0026), and not G. lamblia (p = 0.3844). No differences were found between children aged 11 to 15 years for any of the antigens between children with malaria (single infection) and co-infected with any of the IP.

To determine if higher Ab levels in children co-infected with P. falciparum and E. histolytica might be due to cross-reactive epitopes, a BLAST search for sequence homology between EBA-175 and E. histolytica proteins. No similarities were found using Metablast, and only one hit was found using discontinuous metablast which had a span of only 38 nucleotides (~13 amino acids) that had 82% similarity (Sequence ID: DS571535.1 Length: 11868. Range 1: 4999 to 5034. Score:35.6 bits (38), Expect:2.0, Identities:31/38(82%), Gaps:2/38(5%), Strand: Plus/Minus.

Query 2053 AAACAATACCAAGAATATCAAAAAGGAAATAATTACAA 2090 Sbjct 5034 AAAAAATA—AAGAAAATAAAAAAGGAAAAAATAACAA 4999). Thus, there does not appear to be shared epitopes between these two pathogens that would explain the increase in Ab to EBA-175 in children with co-infections.

Discussion

Malaria and polyparasitism (infections with protozoans and/or helminths) are still common conditions throughout Africa [30,31]. In the 1-15-year-old children living in the rural Cameroonian villages surveyed, the prevalence of slide-positive malaria was 76.3% and 19.1% for intestinal parasites, with 16.9% co-infections (Tables 1 and 2). This prevalence of malaria is similar to that found in other highly endemic regions of the country [32], and the prevalence of co-infections was 19.1%, which is similar to a prevalence of 18–27% reported in other regions of Cameroon [33,34]. This high transmission is related to geo-ecological and climatic conditions at the time of the study which was the transition from the dry to wet season, a period that favors vector breeding and distribution [35].

From Table 3, the prevalence of slide-positive malaria ranged from 61% to 90% in different age groups implying that children in these villages were repeatedly exposed to malaria throughout their lives. The prevalence of malaria in 2017 was similar to that recorded previously for Ngali II between 1998–2004, that ranged from 50% to 85% in 5–15 year old children with an estimated entomological inoculation rate of 0.7 infectious bites/per/night (~257 infectious bites annually) [36]. Prior studies have established that repeated exposure induces immunity to malaria, with development of anti-disease immunity followed by anti-parasite immunity [37–40]. As a result, the highest prevalence of 56% anaemia was found in young children [2,41,42] with a decline to 27% in 13 to 15-year-olds (Table 3). On the other hand, infections with IP only occurred later in life from 3 years. Increase in intestinal parasites was associated with an age-related increase in eosinophilia [43,44], a known innate immune response to helminthic and other soil-transmitted organisms (Table 3). In this study, only 11/320 (3.4%) children were infected with helminths. Although some epidemiological studies have demonstrated an increased risk of infection by P. falciparum in individuals co-infected with helminths, other results are conflicting [45,46]. The low prevalence of helminths in this study is explained, in part by, the fact that mass community de-worming is done biannually following the national infectious disease guide-line for IP control program. The most prevalent intestinal parasites were the protozoans, G. lamblia and E. histolytica [47–50]. These protozoa are commonly found in damp soil and contaminated water with a prevalence of 2–20% in Cameroon [51–54]. These results suggest children acquire their intestinal infections after learning to walk and interact with the environment. Thus, children in the study population were exposed to malaria early in life and began developing anti-malaria immunity prior to exposure to intestinal parasites.

Generally, both Ab prevalence and Ab levels increased with age in 1 to 15-year-olds living in this high transmission area (Fig 1). Often, the presence of Ab is used as markers of infection, including the merozoite antigens used in this study. The study compared antibody levels to Plasmodium merozoite antigens (MSP1, MSP2 MSP3, EBA17) between four groups of children, defined according to infection with malaria and/or intestinal parasites (MAL-IP-, MAL+IP-, MAL+IP+, MAL-IP+) [55–57]. Since over 80% of 1-2-year-olds had Ab to MSP1, humoral immunity began to develop early in life and continued to mature as children developed into adolescents (Fig 1). Often individuals who are MAL+ have higher Ab levels than MAL- individuals due to boosting of the Ab response [37,39,40]. In the current study, Ab levels did not differ significantly between MAL+ and MAL- individuals, neither those who were 3–10 years nor 11–15 years-old. This result was not surprising, since 75% of the children were slide-positive for malaria (Table 1). Because of high transmission, children are becoming infected almost on a daily basis and either are in the process of eliminating the new infection or reducing it to submicroscopic levels. Thus, most children living in areas with high perennial transmission will test positive for malaria by PCR. Because of constant re-exposure, the resulting immune response will be similar to that produced by a chronic infection.

This study measured the Ab response to 4 antigens present in P. falciparum merozoites, that play a role in immunity to malaria and are commonly used in studies of this type. Following schizont rupture, the merozoite surface antigens (MSPs) participate in initial attachment of merozoites to erythrocytes; then erythrocyte-binding antigen EBA-175 aids in binding and induces release of proteins localized in the micronemes that participates in junction formation [58]. Thus, the immune system of children living in Etoudi, Cameroon, would be exposed to these antigens simultaneously and repeatedly. Although considered to be vaccine candidates, Ab against these antigens are markers of past or current infection and not necessarily markers of protection. Antibodies against any one of the antigens alone is not an index of immunity to malaria. Thus, even if intestinal parasitic pathogens had down-regulated humoral responses to P. falciparum, reduced Ab levels would not necessarily mean the individual had increased susceptibility to malaria disease. Studying these antigens, however, provided a way to assess the impact of intestinal pathogens on humoral immunity to asexual P. falciparum parasites.

The results obtained in this study are similar to those reported previously in other areas of Cameroon. For example, Ab prevalence to merozoite antigens increase with age in high transmission areas in Cameroon like Etoudi; but the increase is at a different rate for different merozoite antigens [58,59] and varies in regions with different transmission rates. For example, in Buea and Limba, where EIR are >500 IB/P/year, 100% of children aged 5 years had Ab to AMA1, whereas, only 65% had Ab to MSP1 [60,61]. However, by age 15, 100% of children have Ab to 4 merozoite antigens studied. In addition to rate of malaria transmission, several factors influence the rate of Ab responses in children, e.g., the use of malaria intervention strategies. Cameroonian children less than 5years are generally more prone to anaemia and iron deficiencies, that may result in lower Ab levels to merozoite antigens [8]. Clearly, one major limitation of this study was that it was conducted in an area with MDA campaigns conducted bi-annually. Thus, the impact of IP helminthic infections could not be assessed. However, Ab levels and prevalence in Etoudi are similar to those in areas where MDA are given at different times. Thus, the current results reflect the situation in many regions in Cameroon.

Prior studies have demonstrated that malaria-helminths co-infections can down regulate malaria and orient the immune response via the Th2 response hence, making patients less sick [20,37,62,63]; whereas, others have demonstrated on the contrary that IP and malaria infections increase malaria disease [13,57]. Unfortunately, the current study could not resolve the controversy because very few children had helminthic infections, due to frequent treatment with albendazole via the mass drug administration (MDA) program conducted by the Ministry of Health and other random health campaigns. Despite the common practice of MDA in subtropical and tropical countries like Cameroon, complete eradication is usually not attained as other factors such as hygiene and sanitation, behavior of population and awareness are all require in an integrated manner to avert the problem, as these infections may return in as early as within four to six months post MDA [64,65]. Also, adverse events when not well managed may lead to rejection of treatment, thereby creating reservoirs for the parasites to continue to circulate in the community [66].

In our study population, co-infections with malaria and protozoans were relatively common. Ab levels to MSP1, MSP2 and MSP3 were similar in children infected with P. falciparum alone and those with protozoan (Fig 2); however, significantly higher Ab levels to EBA-175 were found in children co-infected with malaria and intestinal protozoan (p = 0.018). The higher Ab levels were due to E. histolytica infections (p = 0.0026), and not G. lamblia (p = 0.384). This result was unexpected. E. histolytica is a gut protozoan that cause both intestinal and extraintestinal infections such as amebic colitis (dysentery) and liver or brain abscess. In severe cases, this protozoan can cause a marked down-regulation of macrophage functions rendering the cells incapable of antigen presentation and unresponsive to cytokine stimulation [67]. This decrease in macrophage function does not explain the increase in Ab to EBA-175. One possible explanation is that since malaria and E. histolytica are both protozoan pathogens, they might share common antigens, that is, EBA-175 could share homology with an E. histolytica antigen. To investigate this possibility, a blast search of the NCIB gene bank was conducted for EBA-175 and the E. histolytica genome. However, this search revealed only a ~13 amino acid sequence with 82% similarity, which seems unlikely to explain the increase in Ab levels of co-infected children. Finally, an alternative explanation could be that this result is a spurious observation by chance. Prior studies on Ab prevalence or levels to MSP1,2,3 in children infected with E. histolytica have not been reported. Clearly the association between malaria and E. histolytica merits further study.

Altogether, this observation needs to be repeated with a larger sample size as E. histolytica boosting of Ab to EBA-175 –co-infection might not only be limited to EBA-175, but other antigens as well. Children in these villages began to acquire an Ab response to the 4 merozoite antigens early in life, prior to infection with IP. There was no evidence that infection with IP influenced Ab levels or negatively-altered the already established Ab response to the 4 merozoite antigens.

Conclusion

The prevalence of malaria was high in children 1–2 years old; whereas, intestinal parasite infections occurred in children over 3 years old. Thus, immunity to P. falciparum began prior to infection with soil-transmitted parasites. No differences were found in antibody prevalence or levels in malaria-infected and co-infected children, except antibody levels to EBA175 were significantly higher in children co-infected with malaria and E. histolytica. This is the first report of an interaction between malaria and E. histolytica and antibodies to EBA-175 and merits further evaluation.

Supporting information

S1 Table. Influence of co-infections on anemia and eosinophilia.

(DOCX)

Click here for additional data file.^{(19.5KB, docx)}

S1 File

(XLS)

Click here for additional data file.^{(185.5KB, xls)}

Acknowledgments

We heartily thank all the participants and their parents who let them participate in the study in Ngali II and Mfou. We equally express our gratitude to the community health workers of these areas for their assistance during sample collection.

Anna Babakhanyan, University of Hawaii, provided the recombinant proteins (beads) used for the assays. The recombinant MSP antigens were contributed by the Malaria Vaccine Development Branch, NIAID, NIH and EBA-175 was provided by W. Bancroft through the PIBP, NIAID, NIH, Contracts Program.

The authors acknowledge the support of the entire staff of the Biotechnology Centre of University of Yaoundé I, Cameroon for their tremendous work in the field during sample collection and sample processing in the lab.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

The Luminex MAGpix was provided by grant P30GM11473, Centers of Biomedical Research Excellence, National Institute of General Medical Sciences, NIH. GFLR provided the funds for the field work and analysis. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.“World-Malaria-Report-2019-briefing-kit-eng.pdf.” https://www.who.int/malaria/publications/world-malaria-report-2019/World-Malaria-Report-2019-briefing-kit-eng.pdf.
2.Chen I. et al. , “‘Asymptomatic’ Malaria: A chronic and debilitating infection that should be treated,” PLOS Med., vol. 13, no. 1, p. e1001942, January 2016, 10.1371/journal.pmed.1001942 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Pampiglione S., Visconti S., and Pezzino G., “[Human intestinal parasites in Subsaharan Africa. II. Sao Tomé and Principe],” Parassitologia, vol. 29, no. 1, pp. 15–25, April 1987. [PubMed] [Google Scholar]
4.Fletcher S. M., Stark D., and Ellis J., “Prevalence of gastrointestinal pathogens in Sub-Saharan Africa: systematic review and meta-analysis,” J. Public Health Afr., vol. 2, no. 2, September 2011, 10.4081/jphia.2011.e30 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Fusi-Ngwa C., Besong E., Pone J. W., and Mbida M., “a cross-sectional study of intestinal parasitic infections in children in ghettoed, diverse and affluent communities in Dschang, West Region, Cameroon,” Open Access Libr. J., vol. 01, p. 1, December 2014, 10.4236/oalib.1101081 [DOI] [Google Scholar]
6.Mwangi T. W., Bethony J. M., and Brooker S., “Malaria and helminth interactions in humans: an epidemiological viewpoint,” Ann. Trop. Med. Parasitol., vol. 100, no. 7, pp. 551–570, October 2006, 10.1179/136485906X118468 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Zeukeng F. et al. , “Co-infections of Malaria and Geohelminthiasis in Two Rural Communities of Nkassomo and Vian in the Mfou Health District, Cameroon,” PLoS Negl. Trop. Dis., vol. 8, no. 10, October 2014, 10.1371/journal.pntd.0003236 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Njunda A. L., Fon S. G., Assob J. C. N., Nsagha D. S., Kwenti T. D. B., and Kwenti T. E., “Coinfection with malaria and intestinal parasites, and its association with anaemia in children in Cameroon,” Infect. Dis. Poverty, vol. 4, October 2015, 10.1186/s40249-015-0078-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Hopkin J., “Immune and genetic aspects of asthma, allergy and parasitic worm infections: evolutionary links,” Parasite Immunol., vol. 31, no. 5, pp. 267–273, 2009, 10.1111/j.1365-3024.2009.01104.x [DOI] [PubMed] [Google Scholar]
10.Nacher M. et al. , “Ascaris lumbricoides infection is associated with protection from cerebral malaria,” Parasite Immunol., vol. 22, no. 3, pp. 107–113, March 2000, 10.1046/j.1365-3024.2000.00284.x [DOI] [PubMed] [Google Scholar]
11.Brutus L., Watier L., Hanitrasoamampionona V., Razanatsoarilala H., and Cot M., “Confirmation of the protective effect of Ascaris lumbricoides on Plasmodium falciparum infection: results of a randomized trial in Madagascar,” Am. J. Trop. Med. Hyg., vol. 77, no. 6, pp. 1091–1095, December 2007. [PubMed] [Google Scholar]
12.M. Nacher, P. Singhasivanon, S. Yimsamran, W. Manibunyong, N. Thanyavanich, P., Wuthisen, et al, “intestinal helminth infections are associated with increased incidence of plasmodium falciparum malaria in thailand.” 10.1645/0022-3395(2002)088[0055:IHIAAW]2.0.CO;2. [DOI] [PubMed] [Google Scholar]
13.Sokhna C. et al. , “Increase of malaria attacks among children presenting concomitant infection by Schistosoma mansoni in Senegal,” Malar. J., vol. 3, p. 43, 2004, 10.1186/1475-2875-3-43 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Lo A. C., Faye B., Gyan B. A., and Amoah L. E., “Plasmodium and intestinal parasite perturbations of the infected host’s inflammatory responses: a systematic review,” Parasit. Vectors, vol. 11, July 2018, 10.1186/s13071-018-2948-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Njua-Yafi C. et al. , “The Effect of Helminth Co-infection on malaria-specific immunoglobulin g responses,” BMJ Glob. Health, vol. 2, no. Suppl 2, pp. A66–A66, February 2017, 10.1136/bmjgh-2016-000260.178 [DOI] [Google Scholar]
16.Nacher M., “Malaria vaccine trials in a wormy world,” Trends Parasitol., vol. 17, no. 12, pp. 563–565, December 2001, 10.1016/s1471-4922(01)02117-1 [DOI] [PubMed] [Google Scholar]
17.Maizels R. M., Pearce E. J., Artis D., Yazdanbakhsh M., and Wynn T. A., “Regulation of pathogenesis and immunity in helminth infections,” J. Exp. Med., vol. 206, no. 10, pp. 2059–2066, September 2009, 10.1084/jem.20091903 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Ateba-Ngoa U. et al. , “Associations between Helminth Infections, Plasmodium falciparum parasite carriage and antibody responses to sexual and asexual stage malarial antigens,” Am. J. Trop. Med. Hyg., vol. 95, no. 2, pp. 394–400, August 2016, 10.4269/ajtmh.15-0703 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Hartgers F. C. and Yazdanbakhsh M., “Co-infection of helminths and malaria: modulation of the immune responses to malaria,” Parasite Immunol., vol. 28, no. 10, pp. 497–506, October 2006, 10.1111/j.1365-3024.2006.00901.x [DOI] [PubMed] [Google Scholar]
20.Sexe1 et al. , “Intestinal parasites coinfection does not alter plasma cytokines profile elicited in acute malaria in subjects from endemic area of brazil,” Mediators Inflamm., vol. 2014, p. e857245, September 2014, 10.1155/2014/857245 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Kuitcha D., Fouepe A., Ndjama J., Takem G., Awah M., and Kamgang V., “Chemical and isotopic signal of precipitation in Yaounde-Cameroon,” Arch Appl. Sci. Res., vol. 4, pp. 2591–2597, October 2012. [Google Scholar]
22.“District Laboratory Practice in Tropical Countries Part 1, Second Edition—monica-cheesbrough-district-laboratory-practice-in-tropical-countries-part-1.pdf.”
23.Fouda G. G. et al. , “Multiplex assay for simultaneous measurement of antibodies to multiple Plasmodium falciparum antigens,” Clin. Vaccine Immunol., vol. 13, no. 12, pp. 1307–1313, December 2006, 10.1128/CVI.00183-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Fodjo B. A. Y. et al. , “Antibody responses to the full-length VAR2CSA and its DBL domains in Cameroonian children and teenagers,” Malar. J., vol. 15, 2016, 10.1186/s12936-016-1585-y [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Babakhanyan A. et al. , “Comparison of the specificity of antibodies to VAR2CSA in Cameroonian multigravidae with and without placental malaria: a retrospective case–control study,” Malar. J., vol. 14, no. 1, p. 480, December 2015, 10.1186/s12936-015-1023-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Lindholz C. G. et al. , “Study of diagnostic accuracy of Helmintex, Kato-Katz, and POC-CCA methods for diagnosing intestinal schistosomiasis in Candeal, a low intensity transmission area in northeastern Brazil,” PLoS Negl. Trop. Dis., vol. 12, no. 3, p. e0006274, March 2018, 10.1371/journal.pntd.0006274 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Yanet F.-S., Fidel Angel N.-F., Guillermo N., and Sergio S.-P., “Comparison of parasitological techniques for the diagnosis of intestinal parasitic infections in patients with presumptive malabsorption,” J. Parasit. Dis. Off. Organ Indian Soc. Parasitol., vol. 41, no. 3, pp. 718–722, September 2017, 10.1007/s12639-016-0876-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.“Haemoglobin WHO.pdf.” Accessed: Aug. 21, 2017. http://www.who.int/vmnis/indicators/haemoglobin.pdf.
29.“Hemoglobin Concentration (Hb): Reference Range, Interpretation, Collection and Panels,” Jun. 2016, Accessed: May 18, 2017.
30.Degarege A., Veledar E., Degarege D., Erko B., Nacher M., and Madhivanan P., “Plasmodium falciparum and soil-transmitted helminth co-infections among children in sub-Saharan Africa: a systematic review and meta-analysis,” Parasit. Vectors, vol. 9, June 2016, 10.1186/s13071-016-1594-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Hürlimann E. et al. , “The epidemiology of polyparasitism and implications for morbidity in two rural communities of Côte d’Ivoire,” Parasit. Vectors, vol. 7, p. 81, February 2014, 10.1186/1756-3305-7-81 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Akinbo F. O., Omoregie R., Mordi R., and Okaka C. E., “prevalence of malaria and anemia among young children in a tertiary hospital in Benin City, Edo State, Nigeria,” Fooyin J. Health Sci., vol. 1, no. 2, pp. 81–84, November 2009, 10.1016/S1877-8607(10)60004-5 [DOI] [Google Scholar]
33.Nkuo-Akenji T. K., Chi P. C., Cho J. F., Ndamukong K. K. J., and Sumbele I., “Malaria and helminth co-infection in children living in a malaria endemic setting of mount Cameroon and predictors of anemia,” J. Parasitol., vol. 92, no. 6, pp. 1191–1195, December 2006, 10.1645/GE-895R.1 [DOI] [PubMed] [Google Scholar]
34.“Malaria, helminths, co-infection and anaemia in a cohort of children from Mutengene, south western Cameroon | https://malariajournal.biomedcentral.com/articles/10.1186/s12936-016-1111-2. [DOI] [PMC free article] [PubMed]
35.Achonduh-Atijegbe O. A. et al. , “Prevalence of malaria, typhoid, toxoplasmosis and rubella among febrile children in Cameroon,” BMC Infect. Dis., vol. 16, no. 1, p. 658, November 2016, 10.1186/s12879-016-1996-y [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Rf L. et al. , “Longitudinal studies of Plasmodium falciparum malaria in pregnant women living in a rural Cameroonian village with high perennial transmission.,” Am. J. Trop. Med. Hyg., vol. 83, no. 5, pp. 996–1004, November 2010, 10.4269/ajtmh.2010.10-0249 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Artavanis-Tsakonas K., Tongren J. E., and Riley E. M., “The war between the malaria parasite and the immune system: immunity, immunoregulation and immunopathology,” Clin. Exp. Immunol., vol. 133, no. 2, pp. 145–152, August 2003, 10.1046/j.1365-2249.2003.02174.x [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Roetynck S., Baratin M., Vivier É., and Ugolini S., “Cellules natural killer et immunité innée contre le paludisme,” médecine/sciences, vol. 22, no. 8–9, pp. 739–744, August 2006, 10.1051/medsci/20062289739 [DOI] [PubMed] [Google Scholar]
39.Griffin J. T., Hollingsworth T. D., Reyburn H., Drakeley C. J., Riley E. M., and Ghani A. C., “Gradual acquisition of immunity to severe malaria with increasing exposure,” Proc. R. Soc. B Biol. Sci., vol. 282, no. 1801, February 2015, 10.1098/rspb.2014.2657 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Bediako Y. et al. , “Repeated clinical malaria episodes are associated with modification of the immune system in children,” BMC Med., vol. 17, March 2019, 10.1186/s12916-019-1292-y [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Haldar K. and Mohandas N., “Malaria, erythrocytic infection, and anemia,” Hematol. Am. Soc. Hematol. Educ. Program, pp. 87–93, 2009, 10.1182/asheducation-2009.1.87 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.“World Malaria Report 2016 (annexes)—WMR-2016-annexes.pdf.” http://www.who.int/malaria/publications/world-malaria-report-2016/WMR-2016-annexes.pdf.
43.Kovalszki A. and Weller P. F., “Eosinophilia,” Prim. Care, vol. 43, no. 4, pp. 607–617, December 2016, 10.1016/j.pop.2016.07.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.O’Connell E. M. and Nutman T. B., “Eosinophilia in Infectious Diseases,” Immunol. Allergy Clin. North Am., vol. 35, no. 3, pp. 493–522, August 2015, 10.1016/j.iac.2015.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Lyke K. E. et al. , “Association of Schistosoma haematobium infection with protection against acute Plasmodium falciparum malaria in malian children,” Am. J. Trop. Med. Hyg., vol. 73, no. 6, pp. 1124–1130, December 2005. [PMC free article] [PubMed] [Google Scholar]
46.Melo G. C. et al. , “Concurrent helminthic infection protects schoolchildren with Plasmodium vivax from anemia,” PLOS ONE, vol. 5, no. 6, p. e11206, June 2010, 10.1371/journal.pone.0011206 [DOI] [PMC free article] [PubMed] [Google Scholar]
47.“Giardia: Overview and Update.” Accessed: May 16, 2017. [Online]. Available: https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/cid/25/3/10.1086/513745/2/25-3-545.pdf.
48.“Giardiasis: Background, Pathophysiology, Etiology,” Dec. 2016, http://emedicine.medscape.com/article/176718-overview.
49.“Entamoeba histolytica—Overview,” Encyclopedia of Life http://eol.org/pages/491174/overview.
50.“Amebiasis: Background, Pathophysiology, Etiology,” Jan. 2017,: http://emedicine.medscape.com/article/212029-overview.
51.Richardson D. J., Callahan K. D., Dondji B., Tsekeng P., and Richardson K. E., “Prevalence of Waterborne Protozoan Parasites in Two Rural Villages in the West Province of Cameroon,” Comp. Parasitol., vol. 78, no. 1, pp. 180–184, January 2011, 10.1654/4461.1 [DOI] [Google Scholar]
52.Mbuh J. V., Ntonifor N. H., and Ojong J., “The epidemiology of soil-transmitted helminth and protozoan infections in South-West Cameroon,” J. Helminthol., vol. 86, no. 1, pp. 30–37, March 2012, 10.1017/S0022149X1000091X [DOI] [PubMed] [Google Scholar]
53.Mbuh J. V., Ntonifor H. N., and Ojong J. T., “The incidence, intensity and host morbidity of human parasitic protozoan infections in gastrointestinal disorder outpatients in Buea Sub Division, Cameroon,” J. Infect. Dev. Ctries., vol. 4, no. 1, pp. 38–43, December 2009, 10.3855/jidc.82 [DOI] [PubMed] [Google Scholar]
54.Kuete T., Yemeli F. L. S., Mvoa E. E., Nkoa T., Somo R. M., and Ekobo A. S., “Prevalence and risk factors of intestinal helminth and protozoa infections in an urban setting of Cameroon: the case of Douala,” Am. J. Epidemiol. Infect. Dis. Am. J. Epidemiol. Infect. Dis., vol. 3, no. 2, pp. 36–44, June 2015, 10.12691/ajeid-3-2-4 [DOI] [Google Scholar]
55.Diallo T. O. et al. , “Schistosomiasis coinfection in children influences acquired immune response against Plasmodium falciparum Malaria antigens,” PLOS ONE, vol. 5, no. 9, p. e12764, September 2010, 10.1371/journal.pone.0012764 [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Courtin D. et al. , “Schistosoma haematobium infection affects Plasmodium falciparum-specific IgG responses associated with protection against malaria,” Parasite Immunol., vol. 33, no. 2, pp. 124–131, February 2011, 10.1111/j.1365-3024.2010.01267.x [DOI] [PubMed] [Google Scholar]
57.Hartgers F. C. et al. , “Responses to Malarial Antigens Are Altered in Helminth‐Infected Children,” J. Infect. Dis., vol. 199, pp. 1528–1535. 10.1086/598687 [DOI] [PubMed] [Google Scholar]
58.Beeson J. G., Drew D. R., Boyle M. J., Feng G., Fowkes F. J. I., and Richards J. S., “Merozoite surface proteins in red blood cell invasion, immunity and vaccines against malaria,” FEMS Microbiol. Rev., vol. 40, no. 3, pp. 343–372, May 2016, 10.1093/femsre/fuw001 [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Kwenti T. E. et al. , “Comparative analysis of IgG and IgG subclasses against Plasmodium falciparum MSP-119 in children from five contrasting bioecological zones of Cameroon,” Malar. J., vol. 18, no. 1, p. 16, January 2019, 10.1186/s12936-019-2654-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Ondigo B. N. et al. , “Impact of Mothers’ Schistosomiasis status during gestation on children’s igg antibody responses to routine vaccines 2 years later and anti-schistosome and anti-malarial responses by neonates in Western Kenya,” Front. Immunol., vol. 9, 2018, 10.3389/fimmu.2018.01402 [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Kwenti T. E., Nkume F. A., Tanjeko A. T., and Kwenti T. D. B., “The Effect of intestinal parasitic infection on the clinical outcome of malaria in coinfected Children in Cameroon,” PLoS Negl. Trop. Dis., vol. 10, no. 4, p. e0004673, avr 2016, 10.1371/journal.pntd.0004673 [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Su Z., Segura M., and Stevenson M. M., “Reduced protective efficacy of a blood-stage malaria vaccine by concurrent nematode infection,” Infect. Immun., vol. 74, no. 4, pp. 2138–2144, April 2006, 10.1128/IAI.74.4.2138-2144.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
63.Lemaitre M., Watier L., Briand V., Garcia A., Hesran J. Y. L., and Cot M., “Coinfection with Plasmodium falciparum and Schistosoma haematobium: additional evidence of the protective effect of schistosomiasis on malaria in Senegalese Children,” Am. J. Trop. Med. Hyg., vol. 90, no. 2, pp. 329–334, February 2014, 10.4269/ajtmh.12-0431 [DOI] [PMC free article] [PubMed] [Google Scholar]
64.Ortu G. et al. , “The impact of an 8-year mass drug administration programme on prevalence, intensity and co-infections of soil-transmitted helminthiases in Burundi,” Parasit. Vectors, vol. 9, no. 1, p. 513, September 2016, 10.1186/s13071-016-1794-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Dunn J. C. et al. , “Soil-transmitted helminth reinfection four and six months after mass drug administration: results from the delta region of Myanmar,” PLoS Negl. Trop. Dis., vol. 13, no. 2, February 2019, 10.1371/journal.pntd.0006591 [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Lorenzo P. J., Manzanilla D. R., Cortel D. K., and Tangog E., “Community perceptions of mass drug administration for soil-transmitted helminthiasis and schistosomiasis in selected schools in the Philippines,” Infect. Dis. Poverty, vol. 8, no. 1, p. 87, October 2019, 10.1186/s40249-019-0595-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
67.“Entamoeba histolytica: Host Defense and Immune Responses,” http://www.eurekaselect.com. http://www.eurekaselect.com/54531/chapter.

PLoS One. doi: 10.1371/journal.pone.0242012.r001

Decision Letter 0

Luzia Helena Carvalho

10 Jun 2020

PONE-D-20-12369

Full-title: Antibody Response to Malaria Merozoite Antigens in Asymptomatic Children Co-infected with Malaria and Intestinal Parasites

PLOS ONE

Dear Dr. Ndiabamoh,

Thank you for submitting your manuscript to PLoS ONE. After careful consideration, we felt that your manuscript requires substantial revision, following which it can possibly be reconsidered, thus governing the decision of a “major revision”. As requested by the reviewers, the authors need to address several concerns, particularly related to the study design, methods and results. A major concern raised by the Reviewers was because parasite detection was not followed by sensitive diagnostic techniques such as PCR-based assays, and submicroscopic infections may have been missed. Finally, the authors should follow the policy of Plos One to share the raw data underlying their results. Such policies help increase the reproducibility of the published literature, as well as make a larger body of data available for reuse and re-analysis. For your guidance, a copy of the reviewers' comments was included below.

Please submit your revised manuscript by July 10. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Luzia Helena Carvalho, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Acknowledgments Section of your manuscript:

"Funding Statement:

The beats used for the experiments were a gift from A. Babakhanyan (University of

Hawaii) and coupled by ELG. The MAGPIX used for the data analysis was MAGPX

I3038703, Luminex corporation 12212 technology Blvd Austin. Texas 78727. GFLR

provided the funds for the field work and analysis"

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

* Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"The author(s) received no specific funding for this work. Funding used in for this research was mentors (Prof Leke Rose) and a Gift of the magnetic beats from Dr Anna Babakhanyan. No other specific funding were received. "

Additionally, because some of your funding information pertains to [commercial funding//patents], we ask you to provide an updated Competing Interests statement, declaring all sources of commercial funding.

In your Competing Interests statement, please confirm that your commercial funding does not alter your adherence to PLOS ONE Editorial policies and criteria by including the following statement: "This does not alter our adherence to PLOS ONE policies on sharing data and materials.” as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests. If this statement is not true and your adherence to PLOS policies on sharing data and materials is altered, please explain how.

* Please include the updated Competing Interests Statement and Funding Statement in your cover letter. We will change the online submission form on your behalf.

Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Dr. Mbe-cho and colleagues sought to determine the prevalence of co-infection of malaria and intestinal parasites and its association with antibody levels to malaria merozoite antigens. The authors report that there was no difference in antibody prevalence or levels in malaria-infected and co-infected children, except antibody levels to EBA-175 were significantly higher in children co-infected with malaria and E. histolytica. Overall, the study is well-designed but these results do not significantly alter or impact our understanding of the association of malaria and helminths on antibody to malaria merozoite antigens.

1. The limitation of the study is that the parasite testing in children was not followed by sensitive diagnostic techniques like PCR, and light infections may have been missed which may have resulted in misclassification of the groups. Light infections may boost the antibody responses while children remain asymptomatic.

2. In this study, only 3.4% children were infected with helminths alone to get any meaningful data for antibody response to malaria in this group.

3. Very few children are positive for E. histolytica.

4. The data on the children's anthropomorphic measurements are not mentioned. Thus, there is not much point describing how they were collected.

5. There is no data on hookworm infection in the results.

6. The number of eggs per gram of stool were estimated for the parasites listed. Did the authors look at the responses in children with high or low intensity of the parasites?

7. Table 2 is not necessary, it can be written as text.

8. Page 21, reference # 54, year of publication is missing.

Please check spelling and typographical errors scattered through the manuscript (page and lines are given from word document):

1. Page 2, line 3, change led to lead in the sentence.

2. Page 2, line 14, correct the spelling of Rietchi concentration method

3. Page 6, line 21: The bracket has to be closed here: (AB Leo Diagnostics, Helsingborg, Sweden.

4. Page 7, line 17 and 18: Correct 50ul to 50µl

5. Page 9 and 10: In the text, the p value for anemia (MAL+,IP-) is p=0.034; p value for the same in Table 1 is p=0.032; it needs to be corrected.

6. Page 10: In Table 1, % sign is missing in column 5 for children with Hb.

7. Page 10, line 3: In the sentence, change major to majority.

8. Page 14, line 27: In the sentence, MSL- should be MAL-

9. Page 17, line 15: change beats to beads

Re-write the following sentences, they are not very clear:

Page 4, line 8:

However, with most children getting infected with several episodes of infections in a short period, this renders them more prone to having clinical symptoms since the immune systems doesn’t fully recover.

Page 4, line 20:

Concomitant infections in humans have suggested that Ascaris lumbricoides infection may protect against cerebral malaria (11,12), while other studies, children infected by S. mansoni were more susceptible to P. falciparum infection and develop acute malaria episodes.

Page 15, line 3:

In essence, the immune response in individuals who are repeatedly infection would be similar to that produce during chronic infections.

Reviewer #2: The answer to the questions is divided into Major comments, Minor comments. Additionally, I wrote minor observations that, I hope, will help this manuscript to improve readability and consistency.

1. Is the manuscript technically sound, and do the data support the conclusions?

2. Has the statistical analysis been performed appropriately and rigorously?

3. Have the authors made all data underlying the findings in their manuscript fully available?

4. Is the manuscript presented in an intelligible fashion and written in standard English?

Major comments:

• Given that there were no differences in the IgG response between age groups, it would be interesting to join these data, evaluate all the coinfected individuals, and then split the data into Giardia, E. hystolitica.

• I strongly suggest dividing the age of individuals in 0-5, 5-10, 10-15 years-old to partially solve the "N" problem of the groups.

• Because of the absence of molecular Diagnosis and considering that the authors mention the possibility of oh having low parasitemia infections in the MAL- group. It is important to include MAL- individuals in Figure 1.

• It is necessary to compare parasite data with similar regions in Cameroon. Please compare and cite:

• (Malaria and Helminth Co-Infection in Children Living in a Malaria Endemic Setting of Mount Cameroon and Predictors of Anemia from Theresa K Nkuo-Akenji et al. 2006)

• Malaria, Helminths, Coinfection and Anaemia in a Cohort of Children From Mutengene, South Western Cameroon from Clarisse Njua-Yafi et al. 2016.

• Do the authors have information about malaria and intestinal parasites last treatments? On page 17, it was commented that Albendazole treatment was frequent in these children. Deworming information will help the readers to understand why the prevalence of intestinal parasites was low compared with other studies in Cameroon. Additionally, reinforce in the discussion section that collecting/reporting that information is valuable for coinfection studies.

• (Figure 1 B, C, D, E) use the same scale limits for all plots. This is also useful to understand differences in levels of antigenicity between proteins.

• (table 3) How could the authors explain increased eosinophilia with low levels of helminth infection? This mainly applies to the age group > 9 years-old.

• (Page 17) The authors argue, "First, children living in moist or wet environments where mosquitoes breed and E. histolytica are more abundant would have a high risk of acquiring both infections, that would result in frequent boosting of the Ab response." This explanation for intestinal parasite influence on antibody production alteration is not viable since Giardia's frequency is higher than E. hystolitica in the studied population.

• (Page 17) The affirmation "Secondly, since malaria and E. histolytica are both amoebae, they might share common antigens, for example, EBA-175 could share homology with an E. histolytica antigen." is false. Plasmodium falciparum is not an is a protozoan. This group belongs to Apicomplexa organisms. For that reason, the hypothesis about correlating Plasmodium and E. hystolitica is wrong.

• How different are the two Villages Ngali II and Mfou in the central region of Cameroon? Does it exist a difference in humidity and soil moist, once the authors claimed that this variable could explain differences of Entamoeba histolytica?

Minor comments:

• What criteria were used to divide the population into seven groups according to age?

• Please specify how anthropometric parameters were used in the study, once they were described but not used in the study. If this information was not used, please remove these sentences.

• Has the studied region presence of Schistosoma haematobium? If the authors have register if this parasite in the area, Did they examined urine samples to discard infections with this parasite?

• Were the individuals asymptomatic to intestinal parasites infection too? No diarrhea, abdominal pain, etc.? Please clarify.

• (Page 6) It was mentioned that Plasmodium parasitemia was quantified. Did the authors observe any correlation between the Plasmodium parasite burden and the levels of IgG responses to the antigens?

• (End of Page 7) Please specify: If the cut-off is MFI+3*SD, how the standard deviation was calculated if the negative controls were pooled? Was this experiment repeated or used replicates? Traditionally, the negative controls are tested simultaneously in different wells of the plate, and the cut-off is calculated from those values.

• Did the authors analyze the effect of helminth parasite burden (number of eggs/gram of stool) in those individuals with helminths? This valuable information was commented on but never included in the analysis. If not used,e I do not see the necessity of describing in the methods section

• For data analysis:

• Before using ANOVA, did the authors checked for the normality of the variables? If yes, please specify, if not, calculate the normality of the variables and the other ANOVA assumptions.

• If the authors have not-normal variables, they should use the Kruskal-Wallis non-parametric, and Dunn posthoc tests to verify differences between groups.

• Please check frequencies described in table 1 (MAL+IP- 58.8%) vs. the values reported in the second line page 9. (59.4%).

• Sum of 58.8%+16.9% = 75.7% not 75.6%.

• In table 1, please add a column with P-values to facilitate the interpretation of the differences between groups. Please report statistics of multiple comparisons between groups too.

• What is the potential hypothesis to explain the increased values of parasitemia in the coinfected group?

• Please comment in the text the presence of multiparasitism in the studied individuals.

• (Page 11 table 3). Please include values of anemia and eosinophilia in individuals coinfected. In the current configuration is constructed is hard to determine the coinfection impact in anemia and eosinophilia values.

• (Page 11). In the sentence, "Thus, as children living in these villages increased with age, they developed partial immunity to malaria and anemia declined; whereas, the prevalence of IP and eosinophilia increased." In this sentence, it is necessary to specify that "protection" is protection against malaria symptoms. The table clearly shows that the frequency of malaria does not decrease with age, only the anemia.

• Please plot Age vs. Antibody levels for each protein to verify the correlation for each protein studied.

• As an exploratory analysis, I suggest joining all data and make a boxplot comparing MFI between MAl-PI-, MAL-PI+, MAL+PI-, and MAL+PI+. Mainly for MSP1, MPS2, and MSP3 group age 3-10 and 11-15 to check.

• The sentence "E. histolytica is a gut amoeba that causes both intestinal and extraintestinal infections such as amebic colitis (dysentery) and liver or brain abscess. The protozoa cause a marked down-regulation of macrophage functions rendering the cells incapable of antigen presentation and unresponsive to cytokine stimulation (57)" does not explain the increase of antibody production in E. histolytica infected group. Why could a diminishing antigen presentation generate higher levels of anti-Plasmodium antigens?

Other observations/questions:

• In the title, add "IgG" to Antibody response.

• Check all scientific names of parasite species for correct formatting in italics. (Example Entamoeba histolytica in the Results section in the abstract)

• Please, mention in the background the region where the study was performed.

• It is necessary to describe and discuss the role of MSP1, MPS2, MSP3, and EBA-175 as markers in serological studies.

• Considering that coinfection prevalence is relatively low, I consider that it is important to discriminate with colors or point shapes the individuals MAL-IP-, MAL+IP-, MAL-IP+, MAL+IP+ in Figure 1 B-C-D-E

• In page 6 subtitle "Laboratory detection, quantification and speciation of malaria parasites.", I will not use speciation here. I suggest "Diagnosis and quantification of Plasmodium sp. parasites.

• (Page 14-15) What type of parasite is "Amoeba"? What is the difference between "Amoeba" and E. hystolitica? Traditionally, E. hystolitica is considered an amoeba too.

• In table 1, to facilitate reading, please remove symbols % and /ul located in cells with data and add to the columns describing the variables.

• For consistency, unify parasitemia vs. parasitaemia, anemia vs. anaemia in the text and plots.

• (Page 10) change "The major of helminth parasites" to "The most frequent helminth species detected."

• (table 2) Check all the total numbers for the "Total IP+" column. For example, for protozoans, the sum is 29+19+4 = 48, and it was reported 47

• (Page 13) In plot titles Change Ab (Antibody) to IgG

• (Figure 1E) Add, Change from EBA to EBA-175.

• Please verify all references formatting (For example, reference 42 is all in capital letters)

Reviewer #3: Review Comments to the Author

Please find attached the manuscript with my comments for the manuscript 'Full-title: Antibody Response to Malaria Merozoite Antigens in Asymptomatic Children Co-infected with Malaria and Intestinal Parasites'

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: annotated review comments.docx

Click here for additional data file.^{(396.2KB, docx)}

PLoS One. 2020 Nov 10;15(11):e0242012. doi: 10.1371/journal.pone.0242012.r002

Author response to Decision Letter 0

23 Jul 2020

Reply: We understand the concern. When the study was conducted (2017) in the rural villages, the prevalence of slide-positive malaria was 75.6%. In a prior study conducted in the village (Leke et al 2010), an equivalent prevalence was found of P. falciparum (50-85%) in children aged 5-15 years over a 5-year period. The estimated entomological inoculation rate (EIR) was 0.7 infectious bites/person/ nightly thought out the year (~257 IB/P/Y). Based on the more recent malaria prevalence, it appears that the current EIR is similar. Thus, children were most likely being bitten approximately every-other night by an infectious mosquito, since bednets were not routinely used. With this high level of transmission, most of the slide-negative children would be PCR-positive for malaria, i.e., have enough immunity to reduce malaria to submicroscopic levels. Unfortunately, in very high transmission areas like the one reported herein, everyone will have some circulating P. falciparum parasites. So, classifying subjects as slide-positive vs slide-negative may not reflect presence/absence of parasites, but provide information on the immune status of the person. In revising the MS, information from the study by Leke et al. was included as well as a discussion of submicroscopic infections in the revised Discussion.

2. In this study, only 3.4% children were infected with helminths alone to get any meaningful data for antibody response to malaria in this group.

Reply: We agree, the sample size of children with helminth infections is too small to provide meaningful information. Accordingly, Ab levels in children with helminth infections were not analyzed. To explain the low prevalence of helminths, information on the Ministry of Heatlth’s policy for biannual treatment of children for worms was provided.

3. Very few children are positive for E. histolytica.

Reply: True, the prevalence of Entamoeba in our study was only 5.9%, which is lower than that reported in studies in these areas of ~23% (T. E. Kwenti et al., 2016). In our study, the prevalence was lower, probably due to rigorous mass drug administration (MDA) programs implemented by the Ministry of Health and other regular or seasonal health campaigns.

4. The data on the children's anthropomorphic measurements are not mentioned. Thus, there is not much point describing how they were collected.

Reply: This section was removed from the Methods section.

5. There is no data on hookworm infection in the results.

Reply: The prevalence of hookworm infections was considered in this study during stool exams and, surprisingly, we did not find hookworms in the samples collected, most likely due to regular deworming and improved hygiene in the area. No invasive methods were used for diagnosis of adult worms. From a paper published by E. Kwenti et al. (2016) the prevalence of hookworm was 7% in south west region Cameroon.

6. The number of eggs per gram of stool were estimated for the parasites listed. Did the authors look at the responses in children with high or low intensity of the parasites?

Reply: In this study, after obtaining the prevalence of parasites and comparing with antibody response, no significant difference was observed between the malaria antibodies levels and parasites eggs counts.

7. Table 2 is not necessary, it can be written as text.

Reply: Thanks for the comment, but we think Table 2 summarizes the data more clearly and allows readers to easily compare results from different groups than presenting them in the text. Table 2 has been revised.

8. Page 21, reference # 54, year of publication is missing.

Reply: Year of publication has been included.

Please check spelling and typographical errors scattered through the manuscript (page and lines are given from word document):

1. Page 2, line 3, change led to lead in the sentence.

Reply: The word “led” has been changed to “lead”.

2. Page 2, line 14, correct the spelling of Rietchi concentration method

Reply: Spelling has been corrected to “Ritchie”

3. Page 6, line 21: The bracket has to be closed here: (AB Leo Diagnostics, Helsingborg, Sweden.

Reply: The bracket has been closed.

4. Page 7, line 17 and 18: Correct 50ul to 50µl

Reply: The change has been made.

5. Page 9 and 10: In the text, the p value for anemia (MAL+,IP-) is p=0.034; p value for the same in Table 1 is p=0.032; it needs to be corrected.

Reply: P value has been corrected to P=0.032 (correct value) in the text.

6. Page 10: In Table 1, % sign is missing in column 5 for children with Hb.

Reply: The % symbol has been included in table 1, column 5.

7. Page 10, line 3: In the sentence, change major to majority.

Reply: The word “major” has been changed to “majority”.

8. Page 14, line 27: In the sentence, MSL- should be MAL-

Reply: In Line 27 of page 14, MSL- has been changed to MAL-

9. Page 17, line 15: change beats to beads

Reply: The spelling of beads has been corrected.

10. Re-write the following sentences, they are not very clear:

Page 4, line 8:

Reply: The sentence has been deleted because the information is not directly relevant to the study.

Page 4, line 20:

Reply: The sentence has been revised to read: “Studies on concomitant infections in humans suggest that A. lumbricoides infection may protect against cerebral malaria (11,12), while other studies suggest that children infected by S. mansoni may be more susceptible to P. falciparum infections and develop acute malaria episodes (13,14).”

Page 15, line 3:

In essence, the immune response in individuals who are repeatedly infection would be similar to that produce during chronic infections.

Reply: To clarify the statement, the text has been revised to read: “Because of high transmission, the children are becoming infected almost daily and are either in the process of eliminating the new infection or reducing it to a submicroscopic level. Because of constant re-exposure, the resulting immune response will be similar to that produced by a chronic infection.

1. Is the manuscript technically sound, and do the data support the conclusions?

2. Has the statistical analysis been performed appropriately and rigorously?

3. Have the authors made all data underlying the findings in their manuscript fully available?

4. Is the manuscript presented in an intelligible fashion and written in standard English?

Major comments:

Reply: We are confused by this comment, because Fig 1 shows an increase in both Ab prevalence (Fig. 1A) and Ab levels (Fig 1 B-E) with age in Ab-positive children (Kruskal-Wallis test p values were p<0.001 MSP2 and p=0.05-0.086 (borderline) for the other antigens).

We believe combining all MAL+,IP+ children into single a group is unwise, since they were infected with a conglomerate of intestinal helminths, cestodes and protozoa (see Table 2). Combining children with such heterogenous infections is unlikely to provide meaningful information.

• I strongly suggest dividing the age of individuals in 0-5, 5-10, 10-15 years-old to partially solve the "N" problem of the groups.

Reply: Thanks for the comment. Initially, children were groups into 5-year categories as suggested by the Reviewer, i.e., 0-5, 5-10, 10-15 years old. However, when the data set showed that children aged 1 to 2 did not have intestinal parasites, the results were grouped into 2-year intervals, that allowed us to more closely define the increase in Ab prevalence (Fig. 1A) and Ab levels (Fig 1 -B,C,D,E) with age. The purpose of Fig 1 was to determine if age was a variable that needed to be taken into consideration during data analysis.

Reply: We are sorry if we didn’t make the point clear. ALL children who were Ab-positive are included in Fig 1, including those who are MAL+ and MAL-. Because malaria transmission is high in the area, all children in the study had been exposed to P. falciparum and many of the MAL- children were Ab-positive.

• It is necessary to compare parasite data with similar regions in Cameroon. Please compare and cite:

• (Malaria and Helminth Co-Infection in Children Living in a Malaria Endemic Setting of Mount Cameroon and Predictors of Anemia from Theresa K Nkuo-Akenji et al. 2006)

• Malaria, Helminths, Coinfection and Anaemia in a Cohort of Children From Mutengene, South Western Cameroon from Clarisse Njua-Yafi et al. 2016.

Reply: We thank the Reviewer for pointing out the omission of key references. Information from these studies have been included in the revised Discussion. The text now reads, “…..to those found in other highly [malaria] endemic regions of the country (32), and the prevalence of co-infections was 19.1%, which is similar to the prevalence of co-infections of 18 – 27% reported in other regions of Cameroon (9,44). The references have been added to the reference section.

Reply: In response to the Reviewer’s suggestion, the following information has been added to the Methods section. “Currently, mass drug administration with albendazole is being performed twice a year by the Ministry of Health, that is usually conduced in schools and symptomatic cases are sent to the local clinic or hospital for follow up treatment.”

• (Figure 1 B, C, D, E) use the same scale limits for all plots. This is also useful to understand differences in levels of antigenicity between proteins.

Reply: We understand the comment, but we do not wish to change the Y-axis on Fig 1, since it is risky to make a direct comparison of Ab levels between antigens in serological assays. A number of variables, including parasite strain, the system to produce recombinant proteins, protein purity, the amount of antigen used, number of exposed epitopes, dilution of plasma, etc., influence the overall results. Even when Luminex beads are covalently-coupled with saturating amounts of antigen, it is questionable if direct comparison of MFI can be made between antigens. Although our assays have been optimized and equivalence amounts of antigen used during bead-coupling, comparisons among the antigens may not provide accurate information about immunogenicity. In Figs1 B, C, D, E, the Y-Axis was selected to show the best distribution of the MFI results.

• (table 3) How could the authors explain increased eosinophilia with low levels of helminth infection? This mainly applies to the age group > 9 years-old.

Reply: After age 2, children start becoming infected with helminths, resulting in an increase in eosinophil counts. During the biannual drug treatment campaign, helminthic infections are eliminated, but eosinophilia persists for a period of time. With increasing age, more children in the area become i) infected and ii) re-infected, resulting in an increase in prevalence of eosinophilia.

Reply: The sentence has been deleted from the Discussion.

Sorry, “amoebae” was a typo. Both Plasmodium falciparum and E. histolytica are protozoans. The Discussion has been revised to read “parasitic protozoa.”

Reply: The two villages are very similar with no major differences in humidity or soil moisture. The estimated annual average rainfall measures 1600 mm3 with an annual average temperature of 23°C for Ngali II and for Mfou. According to the National Meteorology agency, the average humidity for the center regions is 83%. Ngali and Mfou are both in the center region of Cameroon about 60km apart. Note: as mentioned above, the words “humidity and soil moisture” have been deleted from the MS.

Minor comments:

• What criteria were used to divide the population into seven groups according to age?

Reply: The fact that Intestinal parasite (IP) infections was only observed in children >2 years, helped guide separation of the children into seven groups.

• Please specify how anthropometric parameters were used in the study, once they were described but not used in the study. If this information was not used, please remove these sentences.

Reply: The sentence has been removed.

• Has the studied region presence of Schistosoma haematobium? If the authors have register if this parasite in the area, Did they examined urine samples to discard infections with this parasite?

Reply: Detection of S. haematobium was not included in the study design because of low prevalence in the study area. A study conducted in this area (and other regions of Cameroon) by Louis-Albert Tchuem Tchuenté et al., (2012) reported a prevalence of S. haematobium of only 1.72%. Since a large sample size would be required to assess the impact of this pathogen on the Ab response to malaria, S. haematobium was not included in the study.

• Were the individuals asymptomatic to intestinal parasites infection too? No diarrhea, abdominal pain, etc.? Please clarify.

Reply: Yes. To make the point clear, the Methods section has been revised and states that all children with clinical cases of malaria or intestinal parasites were not included in the study and referred to the local clinic/hospital by the attending physician for treatment. Thank you for the comment.

Reply: As expected, there was no correlation between parasitemia and malaria antibody levels.

Reply: Pooled negative control plasma sample were run in triplicates on the same plates as the test samples in all experiments, as well as the positive controls. The cut-off was obtained by calculating MFI+3 SD of the triplicates on all plates in the experiment.

Reply: The information has been deleted from the Methods section.

• For data analysis:

• Before using ANOVA, did the authors checked for the normality of the variables? If yes, please specify, if not, calculate the normality of the variables and the other ANOVA assumptions.

Reply: Yes, ANOVA was used to compare difference in age across the 4 groups (Table 2). However, comparisons of Ab MFI, which are not normally distributed, with age (Fig. 1) were performed using the Kruskal-Wallis test. The Methods section (Data analysis) has been revised. Information in Fig. 1 legend was correct.

• If the authors have not-normal variables, they should use the Kruskal-Wallis non-parametric, and Dunn posthoc tests to verify differences between groups.

Reply: Sorry for the mistake in the Methods section. The Kruskal-Wallis nonparametric test was performed in Fig 1 and 2. A posthoc test was not performed, as the goal was not to determine when peak Ab levels were obtained, but to determine if age had an influence on Ab levels. Since age was a variable, data for all age groups could not be combined, but rather age was taken into consideration during data analysis.

• Please check frequencies described in table 1 (MAL+IP- 58.8%) vs. the values reported in the second line page 9. (59.4%).

Reply: 59.4% is the correct value. The text has been revised.

• Sum of 58.8%+16.9% = 75.7% not 75.6%.

Reply: Thank you for catching the error. The values in Table 1 and text have been revised and are now consistent.

• In table 1, please add a column with P-values to facilitate the interpretation of the differences between groups. Please report statistics of multiple comparisons between groups too.

Reply: The comparisons requested by the reviewer were originally provided in the Table legend. To comply with the request, the p values have been moved to a column labeled “p values” and the method of analysis was retained in the Table legend.

• What is the potential hypothesis to explain the increased values of parasitemia in the coinfected group?

Reply: There is no significant difference in parasitemia between the two groups (p=0.1599). In fact, the higher parasitemia was found in young children who were intestinal parasite-negative (probably because very young children were in this group).

• Please comment in the text the presence of multi-parasitism in the studied individuals.

Reply: We thank the reviewer for the comment. The following sentence has been added to the Results section. “Interestingly, all of the children had single parasite infections, and polyparasitism was not found.”

Reply: Table 3 was designed to evaluate the influence of age on malaria, IP, anemia and eosinophilia. The number of co-infections are too small to be divided by age. In an attempt to address the Reviewer’s comment, a separate Table was designed that compares the influence of no infections, malaria-positive only, and co-infections on percent with anemia and eosinophilia. The Table will be up-loaded as supplemental Table 1. It essentially showed that same results as expected, anemia was associated with malaria and eosinophils were associated with co-infections.

Reply: The sentence has been revised to read: “Thus, as children living in these villages increased with age, they began developing partial immunity to malaria symptoms and anemia declined; whereas, the prevalence of IP and eosinophilia increased.

• Please plot Age vs. Antibody levels for each protein to verify the correlation for each protein studied.

Reply: The figure on the right confirms that Ab levels increase with age. The figure shows a linear regression analysis of Ab levels for MSP1, MSP2, MSP3 and EBA-175 using data from all 320 children, and includes the equation for the regression line, the R2 value (all positive), and p value (all significant). Thus, the figure confirms that Ab levels increase with age. We do NOT wish to include this figure in the MS since it is essentially identical to the one shown in Fig 1 B, C, D and E. In fact, we feel that the information in Fig 1B-E is easier for the reader to understand.

Note: If the figure is not shown, it is provided in a separate document.

Reply: We thank the Reviewer Thanks for the suggestion concerning exploratory analysis. A comparison of Ab levels in two of the above groups (MAL-,IP-, and MAL+,IP-) is shown in Fig 2. Unfortunately, the number of children in the MAL-,PI+ group is too small to provide valuable information. As stated above, children in the MAL-,PI+ group (n=54) are infected with a variety of intestinal helminths, cestodes and protozoa (see Table 2). With such a diverse range of pathogens, plotting the data as a boxplot will not provide useful information. In Fig. 2, the distribution of Ab levels in children co-infected with malaria and single intestinal pathogens is provided. We feel this approach is more informative than “dumping all pathogens together.”

Reply: Very true! Not sure why that statement wasn’t caught. The Discussion has been changed significantly. It now reads, “The decrease in macrophage function does not explain the increase in Ab to EBA-175. One possible explanation is that since malaria and E. histolytica…”

Other observations/questions:

• In the title, add "IgG" to Antibody response. Reply: IgG has been added to title (although not all of the co-authors agree this is necessary).

• Check all scientific names of parasite species for correct formatting in italics. (Example Entamoeba histolytica in the Results section in the abstract)

Reply: The scientific name has been checked and are now in italics.

• Please, mention in the background the region where the study was performed.

Reply: This information was included in the background section of the Abstract. It is also included in the Materials section.

• It is necessary to describe and discuss the role of MSP1, MPS2, MSP3, and EBA-175 as markers in serological studies.

Reply: This information has been added to the Discussion.

Reply: We thank the Reviewer for the suggestion. However, information in Fig 1B-E is designed to address the question, are Ab prevalence and levels influence by age? Whereas, Fig 2 provides comparisons between individuals infected with malaria alone or co-infected with specific intestinal parasites. Thus, colored dots or symbols are not needed in Fig 1 (and could be confusing to the reader).

Reply: The header has been changed to read: “Laboratory detection of malaria parasites.”

• (Page 14-15) What type of parasite is "Amoeba"? What is the difference between "Amoeba" and E. histolytica? Traditionally, E. histolytica is considered an amoeba too.

Reply: The figure has been revised to read Intestinal Protozoa. Thanks for pointing out the mis-classification.

• In table 1, to facilitate reading, please remove symbols % and /ul located in cells with data and add to the columns describing the variables.

Reply: The symbols in the data cells have been removed.

• For consistency, unify parasitemia vs. parasitemia, anemia vs. anemia in the text and plots.

Reply: The British spelling of parasitaemia, anaemia, and haemoglobin have been used through out the MS.

• (Page 10) change "The major of helminth parasites" to "The most frequent helminth species detected."

Reply: The change was made as suggested.

• (Table 2) Check all the total numbers for the "Total IP+" column. For example, for protozoans, the sum is 29+19+4 = 48, and it was reported 47

Reply: This has been verified and corrected to 48 in Table 2

• (Page 13) In plot titles Change Ab (Antibody) to IgG

Reply: We thank the Reviewer for the comment, but decide not to make the change. Our rationale is that by definition, IgG is a class of immunoglobulin found in the blood; whereas, Ab are plasma proteins that bind specifically with an antigen. What was measured was IgG Ab. Since the serological assay measured IgG Ab that were recorded as MFI (median fluorescence intensity), we think the labels on the Y-Axis (Ab levels -MFI) reflect what was done. The Methods section makes it clear that the Ab were of the IgG class. [Note: Serum IgG levels (which implies mg/ml) were not measured.]

• (Figure 1E) Add, Change from EBA to EBA-175.

Reply: Change has been made.

• Please verify all references formatting (For example, reference 42 is all in capital letters)

Reply: References have been edited as requested by the reviewer.

Review #3: Comments were in the attachment.

Reply: In revising the MS, all requested changes were made and additional information provided in the text, including information on the BLAST search. The only request we would not fully address is the prevalence of bednet use in the villages. The only information available is that very few children use bednets. Since the slide-positivity rate of 75.6% for P. falciparum, it is unlikely the bednets are having a major influence on the current study. The following information has been added to the MS in the Results section. “To determine if higher Ab levels in children co-infected with P. falciparum and E. histolytica might be due to cross-reactive epitopes, a BLAST search for sequence homology between EBA-175 and E. histolytica proteins was made. No similarities were found using Metablast, and only one hit was found using discontinuous metablast which had a span of only 38 nucleotides (~12 amino acids). Thus, there does not appear to be shared epitopes between these two pathogens that would explain the increase in Ab to EBA-175 in children with co-infections.”

Figure for Reviewer #2 confirming an increase in antibody levels with age.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(449.8KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0242012.r003

Decision Letter 1

Luzia Helena Carvalho

13 Aug 2020

PONE-D-20-12369R1

Full-title: The immunoglobulin G antibody response to malaria merozoite antigens in asymptomatic children co-infected with malaria and intestinal parasites

PLOS ONE

Dear Dr. Ndiabamoh

Thank you for submitting your manuscript to PLoS ONE. After careful consideration, we felt that your study has the potential to be published if it is revised to address specific topics raised by the reviewers. A major concern was because the authors revised the MS just by deleting part of the text, without rewriting or providing additional analysis as requested. Also, it is essential to clarify in the abstract that population received mass drug administration, which may explain the lower prevalence of helminths/ protozoans. For your guidance, a copy of the reviewers' comments was included below.

Please submit your revised manuscript by September 10. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Luzia Helena Carvalho, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Partly

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

**********

6. Review Comments to the Author

Reviewer #1: The authors have addressed all the comments.

There are some minor corrections:

Line 36: Please correct the number of children, 244/230 to 244/320

Line 61: Please correct the species, Trichuria trichuria, to Trichuris trichiura

Please use the reference style outlined by the International Committee of Medical Journal Editors (ICMJE)

Reviewer #2: Comments:

1. Check carefully all the italics for species names

2. Is it necessary the sentence in the line 342 in italics?

3. As I previously commented, the discussion about MSP1, MSP2, and MPS3 role as maskers is absent. Please discuss and compare findings with other studies using the same proteins.

4. Please mention in results that hookworms were not detected in the study

5. Please mention in results that no significant difference was observed between the malaria antibodies levels and parasites eggs counts.

6. Although the authors specify two references describing the bead assay, I still believe it is important to report each antigen's concentration in the bead assay. Once the authors explained that these concentrations are not comparable. Additionally, in the references given (old 23 and 24), there is no information about how EBA175 was produced.

7. Please add references showing that eosinophilia is maintained in individuals that had intestinal infections during a longer time even after MDA.

8. The author explains that "The fact that Intestinal parasite (IP) infections was only observed in children >2 years, helped guide separation of the children into seven groups." But that is not e real explanation; please explain what the rationale for that separation is? Why not use 3-4-5-6 groups?

9. Please comment in the abstract that the population received mass drug administration. I consider that that is a crucial point of the investigation and explains the lower prevalence of helminths and protozoans.

10. I think it would be necessary for the manuscript to verify the existence of other articles reporting intestinal parasites in populations under MDA treatment and add that to the discussion.

�

Reviewer #3: Please see comments in the attached file

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Attachment

Submitted filename: PONE-D-20-12369_R1_reviewer2.pdf

Click here for additional data file.^{(3.1MB, pdf)}

Attachment

Submitted filename: PONE-D-20-12369_R1_reviewer3 comments.pdf

Click here for additional data file.^{(3.1MB, pdf)}

PLoS One. 2020 Nov 10;15(11):e0242012. doi: 10.1371/journal.pone.0242012.r004

Author response to Decision Letter 1

17 Sep 2020

Response to reviewers comments

Review Comments to the Author

Reviewer #1: The authors have addressed all the comments.

There are some minor corrections:

Line 36: Please correct the number of children, 244/230 to 244/320

Reply: This correction has been made

Line 61: Please correct the species, Trichuria trichuria, to Trichuris trichiura

Reply: Trichuria trichuria has been corrected to Trichuris trichiura

Please use the reference style outlined by the International Committee of Medical Journal Editors (ICMJE)

Reply: The referencing has been changed to one of ICMJE editors’ style (U.S. National Library of Medicine style) and edited.

Reviewer #2: Comments:

1. Check carefully all the italics for species names

Reply: We thank the reviewer for this comment, and this has been checked and edited throughout the document.

2. Is it necessary the sentence in the line 342 in italics?

Reply: We thank the reviewer for this comment. This statement was highlighted to emphasize the statement. The italic has been removed.

3. As I previously commented, the discussion about MSP1, MSP2, and MSP3 role as maskers is absent. Please discuss and compare findings with other studies using the same proteins.

Reply: Please forgive us for not making the change previously, but we are having difficulty understanding the comment in the context of the current study. Clearly, MSP1, MSP2, and MSP3 are considered as vaccine candidates, but, like all antibodies, Ab to MSP1, MSP2 and MSP3 are simply “markers” of exposure. Over the last 10 years, the presence of Ab to merozoite antigens, not only MSP1, MSP2 and MSP3, are considered to serve as markers for infection with malaria (Patel P et al 2017, Suman et al 2010). Likewise, we are confused about the request to “discuss and compare findings with other studies using the same proteins,” since reference to other studies that directly relate to the current study have been made. Since many studies have documented that Ab prevalence and levels increase with age, it seems unnecessary to provide multiple references to document this point.

In an attempt to respond appropriately to the comments, a paragraph has been added to the Discussion. The paragraph reads: “This study measured the Ab response to 4 antigens present in P. falciparum merozoites. Following schizont rupture, the merozoite surface antigens (MSPs) participate in initial attachment of merozoites to erythrocytes; then erythrocyte-binding antigen EBA-175 aids in binding and induces release of proteins localized in the micronemes that participates in junction formation [Beeson et al. - review]. Thus, the immune system of children living in Etoudi, Cameroon, would be exposed to these antigens simultaneously and repeatedly. Although considered to be vaccine candidates, Ab against these antigens are markers of past or current infection and not necessarily markers of protection [Beeson et al]. Antibodies against any one of the antigens alone is not an index of immunity to malaria. Thus, even if intestinal parasitic pathogens had down-regulated humoral responses to P. falciparum, reduced Ab levels would not necessarily mean the individual had increased susceptibility to malaria disease. Studying these antigens, however, provided a way to assess the impact of intestinal pathogens on humoral immunity to asexual P. falciparum parasites.”

4. Please mention in results that hookworms were not detected in the study

Reply; thank the reviewer for this comment. It has been included accordingly in the text (line 232)

5. Please mention in results that no significant difference was observed between the malaria antibodies levels and parasites eggs counts.

Reply: Sorry, we humbly beg to differ with the Reviewer and have not complied with the suggestion. Since only 9 subjects had Ascaris lumbricoides infections, the sample size is simply too small to determine if an association exists between Ab levels and egg counts. That is, egg counts ranged only from 100 to 320 eggs per gram of stool; whereas, Ab levels (MFI) had a wide range: (median: 25th, 75th percentile: MSP1 - 2088: 696,1367, 7191; MSP2 - 1778:1507,2750; MSP3 - 6778:434,14,323; EBA-175 10,944:1486, 15058 MFI for these 9 individuals). Using a simple linear regression model, none of the p values were significant (p values = 0.19 to 0.80), demonstrating that none of the associations (regression lines) differed significantly from zero. Although, “technically” there was no statistical association between egg counts and Ab levels, we feel that drawing the conclusion that there was no association is invalid and not good science.

Reply: Information on EBA-175, along with the other antigens used, was provided in reference 23 (Fouda et al. 2006). Information on the concentrations and expression systems has been added to the Methods section. “Antigens used included MSP142 of the FVO and 3D7 strains expressed in Escherichia coli and coupled at 0.2 µg per million beads, recombinant EBA-175 RII expressed in yeast coupled at 2.5 µg per million beads, recombinant MSP-3 C-terminal region expressed in E. coli coupled at 5 µg per million beads and recombinant MSP-2 (FC27 strain) coupled at 1 µg per million beads. (Fouda et al. 2006, Fodjio et al. 2016).”

7. Please add references showing that eosinophilia is maintained in individuals that had intestinal infections during a longer time even after MDA.

Reply: The only statement in the manuscript concerning eosinophils [line 248] is that … with age … “the prevalence of IP and eosinophilia increased.” The statement simply reports the results. Thus, adding references doesn’t seem appropriate. The length of time eosinophils persist after drug treatment is influenced by many variables, e.g., initial worm burden, number of eosinophils produced by the innate immune response, length of the infection prior to drug treatment, persistence of antigen, frequency of MDA, complete/incomplete cure, etc. In Etoudi, MDA was conducted approximately twice a year. Thus, some individuals became infected between MSD campaigns. Thus, providing references stating how long eosinophilia persists for an extended period after MDA is impossible to provide.

Reply: We did use age groups 3-4, 5-6-year, etc. Since IP were not detected in children 1-2 years of age, it seemed logical to group children into 2-year bins. There was no other rationale. Grouping the children made it easier to graph the results. The same conclusion would be obtained if the children had been separated into larger sized groups or had not been grouped.

Reply: We thank the reviewer for this comment, and it has been included in the second line of the methods section on the abstract.

10. I think it would be necessary for the manuscript to verify the existence of other articles reporting intestinal parasites in populations under MDA treatment and add that to the discussion.

Reply: Mass drug administration (MDA) is a common practice in subtropical and tropical countries like Cameroon. The aim is to eliminate intestinal parasitic infections. However, complete eradication is usually not attained as other factors such as hygiene and sanitation, behavior of population and awareness are all require in an integrated manner to avert the problem as these infections may return after a MDA in as early as within four to six months (J.C. Dunn et al., 2019, G. Ortu et al., 2016). Adverse events when not well handled usually lead to rejection of MDA by certain families, thereby serving as reservoir for the parasites to continue to circulate in the community (P. Laurenzo et al., 2019). This information has been added to the Discussion as suggested. Line 385 to 388

Reviewer #3: Please see comments in the attached file

Reply: We thank the Reviewer for his/her helpful suggestions. Clearly, the reviewer is a highly qualified parasitologist. All requests for changes highlighted in the manuscript have been made, except for one. Reviewer #3 originally requested data from the Blast analysis. We provided the following information in the revised manuscript: “No similarities were found using Metablast and only one hit was found using discontinuous metablast which had a span of only 38 nucleotides (~13 amino acids) that had 82% similarity. Thus, there does not appear to be shared epitopes between these two pathogens that would explain the increase in Ab to EBA-175 in children with co-infections.” Reviewer #3 has again requested “Please show the data.” We are not sure what more “data” we can provide, other than to include the nucleotide sequence. So, the sequence has been added to the Discussion.

PLoS One. doi: 10.1371/journal.pone.0242012.r005

Decision Letter 2

Luzia Helena Carvalho

7 Oct 2020

PONE-D-20-12369R2

Full-title: The immunoglobulin G antibody response to malaria merozoite antigens in asymptomatic children co-infected with malaria and intestinal parasites

PLOS ONE

Dear Dr. Ndiabamoh,

After careful consideration, we have concluded that your manuscript has the potential to be published although some aspects of the manuscript will need to be changed prior to formal acceptance. More specifically, the authors should discuss in much more details the MSP-1/2/3 results comparing with other studies from the same/different areas/individuals. These comments would enrich the manuscript, even considering that the authors could not test the original coinfection effect hypothesis due to the lack of sample size.

Please submit your revised manuscript by October 30. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Luzia Helena Carvalho, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: The authors have addressed all the comments.

There are some minor corrections:

hook worm should be hookworm.

Page 19 line 397; ref 59 has been written three times.

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Attachment

Submitted filename: Final comments Reviewer 2.pdf

Click here for additional data file.^{(49.8KB, pdf)}

PLoS One. 2020 Nov 10;15(11):e0242012. doi: 10.1371/journal.pone.0242012.r006

Author response to Decision Letter 2

23 Oct 2020

Response to the Reviewers

Request: “…, the authors should discuss in much more details the MSP-1/2/3 results comparing with other studies from the same/different areas/individuals. These comments would enrich the manuscript, even considering that the authors could not test the original coinfection effect hypothesis due to the lack of sample size,”

Reply: A paragraph has been inserted into the Discussion that compares the results from this study with those reported previously in Cameroon. Our results are similar to those reported previously; however, a number of variables exist among the studies that make direct comparisons difficult. That is, since different assay techniques (e.g., ELISA vs. multiplex), serum dilutions, and recombinant proteins were used, comparing antibody levels is not possible. Thus, we discuss differences in antibody prevalence in children with age among studies; however, antibody prevalence is influenced by rate of malaria transmission which differed among the studies. The paragraph conclude that many factors influence the antibody response to Plasmodium falciparum, but our results are similar to those reported previously. There are no studies on the influence of E. histolytica on antibody responses to malarial antigens. Thus, we could not include results from additional studies in our Discussion. We sincerely hope the paragraph will “enrich the manuscript.”

In the attachment, Reviewer #2 agreed with many of the changes made during the second revision. The only major comment was that, ”Since the authors could not test the hypothesis about the effect of coinfections in the antibody response due to the low frequency of helminths in the studied population, I was expecting more discussion about the antibody levels against MSP1, MSP2, and MSP3 proteins. I wanted to see other manuscripts studying MSP1, MSP2, and MSP3 because I expected to see if similar levels of antibodies anti MSPs proteins in other populations/age groups, or even see comments about the association with protozoan coinfections. I know that these merozoite proteins are markers of parasite exposure, but at any moment the authors mentioned why those merozoite proteins were chosen over other Pf proteins (sporozoite or even sexual-stage). This type of information is essential, mainly for non-malaria researchers that will read the manuscript.”

Our Reply: The paragraph has been added to the manuscript.

The Reviewer had two additional suggestions for addition to the manuscript.

1. The authors should consider adding “The length of time eosinophils persist after drug treatment is influenced by many variables, e.g., initial worm burden, number of eosinophils produced by the innate immune response, length of the infection prior to drug treatment, persistence of antigen, frequency of MDA, complete/incomplete cure” as a complement to the eosinophils discussion. We did not add the statement since our goal was simply to report the results, not to make a general statement about the persistence or life-span of eosinophils.

2. Our previous reply: Reply: Mass drug administration (MDA) is a common practice in subtropical and tropical countries like Cameroon. The aim is to eliminate intestinal parasitic infections. However, complete eradication is usually not attained as other factors such as hygiene and sanitation, behavior of population and awareness are all require in an integrated manner to avert the problem as these infections may return after a MDA in as early as within four to six months (J.C. Dunn et al., 2019, G. Ortu et al., 2016). Adverse events when not well handled usually lead to rejection of MDA by certain families, thereby serving as reservoir for the parasites to continue to circulate in the community (P. Laurenzo et al., 2019). This information has been added to the Discussion as suggested. Line 385 to 388

The Reviewer: A =/ Thanks for the answer. Could the authors please add that information as an additional comment to the results in the discussion section?

Reply: It has been added.

PLoS One. doi: 10.1371/journal.pone.0242012.r007

Decision Letter 3

Luzia Helena Carvalho

26 Oct 2020

Full-title: The immunoglobulin G antibody response to malaria merozoite antigens in asymptomatic children co-infected with malaria and intestinal parasites

PONE-D-20-12369R3

Dear Dr. crespo'o mbe-cho ndiabamoh,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Luzia Helena Carvalho, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0242012.r008

Acceptance letter

Luzia Helena Carvalho

28 Oct 2020

PONE-D-20-12369R3

The immunoglobulin G antibody response to malaria merozoite antigens in asymptomatic children co-infected with malaria and intestinal parasites

Dear Dr. Ndiabamoh:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Luzia Helena Carvalho

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Influence of co-infections on anemia and eosinophilia.

(DOCX)

Click here for additional data file.^{(19.5KB, docx)}

S1 File

(XLS)

Click here for additional data file.^{(185.5KB, xls)}

Attachment

Submitted filename: annotated review comments.docx

Click here for additional data file.^{(396.2KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(449.8KB, docx)}

Attachment

Submitted filename: PONE-D-20-12369_R1_reviewer2.pdf

Click here for additional data file.^{(3.1MB, pdf)}

Attachment

Submitted filename: PONE-D-20-12369_R1_reviewer3 comments.pdf

Click here for additional data file.^{(3.1MB, pdf)}

Attachment

Submitted filename: Final comments Reviewer 2.pdf

Click here for additional data file.^{(49.8KB, pdf)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0242012.ref001] 1.“World-Malaria-Report-2019-briefing-kit-eng.pdf.” https://www.who.int/malaria/publications/world-malaria-report-2019/World-Malaria-Report-2019-briefing-kit-eng.pdf.

[pone.0242012.ref002] 2.Chen I. et al. , “‘Asymptomatic’ Malaria: A chronic and debilitating infection that should be treated,” PLOS Med., vol. 13, no. 1, p. e1001942, January 2016, 10.1371/journal.pmed.1001942 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref003] 3.Pampiglione S., Visconti S., and Pezzino G., “[Human intestinal parasites in Subsaharan Africa. II. Sao Tomé and Principe],” Parassitologia, vol. 29, no. 1, pp. 15–25, April 1987. [PubMed] [Google Scholar]

[pone.0242012.ref004] 4.Fletcher S. M., Stark D., and Ellis J., “Prevalence of gastrointestinal pathogens in Sub-Saharan Africa: systematic review and meta-analysis,” J. Public Health Afr., vol. 2, no. 2, September 2011, 10.4081/jphia.2011.e30 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref005] 5.Fusi-Ngwa C., Besong E., Pone J. W., and Mbida M., “a cross-sectional study of intestinal parasitic infections in children in ghettoed, diverse and affluent communities in Dschang, West Region, Cameroon,” Open Access Libr. J., vol. 01, p. 1, December 2014, 10.4236/oalib.1101081 [DOI] [Google Scholar]

[pone.0242012.ref006] 6.Mwangi T. W., Bethony J. M., and Brooker S., “Malaria and helminth interactions in humans: an epidemiological viewpoint,” Ann. Trop. Med. Parasitol., vol. 100, no. 7, pp. 551–570, October 2006, 10.1179/136485906X118468 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref007] 7.Zeukeng F. et al. , “Co-infections of Malaria and Geohelminthiasis in Two Rural Communities of Nkassomo and Vian in the Mfou Health District, Cameroon,” PLoS Negl. Trop. Dis., vol. 8, no. 10, October 2014, 10.1371/journal.pntd.0003236 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref008] 8.Njunda A. L., Fon S. G., Assob J. C. N., Nsagha D. S., Kwenti T. D. B., and Kwenti T. E., “Coinfection with malaria and intestinal parasites, and its association with anaemia in children in Cameroon,” Infect. Dis. Poverty, vol. 4, October 2015, 10.1186/s40249-015-0078-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref009] 9.Hopkin J., “Immune and genetic aspects of asthma, allergy and parasitic worm infections: evolutionary links,” Parasite Immunol., vol. 31, no. 5, pp. 267–273, 2009, 10.1111/j.1365-3024.2009.01104.x [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref010] 10.Nacher M. et al. , “Ascaris lumbricoides infection is associated with protection from cerebral malaria,” Parasite Immunol., vol. 22, no. 3, pp. 107–113, March 2000, 10.1046/j.1365-3024.2000.00284.x [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref011] 11.Brutus L., Watier L., Hanitrasoamampionona V., Razanatsoarilala H., and Cot M., “Confirmation of the protective effect of Ascaris lumbricoides on Plasmodium falciparum infection: results of a randomized trial in Madagascar,” Am. J. Trop. Med. Hyg., vol. 77, no. 6, pp. 1091–1095, December 2007. [PubMed] [Google Scholar]

[pone.0242012.ref012] 12.M. Nacher, P. Singhasivanon, S. Yimsamran, W. Manibunyong, N. Thanyavanich, P., Wuthisen, et al, “intestinal helminth infections are associated with increased incidence of plasmodium falciparum malaria in thailand.” 10.1645/0022-3395(2002)088[0055:IHIAAW]2.0.CO;2. [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref013] 13.Sokhna C. et al. , “Increase of malaria attacks among children presenting concomitant infection by Schistosoma mansoni in Senegal,” Malar. J., vol. 3, p. 43, 2004, 10.1186/1475-2875-3-43 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref014] 14.Lo A. C., Faye B., Gyan B. A., and Amoah L. E., “Plasmodium and intestinal parasite perturbations of the infected host’s inflammatory responses: a systematic review,” Parasit. Vectors, vol. 11, July 2018, 10.1186/s13071-018-2948-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref015] 15.Njua-Yafi C. et al. , “The Effect of Helminth Co-infection on malaria-specific immunoglobulin g responses,” BMJ Glob. Health, vol. 2, no. Suppl 2, pp. A66–A66, February 2017, 10.1136/bmjgh-2016-000260.178 [DOI] [Google Scholar]

[pone.0242012.ref016] 16.Nacher M., “Malaria vaccine trials in a wormy world,” Trends Parasitol., vol. 17, no. 12, pp. 563–565, December 2001, 10.1016/s1471-4922(01)02117-1 [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref017] 17.Maizels R. M., Pearce E. J., Artis D., Yazdanbakhsh M., and Wynn T. A., “Regulation of pathogenesis and immunity in helminth infections,” J. Exp. Med., vol. 206, no. 10, pp. 2059–2066, September 2009, 10.1084/jem.20091903 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref018] 18.Ateba-Ngoa U. et al. , “Associations between Helminth Infections, Plasmodium falciparum parasite carriage and antibody responses to sexual and asexual stage malarial antigens,” Am. J. Trop. Med. Hyg., vol. 95, no. 2, pp. 394–400, August 2016, 10.4269/ajtmh.15-0703 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref019] 19.Hartgers F. C. and Yazdanbakhsh M., “Co-infection of helminths and malaria: modulation of the immune responses to malaria,” Parasite Immunol., vol. 28, no. 10, pp. 497–506, October 2006, 10.1111/j.1365-3024.2006.00901.x [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref020] 20.Sexe1 et al. , “Intestinal parasites coinfection does not alter plasma cytokines profile elicited in acute malaria in subjects from endemic area of brazil,” Mediators Inflamm., vol. 2014, p. e857245, September 2014, 10.1155/2014/857245 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref021] 21.Kuitcha D., Fouepe A., Ndjama J., Takem G., Awah M., and Kamgang V., “Chemical and isotopic signal of precipitation in Yaounde-Cameroon,” Arch Appl. Sci. Res., vol. 4, pp. 2591–2597, October 2012. [Google Scholar]

[pone.0242012.ref022] 22.“District Laboratory Practice in Tropical Countries Part 1, Second Edition—monica-cheesbrough-district-laboratory-practice-in-tropical-countries-part-1.pdf.”

[pone.0242012.ref023] 23.Fouda G. G. et al. , “Multiplex assay for simultaneous measurement of antibodies to multiple Plasmodium falciparum antigens,” Clin. Vaccine Immunol., vol. 13, no. 12, pp. 1307–1313, December 2006, 10.1128/CVI.00183-06 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref024] 24.Fodjo B. A. Y. et al. , “Antibody responses to the full-length VAR2CSA and its DBL domains in Cameroonian children and teenagers,” Malar. J., vol. 15, 2016, 10.1186/s12936-016-1585-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref025] 25.Babakhanyan A. et al. , “Comparison of the specificity of antibodies to VAR2CSA in Cameroonian multigravidae with and without placental malaria: a retrospective case–control study,” Malar. J., vol. 14, no. 1, p. 480, December 2015, 10.1186/s12936-015-1023-6 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref026] 26.Lindholz C. G. et al. , “Study of diagnostic accuracy of Helmintex, Kato-Katz, and POC-CCA methods for diagnosing intestinal schistosomiasis in Candeal, a low intensity transmission area in northeastern Brazil,” PLoS Negl. Trop. Dis., vol. 12, no. 3, p. e0006274, March 2018, 10.1371/journal.pntd.0006274 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref027] 27.Yanet F.-S., Fidel Angel N.-F., Guillermo N., and Sergio S.-P., “Comparison of parasitological techniques for the diagnosis of intestinal parasitic infections in patients with presumptive malabsorption,” J. Parasit. Dis. Off. Organ Indian Soc. Parasitol., vol. 41, no. 3, pp. 718–722, September 2017, 10.1007/s12639-016-0876-0 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref028] 28.“Haemoglobin WHO.pdf.” Accessed: Aug. 21, 2017. http://www.who.int/vmnis/indicators/haemoglobin.pdf.

[pone.0242012.ref029] 29.“Hemoglobin Concentration (Hb): Reference Range, Interpretation, Collection and Panels,” Jun. 2016, Accessed: May 18, 2017.

[pone.0242012.ref030] 30.Degarege A., Veledar E., Degarege D., Erko B., Nacher M., and Madhivanan P., “Plasmodium falciparum and soil-transmitted helminth co-infections among children in sub-Saharan Africa: a systematic review and meta-analysis,” Parasit. Vectors, vol. 9, June 2016, 10.1186/s13071-016-1594-2 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref031] 31.Hürlimann E. et al. , “The epidemiology of polyparasitism and implications for morbidity in two rural communities of Côte d’Ivoire,” Parasit. Vectors, vol. 7, p. 81, February 2014, 10.1186/1756-3305-7-81 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref032] 32.Akinbo F. O., Omoregie R., Mordi R., and Okaka C. E., “prevalence of malaria and anemia among young children in a tertiary hospital in Benin City, Edo State, Nigeria,” Fooyin J. Health Sci., vol. 1, no. 2, pp. 81–84, November 2009, 10.1016/S1877-8607(10)60004-5 [DOI] [Google Scholar]

[pone.0242012.ref033] 33.Nkuo-Akenji T. K., Chi P. C., Cho J. F., Ndamukong K. K. J., and Sumbele I., “Malaria and helminth co-infection in children living in a malaria endemic setting of mount Cameroon and predictors of anemia,” J. Parasitol., vol. 92, no. 6, pp. 1191–1195, December 2006, 10.1645/GE-895R.1 [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref034] 34.“Malaria, helminths, co-infection and anaemia in a cohort of children from Mutengene, south western Cameroon | https://malariajournal.biomedcentral.com/articles/10.1186/s12936-016-1111-2. [DOI] [PMC free article] [PubMed]

[pone.0242012.ref035] 35.Achonduh-Atijegbe O. A. et al. , “Prevalence of malaria, typhoid, toxoplasmosis and rubella among febrile children in Cameroon,” BMC Infect. Dis., vol. 16, no. 1, p. 658, November 2016, 10.1186/s12879-016-1996-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref036] 36.Rf L. et al. , “Longitudinal studies of Plasmodium falciparum malaria in pregnant women living in a rural Cameroonian village with high perennial transmission.,” Am. J. Trop. Med. Hyg., vol. 83, no. 5, pp. 996–1004, November 2010, 10.4269/ajtmh.2010.10-0249 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref037] 37.Artavanis-Tsakonas K., Tongren J. E., and Riley E. M., “The war between the malaria parasite and the immune system: immunity, immunoregulation and immunopathology,” Clin. Exp. Immunol., vol. 133, no. 2, pp. 145–152, August 2003, 10.1046/j.1365-2249.2003.02174.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref038] 38.Roetynck S., Baratin M., Vivier É., and Ugolini S., “Cellules natural killer et immunité innée contre le paludisme,” médecine/sciences, vol. 22, no. 8–9, pp. 739–744, August 2006, 10.1051/medsci/20062289739 [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref039] 39.Griffin J. T., Hollingsworth T. D., Reyburn H., Drakeley C. J., Riley E. M., and Ghani A. C., “Gradual acquisition of immunity to severe malaria with increasing exposure,” Proc. R. Soc. B Biol. Sci., vol. 282, no. 1801, February 2015, 10.1098/rspb.2014.2657 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref040] 40.Bediako Y. et al. , “Repeated clinical malaria episodes are associated with modification of the immune system in children,” BMC Med., vol. 17, March 2019, 10.1186/s12916-019-1292-y [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref041] 41.Haldar K. and Mohandas N., “Malaria, erythrocytic infection, and anemia,” Hematol. Am. Soc. Hematol. Educ. Program, pp. 87–93, 2009, 10.1182/asheducation-2009.1.87 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref042] 42.“World Malaria Report 2016 (annexes)—WMR-2016-annexes.pdf.” http://www.who.int/malaria/publications/world-malaria-report-2016/WMR-2016-annexes.pdf.

[pone.0242012.ref043] 43.Kovalszki A. and Weller P. F., “Eosinophilia,” Prim. Care, vol. 43, no. 4, pp. 607–617, December 2016, 10.1016/j.pop.2016.07.010 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref044] 44.O’Connell E. M. and Nutman T. B., “Eosinophilia in Infectious Diseases,” Immunol. Allergy Clin. North Am., vol. 35, no. 3, pp. 493–522, August 2015, 10.1016/j.iac.2015.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref045] 45.Lyke K. E. et al. , “Association of Schistosoma haematobium infection with protection against acute Plasmodium falciparum malaria in malian children,” Am. J. Trop. Med. Hyg., vol. 73, no. 6, pp. 1124–1130, December 2005. [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref046] 46.Melo G. C. et al. , “Concurrent helminthic infection protects schoolchildren with Plasmodium vivax from anemia,” PLOS ONE, vol. 5, no. 6, p. e11206, June 2010, 10.1371/journal.pone.0011206 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref047] 47.“Giardia: Overview and Update.” Accessed: May 16, 2017. [Online]. Available: https://oup.silverchair-cdn.com/oup/backfile/Content_public/Journal/cid/25/3/10.1086/513745/2/25-3-545.pdf.

[pone.0242012.ref048] 48.“Giardiasis: Background, Pathophysiology, Etiology,” Dec. 2016, http://emedicine.medscape.com/article/176718-overview.

[pone.0242012.ref049] 49.“Entamoeba histolytica—Overview,” Encyclopedia of Life http://eol.org/pages/491174/overview.

[pone.0242012.ref050] 50.“Amebiasis: Background, Pathophysiology, Etiology,” Jan. 2017,: http://emedicine.medscape.com/article/212029-overview.

[pone.0242012.ref051] 51.Richardson D. J., Callahan K. D., Dondji B., Tsekeng P., and Richardson K. E., “Prevalence of Waterborne Protozoan Parasites in Two Rural Villages in the West Province of Cameroon,” Comp. Parasitol., vol. 78, no. 1, pp. 180–184, January 2011, 10.1654/4461.1 [DOI] [Google Scholar]

[pone.0242012.ref052] 52.Mbuh J. V., Ntonifor N. H., and Ojong J., “The epidemiology of soil-transmitted helminth and protozoan infections in South-West Cameroon,” J. Helminthol., vol. 86, no. 1, pp. 30–37, March 2012, 10.1017/S0022149X1000091X [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref053] 53.Mbuh J. V., Ntonifor H. N., and Ojong J. T., “The incidence, intensity and host morbidity of human parasitic protozoan infections in gastrointestinal disorder outpatients in Buea Sub Division, Cameroon,” J. Infect. Dev. Ctries., vol. 4, no. 1, pp. 38–43, December 2009, 10.3855/jidc.82 [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref054] 54.Kuete T., Yemeli F. L. S., Mvoa E. E., Nkoa T., Somo R. M., and Ekobo A. S., “Prevalence and risk factors of intestinal helminth and protozoa infections in an urban setting of Cameroon: the case of Douala,” Am. J. Epidemiol. Infect. Dis. Am. J. Epidemiol. Infect. Dis., vol. 3, no. 2, pp. 36–44, June 2015, 10.12691/ajeid-3-2-4 [DOI] [Google Scholar]

[pone.0242012.ref055] 55.Diallo T. O. et al. , “Schistosomiasis coinfection in children influences acquired immune response against Plasmodium falciparum Malaria antigens,” PLOS ONE, vol. 5, no. 9, p. e12764, September 2010, 10.1371/journal.pone.0012764 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref056] 56.Courtin D. et al. , “Schistosoma haematobium infection affects Plasmodium falciparum-specific IgG responses associated with protection against malaria,” Parasite Immunol., vol. 33, no. 2, pp. 124–131, February 2011, 10.1111/j.1365-3024.2010.01267.x [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref057] 57.Hartgers F. C. et al. , “Responses to Malarial Antigens Are Altered in Helminth‐Infected Children,” J. Infect. Dis., vol. 199, pp. 1528–1535. 10.1086/598687 [DOI] [PubMed] [Google Scholar]

[pone.0242012.ref058] 58.Beeson J. G., Drew D. R., Boyle M. J., Feng G., Fowkes F. J. I., and Richards J. S., “Merozoite surface proteins in red blood cell invasion, immunity and vaccines against malaria,” FEMS Microbiol. Rev., vol. 40, no. 3, pp. 343–372, May 2016, 10.1093/femsre/fuw001 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref059] 59.Kwenti T. E. et al. , “Comparative analysis of IgG and IgG subclasses against Plasmodium falciparum MSP-119 in children from five contrasting bioecological zones of Cameroon,” Malar. J., vol. 18, no. 1, p. 16, January 2019, 10.1186/s12936-019-2654-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref060] 60.Ondigo B. N. et al. , “Impact of Mothers’ Schistosomiasis status during gestation on children’s igg antibody responses to routine vaccines 2 years later and anti-schistosome and anti-malarial responses by neonates in Western Kenya,” Front. Immunol., vol. 9, 2018, 10.3389/fimmu.2018.01402 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref061] 61.Kwenti T. E., Nkume F. A., Tanjeko A. T., and Kwenti T. D. B., “The Effect of intestinal parasitic infection on the clinical outcome of malaria in coinfected Children in Cameroon,” PLoS Negl. Trop. Dis., vol. 10, no. 4, p. e0004673, avr 2016, 10.1371/journal.pntd.0004673 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref062] 62.Su Z., Segura M., and Stevenson M. M., “Reduced protective efficacy of a blood-stage malaria vaccine by concurrent nematode infection,” Infect. Immun., vol. 74, no. 4, pp. 2138–2144, April 2006, 10.1128/IAI.74.4.2138-2144.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref063] 63.Lemaitre M., Watier L., Briand V., Garcia A., Hesran J. Y. L., and Cot M., “Coinfection with Plasmodium falciparum and Schistosoma haematobium: additional evidence of the protective effect of schistosomiasis on malaria in Senegalese Children,” Am. J. Trop. Med. Hyg., vol. 90, no. 2, pp. 329–334, February 2014, 10.4269/ajtmh.12-0431 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref064] 64.Ortu G. et al. , “The impact of an 8-year mass drug administration programme on prevalence, intensity and co-infections of soil-transmitted helminthiases in Burundi,” Parasit. Vectors, vol. 9, no. 1, p. 513, September 2016, 10.1186/s13071-016-1794-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref065] 65.Dunn J. C. et al. , “Soil-transmitted helminth reinfection four and six months after mass drug administration: results from the delta region of Myanmar,” PLoS Negl. Trop. Dis., vol. 13, no. 2, February 2019, 10.1371/journal.pntd.0006591 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref066] 66.Lorenzo P. J., Manzanilla D. R., Cortel D. K., and Tangog E., “Community perceptions of mass drug administration for soil-transmitted helminthiasis and schistosomiasis in selected schools in the Philippines,” Infect. Dis. Poverty, vol. 8, no. 1, p. 87, October 2019, 10.1186/s40249-019-0595-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0242012.ref067] 67.“Entamoeba histolytica: Host Defense and Immune Responses,” http://www.eurekaselect.com. http://www.eurekaselect.com/54531/chapter.

PERMALINK

The immunoglobulin G antibody response to malaria merozoite antigens in asymptomatic children co-infected with malaria and intestinal parasites

Crespo’o Mbe-cho Ndiabamoh

Gabriel Loni Ekali

Livo Esemu

Yukie Michelle Lloyd

Jean Claude Djontu

Wilfred Mbacham

Jude Bigoga

Diane Wallace Taylor

Rose Gana Fomban Leke

Roles

Abstract

Background

Methods

Results

Conclusion

Introduction

Methods

Ethical consideration

Study area description

Study population

Blood collection and on-site testing for malaria

Laboratory detection of malaria parasites

Antibody analysis

The antigens (Ags)

The multiplex immunoassay

Stool sample collection and analysis

Data analysis

Results

The study population

Table 1. Description of 320 children infected with malaria and intestinal parasites (IP).

Prevalence of intestinal parasites

Table 2. Prevalence of intestinal parasites (IP+) in the 320 children, ages 1 to 15 years.

Influence of age on malaria, intestinal parasites, anaemia and moderate eosinophilia

Table 3. Influence of age on malaria, intestinal parasites, anaemia and percentage of peripheral eosinophils.

Antibody levels to malaria merozoite antigens

Fig 1. Prevalence and amount of Ab in different age groups.

Comparison of Ab levels in participants with and without malaria and IP

Fig 2. Antibody levels in children ages 3 to 10 for all antibody-positive individuals.

Discussion

Conclusion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Luzia Helena Carvalho

Roles

Author response to Decision Letter 0

Decision Letter 1

Luzia Helena Carvalho

Roles

Author response to Decision Letter 1

Decision Letter 2

Luzia Helena Carvalho

Roles

Author response to Decision Letter 2

Decision Letter 3

Luzia Helena Carvalho

Roles

Acceptance letter

Luzia Helena Carvalho

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases