Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jan 1.
Published in final edited form as: Dev Comp Immunol. 2020 Aug 23;114:103829. doi: 10.1016/j.dci.2020.103829

DIFFERENCES IN INFLAMMATORY RESPONSES OF RAINBOW TROUT INFECTED BY TWO GENOTYPES OF THE MYXOZOAN PARASITE CERATONOVA SHASTA

Laura Taggart-Murphy a,1, Gema Alama-Bermejo a,b, Brian Dolan c, Fumio Takizawa d, Jerri Bartholomew a
PMCID: PMC7655565  NIHMSID: NIHMS1623707  PMID: 32846161

Abstract

Two genotypes of the intestinal parasite Ceratonova shasta infect Oncorhynchus mykiss: genotype 0 results in a chronic infection with low mortality while genotype IIR causes disease with high mortality. We determined parasite load and the relative expression of six immune factors (IgT, IgM, IL-6, IL-8, IL-10, IFNG) in fish infected with either genotype over 29 days post-exposure. In genotype IIR infections the host responded with upregulation of inflammatory and regulatory cytokines. In contrast, genotype 0 infection did not elicit an inflammatory response and expression of IFNG and IL-10 was lower. Antibody expression was upregulated in both infections but appeared to have limited efficacy in the virulent genotype IIR infections. Histologically, in genotype 0 infections the parasite migrated through the tissue layers causing inflammation but minimal damage to the mucosal epithelium, which contrasts with the severe pathology found in genotype IIR infections.

Keywords: salmonid, cytokine, immunoglobulin, fish disease, intestine

1. Introduction

The myxozoan parasite Ceratonova shasta (syn. Ceratomyxa shasta) infects salmon and trout in the Pacific Northwest region of North America, causing high mortality in juvenile salmonids in some rivers (Bartholomew et al., 2004; Fujiwara et al., 2011; Ratliff, 1981; Stocking et al., 2006). The waterborne stage of the parasite attaches to the gills of the fish, invades, and travels through the blood to reach the intestine (Bjork and Bartholomew, 2010). In many cases, inflammation has been observed throughout the intestine, which becomes necrotic and hemorrhagic towards the terminal stage of the disease (Bartholomew et al., 1989). Disease severity is dependent on several factors, including temperature, parasite dose, and fish strain origin. Salmon that are native to rivers where C. shasta is endemic (sympatric strains) have evolved resistance to the parasite, while introduced fish (allopatric strains) are highly susceptible (Atkinson and Bartholomew, 2010b; Bartholomew, 1998; Hurst and Bartholomew, 2012). However, differences in the parasite itself also contribute to differences in disease severity.

The three described genotypes of C. shasta (0, I, and II) can be characterized by the number of tri-nucleotide repeats in the ribosomal internal transcribed spacer (ITS) 1 region of the parasite genome (Atkinson et al., 2018; Atkinson and Bartholomew, 2010a). C. shasta genotypes 0 and I show high fish host-specificity: genotype 0 infects both anadromous (steelhead) and freshwater (rainbow trout) strains of Oncorhynchus mykiss; genotype I infects Chinook salmon (O. tshawytscha) (Atkinson and Bartholomew, 2010b). Genotype II employs a generalist parasite strategy, meaning that it can infect multiple species of salmonids. Results of laboratory and field studies indicate there are at least two biotypes, IIC and IIR, which cause severe infections in coho salmon and rainbow trout respectively (Hurst and Bartholomew, 2012; Stinson et al., 2018). These two biotypes are not distinguishable with the ITS-1 marker, and were only recently identified as separate and independent lineages, using transcriptome-wide genetic distances and phylogenomics (Alama-Bermejo et al. 2020).

Allopatric strains of salmon and trout (susceptible to C. shasta) can be infected at a low parasite dose and their response varies depending on genotype; thus, they are an ideal model to study the immune response to C. shasta. Allopatric strains of Chinook salmon have been used to investigate the role of the adaptive and inflammatory immune response to the host-specific genotype I and the generalist genotype II. Infection by either genotype resulted in upregulation of igm gene expression in the intestine by 14 days post-exposure, but only genotype II, which has lower virulence for Chinook salmon, elicited igt gene expression in the intestine (Hurst et al., 2019). This supported observations by Zhang et al. (2010) that IgT may play a role in reducing mortality. Investigators have also observed differential regulation of cytokine gene expression: il10 (immune regulatory) was upregulated in the intestine of fish infected with genotype I, ifng (involved in TH1 cytotoxic responses) was upregulated in fish with genotype II, and il6 (both inflammatory and regulatory) was upregulated in fish with either genotype at 14 days post-exposure (Hurst et al., 2019). This largely supported findings of an earlier study, where allopatric Chinook salmon exposed to genotype I showed upregulation in expression of il10, ifng, and il6 genes in the intestine 12 days after exposure (Bjork et al., 2014). These findings suggest that upregulation of both inflammatory and regulatory cytokines plays a role in infections caused by C. shasta.

Similarly, allopatric strains of rainbow trout can become infected by two C. shasta genotypes, with even greater differences in virulence than observed in allopatric Chinook salmon infected with genotypes I and II. In these rainbow trout, exposure to genotype 0 results in a chronic infection without causing mortality (Stinson et al., 2018). In contrast, genotype IIR infection results in the classic disease signs associated with C. shasta infection, with up to 100% mortality within 3–6 weeks after infection at a dose as low as one spore per fish (Bjork and Bartholomew, 2009; Hurst and Bartholomew, 2012; Stinson and Bartholomew, 2012). Following field exposure, allopatric rainbow trout with chronic infections (putative genotype 0) had increased levels of IgM+ and IgT+ cells in the intestine and parasite-specific titers of IgM and IgT in the serum and intestine mucus, respectively, at 3 months post-infection (Zhang et al., 2010). These results demonstrate that fish can produce pathogen-specific immunoglobulins in response to C. shasta.

We sought to describe the microscopic anatomy of infection and characterize the specific components of the immune system associated with the asymptomatic infection and low mortality observed in rainbow trout infected with C. shasta genotype 0, compared to the high mortality and acute disease associated with genotype IIR. Consistent with the cytokine expression patterns observed in allopatric Chinook salmon (Bjork et al., 2014; Hurst et al., 2019), we hypothesized that rainbow trout infected with genotype IIR would have increased expression of inflammatory cytokines. In contrast, genotype 0-infected fish would show decreased expression of inflammatory cytokine genes and increased expression of the igt gene, an immunoglobulin found in high levels in the intestine that could protect these fish from C. shasta-induced pathology and mortality.

2. Methods

2.1. C. shasta genotype 0 and IIR infections for transcriptomic analysis

We used intestine cDNA samples from allopatric rainbow trout (O. mykiss, Roaring River Hatchery, Scio, Oregon, USA) exposed to C. shasta genotypes 0 or IIR that were collected in Alama-Bermejo et al. (2019). Briefly, these fish were exposed in a river setting for 3 days, in two locations of the Klamath River (OR): Keno Eddy for genotype 0 (n=60) and Williamson River for genotype IIR (n=64) in May 2016. Parasite dose was quantified with three replicates of 1 L filtered water samples using a C. shasta SSU rDNA-based absolute quantification qPCR assay and genotype was confirmed using a specific assay targeting the ITS1 rDNA region (Hallett & Bartholomew 2006, Hallett et al. 2012, Atkinson et al. 2018). After exposure, fish were returned to the lab and treated prophylactically (Stocking et al. 2006). Fish were held and raised at 18 °C in well water, and monitored daily to report any mortality. Five fish per group were sampled at 1, 7, 15, 22, and 29 days post-exposure (dpe). Half gills arches and an anterior portion of the intestine were frozen at −20 °C for parasite DNA quantification (see 2.2.1). The posterior portion of the intestine was preserved in RNA later (Ambion) at −20 °C. Naïve fish (n=5) were sampled as negative uninfected controls.

Intestine samples in RNA later were extracted using the High Pure RNA tissue kit (Roche), with an on-column DNase step. RNA was quantified with a NanoDrop 1000 spectrophotometer (ThermoFisher Scientific). Confirmation of no gDNA contamination and the integrity of RNA was determined by running 100–200 ng of RNA in a 1% agarose gel and using a -RT control in a subset of samples. cDNA was synthesized using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) and anchored-oligo (dT)18 primers (see Alama-Bermejo et al. 2019 for further details).

2.1.1. Host gene expression in intestine samples

We used primers for host cytokines and immunoglobulins examined in previous studies of C. shasta including IL-8, IFNG, IL-10, and IL-6, IgM (secreted Igh mu), and IgT (secreted Igh tau) (Table 1). To test primers for specificity, PCR was performed on intestine cDNA from a rainbow trout infected with C. shasta genotype IIR and analyzed for the expected product size by gel electrophoresis. Quantitative PCR (qPCR) for host gene expression was performed on a StepOnePlus instrument (ThermoFisher Scientific) under the following conditions: a 10 min hot-start incubation at 95 °C, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. A melt curve analysis was performed after each qPCR run. Each 10 μL qPCR reaction contained 1x Power SYBR™ Green PCR Master Mix (ThermoFisher Scientific), forward and reverse primers for the target (see Table 1 for concentrations), 5 ng cDNA, and molecular grade water (Lonza). All samples (n=5 per each timepoint at 7, 15, 22, and 29 dpe) were analyzed in triplicate. All plates were run with an inter-plate calibrator and a no template control. The dye ROX was used as the passive reference to control for inter-well variation within a sample plate. All primers had an efficiency of 90–110% as calculated by analyzing a dilution series and determining the efficiency of the standard curve using the StepOnePlus software (ThermoFisher Scientific). Relative gene expression was calculated using the comparative Cq (cycle quantification) method, using the average Cq from the control group (untreated samples) and comparing to either the genotype 0-or IIR-exposed groups (treated samples) (Schmittgen and Livak, 2008). Elongation factor-1α (EF-1α) was used as the reference gene (Deloffre et al., 2012).

Table 1.

Primer sequences, concentration, product size, and GenBank accession numbers for genes used in rainbow trout cytokine and immunoglobulin expression analysis.

Target Primer sequence (5’ – 3’) Concentration for each primer (μM) Product size (bp) Accession number Reference
EF-1α (F) CAAGGATATCCGTCGTGGCA 4 327 AF498320 Gorgoglione et al., 2013
(R)ACAGCGAAACGACCAAGAGG
IFNg (F) CAACATAGACAAACTGAAAGTCCA 4 129 GT897806 Bjork et al., 2014
(R)ACATCCAGAACCACACTCATCA
IL-6 (F) CAGTTTGTGGAGGAGTTTCAGA 2 119 NM_001124657 Bjork et al., 2014
(R) TGTTGTAGTTTGAGGTGGAGCA
IL-8 (F) GAGCATCAGAATGTCAGCCAG 4 76 DQ778948 Hurst et al., 2019
(R)CTCTCAGACTCATCCCCTCAG
IL-10 (F) CTACGAGGCTAATGACGAGC 5 96 AB118099 Bjork et al., 2014
(R)GATGCTGTCCATAGCGTGAC
IgM (secreted) (F) GCGCTGTAGATCACATGGAA 3 142 S63348.1 Schouten et al., 2013
(R) GCAAGTCAGGGTCACCGTAT
IgT (secreted) (F) CAGACAACAGCACCTCACCTA 1 114 AY870263.1 Zhang et al., 2010
(R) GAGTCAATAAGAAGACACAACGA

2.2. C. shasta genotype 0 infections for histopathology

To characterize the host inflammatory response to genotype 0 infections, allopatric steelhead (O. mykiss, Alsea River Hatchery, Alsea, Oregon, USA) were exposed over a period of three days to the outflow from Manayunkia sp. mesocosms infected with C. shasta genotype 0 in November 2018. Three x 1 L of water was collected from the exposure tank each day and assayed as previously described to determine parasite density and genotype (Hallett et al., 2012; Hallett and Bartholomew, 2006). Fish were raised at the Aquatic Animal Health Laboratory (Oregon State University, Corvallis, Oregon, USA) in 18 °C specific pathogen-free well water. Following the same sampling regime as the natural exposure, at 1, 7, 15, 22, and 29 dpe, five fish per group were euthanized with an overdose of tricaine methanesulfonate (MS222, Western Chemical, Inc.). Intestine and gill samples were collected for DNA extraction (stored at −20 °C) to determine infection status and parasite load, and for histology (stored in Dietrich’s fixative at room temperature). All fish exposures and sampling were carried out under Animal Care and Use Protocol #4666 (Oregon State University).

2.2.1. Parasite SSU rDNA quantification

Ceratonova shasta small subunit ribosomal DNA gene (SSU rDNA) copy numbers was quantified by qPCR from extracted DNA from intestine and gill samples from genotype 0 (river and mesocosm exposed) and IIR infected rainbow trout as described in Alama-Bermejo et al. (2019). Briefly, DNA was extracted and purified using the DNeasy Blood & Tissue kit (Qiagen) according to the manufacturer’s protocol. DNA concentration was quantified using Quant-iT™ dsDNA Assay Kit (Invitrogen) and a Biotek Synergy HT microplate reader (Biotek) and/or a Nanodrop 1000 spectrophotometer (ThermoFisher Scientific). A DNA quantity value was chosen so that all samples could be quantified (river exposed fish: 134 ng of DNA from gills and 50 ng from intestine per reaction; mesocosm exposed fish: 50 ng each from gills and intestine). C. shasta SSU rDNA TaqMan-probe assay water assay (Hallett & Bartholomew 2006; Hallett et al. 2012) with modified standards and no IPC test was used (Alama-Bermejo et al. 2019). All samples were run in triplicate, with an interplate calibrator and no template control.

2.2.2. Histology

Intestine and gill samples from fish with confirmed genotype 0 mesocosm infections (qPCR) were embedded in paraffin, sectioned at 5 μm and stained with hematoxylin and eosin (H&E) or Giemsa stain using standard histological methods. All staining and sectioning was performed by the Oregon State University Veterinary Diagnostic Laboratory. Slides were imaged with a Leica DMRB microscope.

2.3. Statistical analysis

Statistical tests were performed in GraphPad Prism version 7.03 (GraphPad Software) and SAS version 9.4 (SAS), and all graphs were produced using GraphPad Prism version 7.03. Gene expression outliers were defined as Cq values greater than 1 SD from the mean of each sampling timepoint and were excluded from the analysis (Table 2). Each dataset was checked for normal distribution using a Shapiro-Wilk normality test. For normally-distributed samples, a one-way ANOVA with Tukey’s multiple comparison test was used; datasets not normally-distributed were analyzed by the Kruskal-Wallis test with Dunn’s multiple comparison test. Datasets were tested for differences compared to baseline values using a mixed model analysis with specified post-hoc pairwise contrasts. P-values < 0.05 were considered significant.

Table 2.

Fold change in intestinal expression of immune genes in allopatric strains of rainbow trout exposed to two Ceratonova shasta genotypes.

Genotype 0 Genotype IIR
Days post-exposure Gene Fold change (mean ± SD) N P-value Fold change (mean ± SD) N P-value
7 IFNG 6.7 ±1.2 3 * 43.0 ± 2.3 3 *
IL-6 0.8 ± 0.7 3 6.0 ± 1.7 4
IL-8 0.8 ± 0.2 4 1.9 ± 0.5 3
IL-10 21.9 ± 29.5 3 1171.6 ± 140.3 4 *
IgM 1.0 ± 0.3 3 5.0 ± 1.3 3
IgT 1.4 ± 0.4 3 29.4 ± 9.8 3 *
15 IFNG 11.7 ± 5.5 4 * 213.7 ± 17.5 3 *
IL-6 0.6 ± 0.3 4 979.4 ± 1932.2 4
IL-8 1.0 ± 0.3 3 12.7 ± 1.4 3 *
IL-10 145.9 ±60.2 4 * 229478.8 ± 258985.2 4 *
IgM 0.9 ± 0.6 4 14.6 ± 6.0 3 *
IgT 6.3 ± 6.1 3 240 ± 108.2 3 *
22 IFNG 24.9 ±4.2 3 * 30.4 ± 11.0 4 *
IL-6 0.3 ± 0.1 3 3.0 ± 1.6 4
IL-8 1.1 ± 0.3 3 16.1 ± 10.0 4 *
IL-10 198.1 ± 43.8 3 * 7043.0 ± 5473.7 4 *
IgM 2.8 ± 1.4 3 18.9 ± 8.3 4 *
IgT 7.6 ± 3.0 3 81.5 ±64.4 2 *
29 IFNG 49.4 ± 30.2 3 * 183.3 ± 83.6 4 *
IL-6 0.9 ± 0.7 3 2.8 ± 0.7 4
IL-8 1.3 ± 0.3 4 19.9 ± 9.3 4 *
IL-10 319.1 ± 37.4 3 * 7033.9 ± 482.1 4 *
IgM 11.0 ± 8.5 3 * 52.3 ± 14.6 4 *
IgT 55.7 ± 15.8 4 * 787.5 ± 414.9 4 *
*

P < 0.05, calculated by a mixed model analysis with specified post-hoc pairwise contrasts.

3. Results

3.1. Dynamics of C. shasta genotype 0 and IIR infections

Results of the river exposures, including mortality, and parasite load data are presented in Alama-Bermejo et al. (2019) and are summarized here. For river exposure infections by both genotypes, C. shasta was detected in the intestine by 7 dpe and parasite loads peaked at 22 dpe. Mortality in fish infected with C. shasta genotype IIR first occurred at 19 dpe and all fish succumbed to the disease within 30 d. There was no mortality in fish exposed to genotype 0, and fish sampled at 60 dpe had reduced parasite loads compared to days 15–29. At the peak (22 dpe), parasite gene copy numbers in the posterior intestine were approximately two orders of magnitude higher in fish exposed to genotype IIR (3 × 106) compared to those exposed to genotype 0 (2 × 104).

Similarly, there was no mortality in fish exposed to genotype 0 in the laboratory mesocosm at any point during the experiment. In the gills, the parasite load increased to approximately 50 parasite gene copy numbers at 7 dpe and remained relatively constant at subsequent timepoints, peaking at a mean of 400 parasite copy numbers at 29 dpe (Figure 1A). In the intestine, parasite load increased up to 22 dpe before plateauing (Figure 1B) and was similar to that measured in the field exposure (3 × 104). The average parasite load value for the intestine at 29 dpe was about 100-fold higher compared to an equal quantity of gill tissue at the same timepoint (Table 3).

Figure 1.

Figure 1.

Ceratonova shasta genotype 0 parasite load in (A) gill and (B) intestine tissue from Oncorhynchus mykiss at 1, 7, 15, 22, and 29 days post-exposure (dpe). Letters indicate significant differences (P < 0.05) between timepoints and were calculated by the Kruskal-Wallis test with Dunn’s multiple comparisons test.

Table 3.

Ceratonova shasta quantity in allopatric steelhead tissues for genotype 0 laboratory exposure.

C. shasta SSU copy number (mean ± SD)
Days post-exposure Gill Intestine
1 10.4 ± 6.1 Undetermined
7 54.7 ± 12.0 17.7 ± 9.6
15 49.3 ± 22.5 2824.9 ± 2145.8
22 69.1 ± 52.8 28393.2 ± 9356.3
29 309.4 ± 359.5 26917.6 ± 10552.2
Control Undetermined Undetermined

3.2. Gene expression of immunoglobulins and cytokines in genotypes 0 and IIR infections

All genes analyzed in this study showed higher expression levels in genotype IIR infections than in genotype 0 infections (Table 2). Igm and igt were upregulated in the intestine at all timepoints in genotype IIR infections (Figure 2). Igm expression significantly increased over time in genotype IIR infections and trended towards increasing for genotype 0, with a significant increase at 29 dpe. For igt, both genotype infections showed significantly increasing expression over the days post-exposure, although expression in genotype IIR infections was greater than 10-fold higher.

Figure 2.

Figure 2.

Immunoglobulin expression in intestine tissue from Oncorhynchus mykiss infected with Ceratonova shasta genotypes 0 or IIR at 7, 15, 22, and 29 days post-exposure (dpe). Fold change relative to uninfected control fish, expressed as mean ± SD (n = 2–4 fish/timepoint) and calculated by the comparative Cq method. Letters indicate significant differences (P < 0.05) between timepoints within a genotype and were calculated by a one-way ANOVA with Tukey’s multiple comparisons test (for datasets considered normally-distributed by the Shapiro-Wilk normality test) or the Kruskal-Wallis test with Dunn’s multiple comparisons test (for datasets failing normality test). Asterisks indicate a significant difference between the values compared to the baseline values from uninfected fish, calculated by a mixed model analysis with specified post-hoc pairwise contrasts. Data for IgT expression for genotype 0 is shown at two scales for comparison with expression in genotype IIR.

Pro-inflammatory cytokine genes il6 and il8 were highly upregulated in intestine tissue from fish infected with genotype IIR compared to the uninfected control fish (Figure 3). The highest upregulation was at 15 and 29 dpe for il6 (~900 fold-change) and il8 (~20 fold-change), respectively (Table 2). Conversely, little change in expression at any sampling timepoint was observed for either of these genes in genotype 0-infected fish.

Figure 3.

Figure 3.

Cytokine expression in intestine tissue from Oncorhynchus mykiss infected with Ceratonova shasta genotypes 0 or IIR at 7, 15, 22, and 29 days post-exposure (dpe). Fold change relative to uninfected control fish, expressed as mean ± SD (n = 3–4 fish/timepoint) and calculated by the comparative Cq method. Letters indicate significant differences (P < 0.05) between timepoints within a genotype and were calculated by a one-way ANOVA with Tukey’s multiple comparisons test (for datasets considered normally-distributed by the Sapiro-Wilk normality test) or the Kruskal-Wallis test with Dunn’s multiple comparisons test (for datasets failing normality test). Asterisks indicate a significant difference between the values compared to the baseline values from uninfected fish, calculated by a mixed model analysis with specified post-hoc pairwise contrasts.

Expression of the TH1 cytokine gene ifng was upregulated in both genotype 0-and IIR-infected fish, with gene expression gradually increasing over time (~25-fold) for genotype 0-infected fish (Figure 3). In genotype IIR-infected fish, ifng expression had no clear pattern of expression, but at its peak, expression was >200-fold higher over control fish (Table 2).

Expression of the immune regulatory cytokine gene il10 was upregulated in both genotype infections compared to the uninfected control fish (Figure 3). For genotype 0-infected fish, expression of il10 increased over the sampling period up to ~300-fold (Table 2). In genotype IIR-infected fish, the highest il10 expression (>200,000-fold) was at 15 dpe.

3.3. Microscopic pathology of genotype 0 infections

Allopatric rainbow trout infected with genotype 0 showed mild intestinal inflammation starting at 22 dpe (Figure 4B) and progressing to moderate inflammation at 29 dpe (Figure 4C). Only minimal tissue damage was visible, with immune cells infiltrating and fibrosis present in the lamina propria at 29 dpe (Figure 4D). The mucosal surface remained intact. Parasite stages were visible in the intestinal lumen at 22 dpe (Figure 5A). As in the terminal stage of genotype IIR infections, the genotype 0 parasite was able to progress to the mature myxospore stage in the intestine (Figure 5B).

Figure 4.

Figure 4.

Moderate intestinal tissue damage is present in Ceratonova shasta genotype 0 infections. Intestinal sections stained with H&E. (A) Uninfected control, (B) 22 dpe, with no apparent immune cell proliferation and (C, D) 29 dpe, with moderate proliferation of immune cells and fibrosis (arrow). Parasites (arrowhead) are present on the surface of the mucosal epithelia, but the epithelium was intact.

Figure 5.

Figure 5.

Ceratonova shasta development to the myxospore stages in genotype 0 infected fish hosts. Intestinal sections were stained with Giemsa. (A) 22 dpe, developmental parasite stages at base of epithelium (arrow), presporogonic stages in lumen (arrowhead) and at (C) 29 dpe, nearly mature disporoblasts (arrowheads) in the lumen and at the base of the epithelium.

4. Discussion

Here, we compared the immune response of rainbow trout infected with a C. shasta genotype that causes a chronic, asymptomatic infection (0) with the response against a genotype that causes the typical acute, severe disease associated with the parasite (IIR). Our results supported the hypothesis that genotype IIR infections result in upregulation of inflammatory cytokine expression, consistent with the inflammation observed by histology (Bartholomew et al., 1989). As predicted, upregulation of inflammatory genes was largely not observed in genotype 0 infections, with the exception of ifng, whose expression increased over the course of the sampling period. However, our results did not support the hypothesis that the adaptive immune response plays a role in protection from disease and mortality, given that the immunoglobulins igm and igt were upregulated in both genotype infections.

The inability of the host to control genotype IIR infections appears to result from the combined parasite-induced upregulation of inflammatory cytokines and the inability of regulatory cytokines to suppress these responses. The upregulation of IL-6 at 15 dpe was remarkable; IL-6 is thought to be involved in acute phase response to inflammatory stimuli and so its presence suggests an ongoing inflammatory response. Additionally, IL-6 acts on B cells to impact antibody secretion in teleost fish (Abós et al., 2016), so antibody production may be occurring at this time as well. However, we also measured an upregulation of il10 expression in genotype IIR infections at 15 dpe, which would suggest regulatory activity during a time of parasite proliferation in the intestine. Il8 and ifng were upregulated towards the end of the sampling period, indicating neutrophil recruitment and macrophage/TH1 responses, respectively, during an overwhelming host response characterizing the end stages of IIR infections. However, these inflammatory responses were insufficient to clear the infection. Histological examination of intestines show infiltration of lymphocytic cells near where parasites were observed and extensive inflammation along with parasite proliferation, indicating that parasites continue to proliferate even in the presence of inflammation (Bartholomew et al., 1989).

In contrast, genotype 0 is able to proliferate in the host without eliciting an inflammatory response. There is relatively little known about genotype 0 infections and much of what we know has to be inferred from studies that were conducted prior to our ability to identify parasite genotypes. Two previous histological studies were likely genotype 0 infections (Bartholomew et al. 2004; Zhang et al. 2010), and these showed infections of moderate severity that lacked the destruction of mucosal surfaces associated with genotype IIR infections. In laboratory studies, evidence that genotype 0 is able to persist was shown by detection of the parasite in fish at least 2 years after infection (authors’ personal observations).

Parasite motility-related gene expression between C. shasta genotypes 0 and IIR was also analyzed for the samples in which we measured host gene expression (Alama-Bermejo et al., 2019). Cell adhesion genes were upregulated earlier in the infection (at 7 and 15 dpe) for genotype 0 parasites and later in the infection (22 and 29 dpe) for genotype IIR parasites. Those findings, along with low proliferation over time for genotype 0, suggest that genotype 0 parasites migrate to the intestine initially but are less active once established there; this corresponds to our findings of minimal tissue damage in genotype 0-infected fish. In contrast, genotype IIR parasites proliferated rapidly in the intestine and both sporogonic stages and mature spores were observed at 22 and 29 dpe, along with upregulated adhesion gene expression at these timepoints (Alama-Bermejo et al., 2019); these parasite actions may be the cause of the tissue damage and inflammation that we have observed in late-stage genotype IIR infections.

Our observations in this study corroborate that genotype 0 infections are characterized by proliferation of immune cells, with fibrosis evident as a reparative response. In contrast to genotype IIR infections, the parasite is able to migrate through the mucosal epithelium without causing damage to that tissue. We did not observe any upregulation of the inflammatory cytokines IL6 and IL8, which is consistent with the lack of tissue damage. Ifng and il10 were both upregulated, particularly later in the infection, which may indicate an antigen-specific TH1 T-cell response that was being effectively self-regulated to minimize tissue damage (reviewed in Cope et al., 2011).

Infections by other myxozoans also result in upregulation of both inflammatory and regulatory cytokines, suggesting they play a role in either the recovery or pathology of the infection. In a study of E. leei in gilthead sea bream, il6, il8, and il10 were all upregulated in the intestines of exposed fish (Pérez-Cordón et al., 2014). However, with another Enteromyxum intestine parasite (E. scophthalmi) in turbot (Scophthalmus maximus), an RNA-seq analysis of early infection (24 days post-inoculation) did not detect any upregulation of il6, il8, or il10, and ifng was only upregulated in the head kidney, suggesting an IFNG-mediated immune response in early E. scophthalmi infections (Ronza et al., 2016). Similar results were also found in a study of proliferative kidney disease (PKD), caused by the malacosporean parasite Tetracapsuloides bryosalmonae, where there was an upregulation of il6 and ifng expression in the kidneys of fish with signs of clinical disease, but overall the infected fish had an anti-inflammatory profile, with increased expression of regulatory cytokines such as il10 and tgfb, and the transcription factor foxp3 (Gorgoglione et al., 2013). These genes all correlated positively with kidney disease severity, indicating that their upregulation may play a role in acute disease and mortality. Altogether, these studies suggest that dysregulation of regulatory genes may contribute to an inflammatory response that harms the fish host. These studies demonstrate that myxozoan infections can induce both inflammatory and regulatory immune responses in different tissues.

Given the differences in the ability of the host to resolve infections by genotypes 0 and IIR, we expected to see differences in the expression of genes involved in the adaptive immune response. IgT and IgM have been shown to produce parasite-specific responses in a chronic, low mortality C. shasta infection (putative genotype 0) in rainbow trout (Zhang et al., 2010), with IgT occurring in higher levels in the intestine compared to IgM. We thus expected to see that igt levels would be upregulated in the intestine in genotype 0 infections, as occurred at 29 dpe. However, we did not predict that igt or igm would be upregulated in an acute high mortality IIR infection, particularly late in the infection when mortality was occurring. This suggests that although the host is capable of an adaptive immune response, this may not be effective against parasite genotype IIR. And the fact that the parasite continues to replicate and be released from the intestine in genotype 0-infected fish suggests that the immunoglobulin response is not resulting in parasite death.

The upregulation of immunoglobulin genes in C. shasta is consistent with studies of other myxozoan infections. In rainbow trout with PKD, there was an upregulation of igm and igt expression in the kidney that correlated with increasing disease severity (Gorgoglione et al., 2013). Another study confirmed these results at the protein level, where some increase in IgD was also observed (Abós et al., 2018). Upregulation of igm and igt expression was reported in muscle of Atlantic salmon (Salmo salar) infected with the myxozoan Kudoa thyrsites, and in the intestines of gilthead sea bream (Sparus aurata) infected with Enteromyxum leei, an intestinal myxozoan parasite (Braden et al., 2018; Piazzon et al., 2016). E. leei affects cultured fish species in the Mediterranean, and like C. shasta genotype IIR, also causes inflammation and tissue damage in the intestine (Sitjà‐Bobadilla et al., 2007). These results all suggest that the immune system is mounting an adaptive immune response to myxozoan infections; however, in fatal C. shasta infections, the response is 1) is not sufficient to clear the parasites, 2) comes too late after the tissue has already been damaged by the initial inflammatory response, and/or 3) causes damage to the host and contributes to the pathology observed.

Protection from disease and mortality induced by parasites comes from one of two mechanisms: resistance or tolerance (Soares et al., 2017). Resistance involves reducing the parasite load in the host, while tolerance does not affect parasite numbers but instead controls host tissue damage. Mechanisms of resistance may have been activated in response to either C. shasta genotype, but they were not sufficient to clear the parasite. Tolerance may explain why C. shasta genotype 0 infections can persist for years; in genotype 0-infected fish, C. shasta levels increased over the sampling period, but they were several orders of magnitude lower than genotype IIR and did not cause mortality or clinical disease (Alama-Bermejo et al., 2019). This suggests that either the immune system is employing mechanisms to limit tissue damage (tolerance), as evidenced by the low levels of il6 and il8 in these fish, or that the genotype 0 parasite is simply less abundant compared to genotype IIR. The tolerance hypothesis is supported by our observation of parasite proliferation with limited host tissue damage. Alternatively, the immune system may instead be deploying ongoing parasite-specific adaptive responses that limit the spread of the parasite and result in in chronic infections, as suggested by the production of specific antibodies (Zhang et al. (2010), and supported by the upregulation of igm and igt in this study.

We propose a model of the host-parasite interactions in severe C. shasta infections based on the results of this and previous studies of C. shasta. In our model, recognition of virulent genotype IIR by the host immune system initiates an inflammatory response through signaling by inflammatory cytokines such as IL-6 and IL-8. The inflammatory response causes regulatory cytokines such as IL-10 to be upregulated. Regulation of the immune response allows the parasite to proliferate, which in turn causes tissue damage and increases the inflammatory response in the host. In contrast, the low virulence genotype 0 infections appear to modulate the inflammatory portion of this cycle, leading to less upregulation of both inflammatory and regulatory cytokines. These lower levels of inflammation may protect genotype 0-infected fish from progressing to severe disease and mortality. We recognize, however, that our study has limitations in that our gene expression data could not be confirmed with protein or cellular response data; this is due to the limited availability of antibody reagents that are compatible with rainbow trout samples. However, gene expression data can still give us valuable insight to the host immune response to pathogens. If our model is confirmed, it suggests that immune treatments that reduce levels of inflammatory cytokines such as IL-6 and IL-8 could prevent mortality from severe infections. In addition, our findings that IgT expression is upregulated in both severe and mild infections suggest that treatments that stimulate an immunoglobulin response may have limited effectiveness.

  • IL6, IL8, and IFNG were all upregulated in C. shasta genotype II infections.

  • IgM and IgT were significantly upregulated at the end of both genotype infections.

  • Genotype 0 infections showed a cellular immune response but little tissue damage.

Acknowledgements

Thanks to Ruth Milston-Clements, Rich Holt, and Ryan Craig at the John L. Fryer Aquatic Animal Health Laboratory, Oregon State University (OSU), for assistance with river exposures and fish husbandry; Stephen Atkinson, Department of Microbiology, OSU, for assistance with microscopy and in developing the gene expression qPCR assays; and Julie Alexander, Department of Microbiology, OSU, for assistance with statistical analysis. This research was supported by the National Institutes of Health (R01GM085207-06), the National Science Foundation (IOS-1457282), the John L. Fryer Fellowship, the Harriet M. Winton Scholarship, and the Czech Science Foundation (project 14-28784P and 19-28399X for GAB).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Abós B, Wang T, Castro R, Granja AG, Leal E, Havixbeck J, Luque A, Barreda DR, Secombes CJ, Tafalla C, 2016. Distinct differentiation programs triggered by IL-6 and LPS in teleost IgM+ B cells in the absence of germinal centers. Sci. Rep 6, 30004 10.1038/srep30004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Abós B, Estensoro I, Perdiguero P, Faber M, Hu Y, Díaz Rosales P, Granja AG, Secombes CJ, Holland JW, Tafalla C, 2018. Dysregulation of B cell activity during proliferative kidney disease in rainbow trout. Front. Immunol 9 10.3389/fimmu.2018.01203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alama-Bermejo G, Holzer AS, Bartholomew JL, 2019. Myxozoan adhesion and virulence: Ceratonova shasta on the move. Microorganisms 7, 397 10.3390/microorganisms7100397 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Alama-Bermejo G, Meyer E, Atkinson SD, Holzer AS, Wísniewska MM, Kolísko M, Bartholomew JL, 2020. Transcriptome-wide comparisons and virulence gene polymorphisms of host-associated genotypes of the cnidarian parasite Ceratonova shasta in salmonids. Genome Biol. Evoln evaa109 10.1093/gbe/evaa109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Atkinson SD, Bartholomew JL, 2010a. Disparate infection patterns of Ceratomyxa shasta (Myxozoa) in rainbow trout (Oncorhynchus mykiss) and Chinook salmon (Oncorhynchus tshawytscha) correlate with internal transcribed spacer-1 sequence variation in the parasite. Int. J. Parasitol 40, 599–604. 10.1016/j.ijpara.2009.10.010 [DOI] [PubMed] [Google Scholar]
  6. Atkinson SD, Bartholomew JL, 2010b. Spatial, temporal and host factors structure the Ceratomyxa shasta (Myxozoa) population in the Klamath River basin. Infect. Genet. Evol 10, 1019–1026. 10.1016/j.meegid.2010.06.013 [DOI] [PubMed] [Google Scholar]
  7. Atkinson SD, Hallett SL, Bartholomew JL, 2018. Genotyping of individual Ceratonova shasta (Cnidaria: Myxosporea) myxospores reveals intra-spore ITS-1 variation and invalidates the distinction of genotypes II and III. Parasitology 1–6. 10.1017/S0031182018000422 [DOI] [PubMed] [Google Scholar]
  8. Bartholomew JL, 1998. Host resistance to infection by the myxosporean parasite Ceratomyxa shasta: a review. J. Aquat. Anim. Health 10, 112–120. 10.1577/1548-8667(1998)010<0112:HRTIBT>2.0.CO;2 [DOI] [Google Scholar]
  9. Bartholomew JL, Ray E, Torell B, Whipple MJ, Heidel JR, 2004. Monitoring Ceratomyxa shasta infection during a hatchery rearing cycle: comparison of molecular, serological and histological methods. Dis. Aquat. Organ 62, 85–92. 10.3354/dao062085 [DOI] [PubMed] [Google Scholar]
  10. Bartholomew JL, Smith CE, Rohovec JS, Fryer JL, 1989. Characterization of a host response to the myxosporean parasite, Ceratomyxa shasta (Noble), by histology, scanning electron microscopy and immunological techniques. J. Fish Dis 12, 509–522. 10.1111/j.1365-2761.1989.tb00561.x [DOI] [Google Scholar]
  11. Bjork SJ, Bartholomew JL, 2010. Invasion of Ceratomyxa shasta (Myxozoa) and comparison of migration to the intestine between susceptible and resistant fish hosts. Int. J. Parasitol 40, 1087–1095. 10.1016/j.ijpara.2010.03.005 [DOI] [PubMed] [Google Scholar]
  12. Bjork SJ, Bartholomew JL, 2009. Effects of Ceratomyxa shasta dose on a susceptible strain of rainbow trout and comparatively resistant Chinook and coho salmon. Dis. Aquat. Organ 86, 29–37. 10.3354/dao02092 [DOI] [PubMed] [Google Scholar]
  13. Bjork SJ, Zhang Y-A, Hurst CN, Alonso-Naveiro ME, Alexander JD, Sunyer JO, Bartholomew JL, 2014. Defenses of susceptible and resistant Chinook salmon (Onchorhynchus tshawytscha) against the myxozoan parasite Ceratomyxa shasta. Fish Shellfish Immunol. 37, 87–95. 10.1016/j.fsi.2013.12.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Braden LM, Rasmussen KJ, Purcell SL, Ellis L, Mahony A, Cho S, Whyte SK, Jones SRM, Fast MD, 2018. Acquired protective immunity in Atlantic salmon Salmo salar against the myxozoan Kudoa thyrsites involves induction of MHIIβ+ CD83+ antigen-presenting cells. Infect. Immun 86, e00556–17. 10.1128/IAI.00556-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Cope A, Le Friec G, Cardone J, Kemper C, 2011. The Th1 life cycle: molecular control of IFN-γ to IL-10 switching. Trends Immunol. 32, 278–286. 10.1016/j.it.2011.03.010 [DOI] [PubMed] [Google Scholar]
  16. Deloffre LAM, Andrade A, Filipe AI, Canario AVM, 2012. Reference genes to quantify gene expression during oogenesis in a teleost fish. Gene 506, 69–75. 10.1016/j.gene.2012.06.047 [DOI] [PubMed] [Google Scholar]
  17. Fujiwara M, Mohr MS, Greenberg A, Foott JS, Bartholomew JL, 2011. Effects of ceratomyxosis on population dynamics of Klamath fall-run Chinook salmon. Trans. Am. Fish. Soc 140, 1380–1391. 10.1080/00028487.2011.621811 [DOI] [Google Scholar]
  18. Gorgoglione B, Wang T, Secombes CJ, Holland JW, 2013. Immune gene expression profiling of Proliferative Kidney Disease in rainbow trout Oncorhynchus mykiss reveals a dominance of anti-inflammatory, antibody and T helper cell-like activities. Vet. Res 44, 55 10.1186/1297-9716-44-55 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hallett SL, Bartholomew JL, 2006. Application of a real-time PCR assay to detect and quantify the myxozoan parasite Ceratomyxa shasta in river water samples. Dis. Aquat. Organ 71, 109–18. 10.3354/dao071109 [DOI] [PubMed] [Google Scholar]
  20. Hallett SL, Ray RA, Hurst CN, Holt RA, Buckles GR, Atkinson SD, Bartholomew JL, 2012. Density of the waterborne parasite Ceratomyxa shasta and its biological effects on salmon. Appl. Environ. Microbiol 78, 3724–31. 10.1128/AEM.07801-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hurst CN, Alexander JD, Dolan BP, Jia L, Bartholomew JL, 2019. Outcome of within-host competition demonstrates that parasite virulence doesn’t equal success in a myxozoan model system. Int. J. Parasitol. Parasites Wildl, 9, 25–35. 10.1016/j.ijppaw.2019.03.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hurst CN, Bartholomew JL, 2012. Ceratomyxa shasta genotypes cause differential mortality in their salmonid hosts. J. Fish Dis 35, 725–732. 10.1111/j.1365-2761.2012.01407.x [DOI] [PubMed] [Google Scholar]
  23. Pérez-Cordón G, Estensoro I, Benedito-Palos L, Calduch-Giner JA, Sitjà-Bobadilla A, Pérez-Sánchez J, 2014. Interleukin gene expression is strongly modulated at the local level in a fish–parasite model. Fish Shellfish Immunol. 37, 201–208. 10.1016/j.fsi.2014.01.022 [DOI] [PubMed] [Google Scholar]
  24. Piazzon MC, Galindo-Villegas J, Pereiro P, Estensoro I, Calduch-Giner JA, Gómez-Casado E, Novoa B, Mulero V, Sitjà-Bobadilla A, Pérez-Sánchez J, 2016. Differential modulation of IgT and IgM upon parasitic, bacterial, viral, and dietary challenges in a perciform fish. Front. Immunol 7 10.3389/fimmu.2016.00637 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Ratliff DE, 1981. Ceratomyxa shasta: Epizootiology in Chinook Salmon of Central Oregon. Transactions of the American Fisheries Society 110, 507–513. 10.1577/1548-8659(1981)110<507:CS>2.0.CO;2 [DOI] [Google Scholar]
  26. Ronza P, Robledo D, Bermúdez R, Losada AP, Pardo BG, Sitjà-Bobadilla A, Quiroga MI, Martínez P, 2016. RNA-seq analysis of early enteromyxosis in turbot (Scophthalmus maximus): new insights into parasite invasion and immune evasion strategies. Int. J. Parasitol 46, 507–517. 10.1016/j.ijpara.2016.03.007 [DOI] [PubMed] [Google Scholar]
  27. Schmittgen TD, Livak KJ, 2008. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc 3, 1101–1108. 10.1038/nprot.2008.73 [DOI] [PubMed] [Google Scholar]
  28. Sitjà-Bobadilla A, Diamant A, Palenzuela O, Alvarez-Pellitero P, 2007. Effect of host factors and experimental conditions on the horizontal transmission of Enteromyxum leei (Myxozoa) to gilthead sea bream, Sparus aurata L., and European sea bass, Dicentrarchus labrax (L.). J. Fish Dis 30, 243–250. 10.1111/j.1365-2761.2007.00804.x [DOI] [PubMed] [Google Scholar]
  29. Soares MP, Teixeira L, Moita LF, 2017. Disease tolerance and immunity in host protection against infection. Nat. Rev. Immunol 17, 83–96. 10.1038/nri.2016.136 [DOI] [PubMed] [Google Scholar]
  30. Stinson MET, Atkinson SD, Bartholomew JL, 2018. Host-specific genotypes of Ceratonova shasta (Cnidaria:Myxosporea) are widespread in the Pacific Northwest of North America. J. Parasitol 104, 645–650. 10.1645/18-79 [DOI] [PubMed] [Google Scholar]
  31. Stinso MET, Bartholomew JL, 2012. Predicted redistribution of Ceratomyxa shasta genotypes with salmonid passage in the Deschutes River, Oregon. J. Aquat. Anim. Health 24, 274–280. 10.1080/08997659.2012.716012 [DOI] [PubMed] [Google Scholar]
  32. Stocking RW, Holt RA, Foott JS, Bartholomew JL, 2006. Spatial and temporal occurrence of the salmonid parasite Ceratomyxa shasta in the Oregon–California Klamath River Basin. J. Aquat. Anim. Health 18, 194–202. 10.1577/H05-036.1 [DOI] [Google Scholar]
  33. Zhang Y-A, Salinas I, Li J, Parra D, Bjork S, Xu Z, LaPatra SE, Bartholomew J, Sunyer JO, 2010. IgT, a primitive immunoglobulin class specialized in mucosal immunity. Nat. Immunol 11, 827–835. 10.1038/ni.1913 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES