Skip to main content
Cancer Science logoLink to Cancer Science
. 2013 Jun 28;104(9):1178–1188. doi: 10.1111/cas.12208

Telomelysin shows potent antitumor activity through apoptotic and non‐apoptotic cell death in soft tissue sarcoma cells

Gui‐Dong Li 1,2, Hiroyuki Kawashima 1,✉, Akira Ogose 1, Takashi Ariizumi 1, Tetsuo Hotta 1, Ryozo Kuwano 3, Yasuo Urata 4, Toshiyoshi Fujiwara 5,6, Naoto Endo 1
PMCID: PMC7656541  PMID: 23718223

Abstract

This study investigated the pathway underlying the antitumor activity of telomelysin, a telomerase‐dependent, replication‐selective oncolytic adenovirus, in soft tissue sarcoma cells. Treatment with telomelysin alone resulted in simultaneous induction of apoptosis and autophagy, whereas cotreatment with telomelysin and 3‐methyladenine significantly reduced cell viability and increased apoptosis and the cellular ATP level compared to treatment with telomelysin alone, indicating that telomelysin‐mediated autophagy is a death‐protective but not death‐promoting process. Cotreatment with Z‐Val‐Ala‐Asp‐CH2F significantly increased cellular ATP depletion compared to telomelysin‐alone treatment while inhibiting telomelysin‐induced apoptosis and having no significant effect on cell viability, indicating that it promotes transition from apoptotic to necrotic cell death.


Primary STS tumors are highly heterogeneous, very rare malignant mesenchymal tumors. Although representing less than 1% of all cancerous tumors in humans,1 STS tumors are highly malignant. Approximately 50% of patients with high‐grade STS tumors develop distant metastases and ultimately die of disease despite optimal multidisciplinary treatment, including limb salvage surgery, radiation, and adjuvant chemotherapy.2, 3, 4 Thus, there is an imminent need to develop more efficient strategies for treatment of STS tumors to decrease local recurrence and distant metastases, and thereby improve patient survival.

Use of CRAds is a promising new approach to the treatment of various cancers5, 6 that has shown encouraging anticancer potency and safety in several clinical trials.7, 8, 9 Telomerase is expressed in almost all cancer cells but not in all normal cells.10, 11 As such, a telomerase‐targeted oncolytic adenoviral agent has emerged as a particularly promising CRAd among those developed for the treatment of human cancers. We previously described our examination of the effect of treatment with telomelysin (OBP‐301), the first adenovirus found to retain a fully functional viral E3 region.11 Telomelysin is a telomerase‐specific, replication‐selective oncolytic adenovirus in which the hTERT promoter element that drives expression of E1A and E1B genes is linked with an internal ribosome entry site to minimize “leakiness.” TelomeScan (OBP‐401) is a variant of telomelysin in which the GFP gene, under the control of the cytomegalovirus promoter, has been inserted into the E3 region of telomelysin for the monitoring of viral replication. Both adenoviral vectors have been previously constructed and described.12, 13, 14, 15, 16 In our previous study, we found that treatment with telomelysin exerted a selective and efficient cytotoxic effect on various human cancers, including carcinomas, melanomas, and osteosarcomas, without damaging normal fibroblasts, mesenchymal cells, or tissues.17, 18, 19, 20 In support of our findings, a recently completed phase I clinical trial of telomelysin in patients with advanced solid tumors found that telomelysin treatment was well tolerated by these patients.13

Despite such research, the antitumor efficacy of telomelysin in the treatment of STS tumors and the cell death pathway induced by telomelysin treatment remain unclear. Discovering the underlying cell death mechanism(s), whether an apoptotic, autophagic, and/or necrosis‐like program, may contribute to improving the therapeutic effectiveness of oncolytic adenovirus therapy as part of combined treatment by allowing for targeting of the cell death pathway. To contribute to this effort, we examined the extent of viral replication and cytotoxicity of telomelysin in human STS cell lines and attempted to identify the mechanism(s) by which telomelysin induces cell death.

Materials and Methods

Cell lines and culture conditions

The human STS cell lines used in this study were kindly provided by outside sources, purchased, or established in our laboratory. Specifically: the alveolar soft part sarcoma cell line ASPS‐KY was kindly provided by Dr S. Yanoma (Kanagawa Cancer Center, Yokohama, Japan); the synovial sarcoma HS‐SY‐II and SYO‐1 cell lines by Dr H. Sonobe (Department of Pathology, Kochi Medical School, Kochi, Japan) and Dr A. Kawai (Department of Orthopaedic Surgery, National Cancer Center Hospital, Tokyo, Japan), respectively; the epithelioid sarcoma cell lines SFT‐8606 and FU‐EPS‐1 by Dr H. Iwasaki (Fukuoka University School of Medicine, Fukuoka, Japan); and the myxoid liposarcoma cell line 402‐92 by Dr. P. Ǻman (Department of Clinical Genetics, University Hospital, Lund, Sweden). The fibrosarcoma cell line HT‐1080 was purchased from the Health Science Research Resources Bank (Osaka, Japan). The epithelioid sarcoma cell line NEPS, the malignant fibrous histocytoma (MFH) cell lines NMFH‐1 and NMFH‐2, and the malignant peripheral nerve sheath tumor cell line NMS‐2 were established in our laboratory. The human embryonic kidney cell line HEK‐293 (ATCC, Manassas, VA, USA), the human T‐cell leukemia cell line CCRF‐CEM (ATCC), and the human cervical carcinoma cell line HeLa (Riken Cell Bank, Tsukuba, Japan) were used as controls.

The ASPS‐KY, NEPS, NMFH‐1, NMFH‐2, NMS‐2, SFT‐8606, FU‐EPS‐1, 402‐92, and CCRF‐CEM cell lines were cultured in RPMI‐1640 (Invitrogen, Carlsbad, CA, USA); the HS‐SY‐II, SYO‐1, and HEK‐293 cell lines were maintained in DMEM (Invitrogen); and the HT‐1080 and HeLa cell lines were maintained in alpha‐MEM (Invitrogen). All media were supplemented with 10% FBS (PAA, Pasching, Austria) containing 1% antibiotic/antimycotic solution (Invitrogen). All cell lines were incubated at 37°C in an atmosphere of 5% CO2 and 95% air with high humidity.

Recombinant adenoviruses

CsCl2‐step gradient ultracentrifugation was used to purify the three recombinant adenoviruses examined: telomelysin (OBP‐301); TelomeScan (OBP‐401), a variant of telomelysin in which the GFP gene, under the control of the cytomegalovirus promoter, has been inserted into the E3 region of telomelysin for the monitoring of viral replication; and d1312, an E1A‐deleted replication‐deficient adenovirus that was used as a control vector. The titer of each adenovirus was determined by carrying out plaque‐forming assays on HEK‐293 cells.

Quantitative real‐time RT‐PCR

Total RNA was extracted from cultured cells using the Isogen Reagent (Nippongene, Toyama, Japan) and cDNA was generated using the PrimeScript RT reagent kit (Takara Bio, Tokyo, Japan), according to the manufacturer's protocol. Quantitative real‐time PCR was carried out using the Thermal Cycler Dice Real Time System (Takara Bio) and the SYBR Premix Ex Taq II (Perfect Real Time) PCR kit (Takara Bio) according to the manufacturer's instructions. The primer sequences used were as follows: hTERT, 5′‐GAGTGTCTGGAGCAAGTTGCAAAG‐3′ (forward) and 5′‐CACGACGTAGTCCATGTTCACAATC‐3′ (reverse); CAR, 5′‐TGGCACATATCAGTGCAAAGTGAA‐3′ (forward) and 5′‐CAACGTAACATCTCGCACCTGAA‐3′ (reverse); E1A, 5′‐GTATGATTTAGACGTGACGG‐3′ (forward) and 5′‐GATAGCAGGGCGCATTTTAG‐3′ (reverse); E1B, 5′‐GGCTAAAGGGGGTAAAGAGGG‐3′ (forward) and 5′‐CCTTACATCGGTCCAGGCTTC‐3′ (reverse); and GAPDH, 5′‐GCACCGTCAAGGCTGAGAAC‐3′ (forward) and 5′‐TGGTGAAGACGCCAGTGGA‐3′ (reverse). DNA amplification for the hTERT and the CAR genes consisted of denaturation at 95°C for 10 s, followed by 40 cycles of denaturation at 95°C for 5 s, and annealing and extension at 60°C for 30 s. The PCR amplification of the E1A and E1B genes consisted of denaturation at 95°C for 10 s, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min. Data were analyzed using the Thermal Cycler Dice Real Time System analysis software package (Takara Bio). The HeLa cell line was used as a positive control for CAR gene expression21 and the HEK‐293 cell line as a positive control for hTERT gene expression.11 As the HEK‐293 cell line is known as an adenovirus 5 DNA‐transformed cell line, it was also used as a positive control for E1A and E1B gene expression. After the PCR results for the mRNA expression levels were normalized to those of GAPDH, the relative mRNA expression level of each sample was calculated by dividing the measured mRNA expression level by the level of a positive control that had been assigned a value of 1.0. All results are expressed as the mean ± SD values calculated using the data collected from individual experiments carried out in triplicate.

Western blot analysis

Cells were harvested and lysed using 100 μL sample buffer (62.5 mM Tris [pH 6.8], 2% SDS, 5% glycerol, and 6 M urea) containing 4 μL protease inhibitor cocktail (Complete; Roche Diagnostic, Mannheim, Germany). After measurement of supernatant protein concentration using the BCA Protein Assay Kit (Pierce, Rockford, IL, USA), the supernatants were mixed with 5% (v/v) 1 M DTT and 5% (v/v) bromophenol blue and heated at 95–100°C for 5 min. Equal amounts (50 μg/lane) of proteins were separated by SDS‐PAGE gels (range 7.5–15%) and then electrotransferred to nitrocellulose membranes. The membranes were incubated with the primary antibodies before being probed with HRP‐linked secondary antibodies (Amersham Biosciences, Little Chalfont, UK) and development using ECL detection reagents (Amersham Biosciences).

Control cell lines were as follows: the HeLa cell line was used as a positive control for CAR protein expression;22 the HEK‐293 cell line as a positive control for induction of autophagy after overnight serum‐starving of HEK‐293 cells; the CCRF‐CEM cell line as a positive control for induction of apoptosis after 24 h of treatment with dexamethasone (2 μM);23 and β‐actin blots as loading controls. After the protein bands of microtubule‐associated protein 1 LC3B and β‐actin had been quantified by densitometric scanning using NIH‐Image J software (http://rsb.info.nih.gov/ij/download.html), the intensities of the LC3B‐II bands were normalized to the β‐actin signals using the following primary antibodies: mouse anti‐adenovirus type 5 E1A mAb (1:3000; BD Biosciences PharMingen, San Diego, CA, USA), rabbit anti‐caspase‐3 (1:1000; Cell Signaling Technology, Beverly, MA, USA), rabbit anti‐PARP (1:1000; Cell Signaling Technology), rabbit anti‐LC3B polyclonal antibodies (1:1000; Cell Signaling Technology), and mouse anti‐β‐actin mAb (1:3000; Sigma‐Aldrich, St. Louis, MO, USA).

Flow cytometry

The NEPS, NMFH‐2, and NMFH‐1 cell lines, three human STS cell lines, were seeded on 6‐cm dishes at a density of 5 × 105 cells/well for 24 h, and then virally infected with TelomeScan at an MOI of 0, 0.1, 1, 5, or 10. At 48 h after infection, the cells, which included floating cells, were harvested, washed twice with FACS buffer (5% FBS in PBS and 1 mM EDTA), and then resuspended in FACS buffer. The percentage of GFP‐positive cells was analyzed using a BD FACSCalibur flow cytometer and the CellQuest Pro software package (Becton‐Dickinson, Franklin Lakes, NJ, USA). A minimum of 10 000 events were examined for each experiment.

Fluorescence microscopy

The NEPS, NMFH‐2, and NMFH‐1 cell lines were seeded on Lab‐Tek chamber slides (Nalge Nunc International, Rochester, NY, USA) at a density of 1.25 × 105 cells/well for 24 h and then virally infected with TelomeScan at an MOI of 1 or 10. After further incubation for the indicated time periods, GFP fluorescence was detected and photographed under ×100 magnification using an Olympus BX‐50 bright‐field microscope (Olympus, Tokyo, Japan) equipped with a BX‐FLA fluorescence attachment and an NIBA filter (excitation, 470–490 nm; emission, 515–550 nm).

After infection with TelomeScan at an MOI of 1, the cell lines were incubated for an additional 72 h and fixed with 4% (v/v) paraformaldehyde in PBS for 15 min at room temperature, and then made permeable with ice‐cold 100% methanol for 10 min at −20°C. After being covered with blocking buffer (1 × PBS/5% normal goat serum/0.3% Triton X‐100) for 60 min at room temperature to block non‐specific adsorption of antibodies, the cells were incubated with primary antibody against LC3B (1:400; Cell Signaling Technology) in 1% BSA/PBS at 4°C overnight, probed with Alexa Fluor 488 goat anti‐rabbit secondary antibodies (1:1000; Cell Signaling Technology) 1% BSA/PBS, and incubated at room temperature in a dark environment for an additional 2 h. After counterstaining with 300 nM DAPI (Invitrogen), fluorescent signals were detected by observation under fluorescence microscopy at ×100 magnification.

Cell viability and morphology

After plating on 96‐well plates at a density of 5 × 103 cells/well for 24 h, the NEPS, NMFH‐2, and NMFH‐1 cell lines were either infected with telomelysin at an MOI of 0.01, 0.1, 1, 2, or 10 or mock infected with PBS to serve as controls. Cell viability was assessed by XTT assay at the indicated time points using a Cell Proliferation Kit‐II (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer's protocol. In the other experiments, NEPS and NMFH‐2 cells were pre‐incubated in either the presence or absence of 2 mM 3‐MA (Sigma‐Aldrich), an inhibitor of autophagosome formation, or 40 μM Z‐VAD‐FMK (Calbiochem, Gibbstown, NJ, USA), an inhibitor of pan‐caspase, for 2 h before infection with telomelysin at an MOI of 1 or mock infection with PBS. Cell viability was assessed by XTT assay at the indicated time points.

Cellular and nuclear morphology

After plating on 6‐cm dishes at a density of 5 × 105 cells/dish for 24 h, the NMFH‐1, NMFH‐2, and NEPS cell lines were either infected with telomelysin at an MOI of 0.1, 1, or 10 or mock infected with PBS. Cell morphology was observed daily using the ULWCD 0.30 Olympus phase‐contrast microscope (IMT2) and photomicrographs were taken at 72 h after infection using the Olympus DP12 digital camera attached to the microscope under ×40 magnification. In the other experiments, NMFH‐2 and NEPS cells were pre‐incubated in either the presence or absence of 2 mM 3‐MA or 40 μM Z‐VAD‐FMK for 2 h before infection with TelomeScan at an MOI of 1 for 72 h or mock infection with PBS for 72 h. Cell morphology was observed under phase‐contrast microscopy at ×100 and ×200 magnification and nuclear condensation and fragmentation were determined by DAPI staining. To carry out the latter, cells were washed once with ice‐cold PBS, smeared on slides, and stained with 300 nM DAPI (Invitrogen) for 15 min before nuclear morphology (blue fluorescence) was immediately examined by fluorescence microscopy at 460 nm and ×100 and ×200 magnification.

DNA fragmentation detected by TUNEL assay

After being seeded on 6‐cm dishes at a density of 5 × 105 cells/dish for 24 h, NMFH‐2 and NEPS cells were pre‐incubated in either the presence or absence of 2 mM 3‐MA or 40 μM Z‐VAD‐FMK for 2 h before infection with telomelysin at an MOI of 1 for 72 h or mock infection with PBS for 72 h. DNA fragmentation of apoptotic cells was then detected by TUNEL assay using the DeadEnd Fluorometric TUNEL system (Promega, Madison, WI, USA) according to the manufacturer's protocol. Briefly, 3–5 × 106 cells were washed with ice‐cold PBS twice, fixed with 4% paraformaldehyde in PBS for 20 min on ice, and permeabilized with 70% ice‐cold ethanol at −20°C overnight. After washing with PBS, 2 × 106 cells were resuspended in 80 μL equilibration buffer composed of 200 mM potassium cacodylate (pH 6.6), 25 mM Tris‐HCl (pH 6.6), 0.2 mM DTT, 0.25 mg/mL BSA, and 2.5 mM cobalt chloride before incubation at room temperature for 5 min. After the addition of 50 μL rTdT incubation buffer consisting of 45 μL equilibration buffer, 5 μL nucleotide mix (50 μM fluorescein‐12‐dUTP, 100 μM dATP, 10 mM Tris‐HCl [pH 7.6], and 1 mM EDTA) and rTdT enzyme, the cells were incubated in a water bath for 90 min at 37°C in a dark environment while being resuspended with a micropipettor at 15‐min intervals. After the reaction had been terminated by the addition of 1 mL of 20 mM EDTA, the cells were resuspended in 1 mL of 0.1% Triton X‐100 solution in PBS containing 5 mg/mL BSA. The cells reacting with the incubation buffer without the rTdT enzyme were used as negative controls and the cells treated with DNase I buffer were used as positive controls for DNA fragmentation. The percentage of green fluorescence of fluorescein‐12‐dUTP (TUNEL‐positive) cells was analyzed using a BD FACSCalibur flow cytometer and the CellQuest Pro software package (Becton‐Dickinson). The TUNEL‐stained cells were then counterstained with 0.5 mL propidium iodide solution that had been freshly diluted to 5 μg/mL in PBS containing 250 μg DNase‐free RNase A. After subsequent incubation at room temperature for 30 min in the dark, the cells were immediately examined under fluorescence microscopy for observation of green fluorescence of fluorescein at 520 ± 20 nm and red fluorescence of propidium iodide at >620 nm. A minimum of 10 000 events were examined for each experiment.

Adenosine triphosphate assay

The NMFH‐2 and NEPS cells were treated with telomelysin alone at an MOI of 1 or 10 or cotreated with telomelysin and either 3‐MA or Z‐VAD‐FMK for 48 h. Total cellular adenosine triphosphate (ATP) assay was then carried out using an ATP Colorimetric/Fluorometric Assay Kit (BioVision, Mountain View, CA, USA) according to the manufacturer's instructions. Briefly, 1 × 106 cells were pelleted, lysed in 100 μL ATP assay buffer, and rapidly frozen using liquid nitrogen until assay. In preparation for assay, lysates were homogenized and centrifuged (15 000g, 2 min, 4°C) using 10‐kD molecular weight cut‐off spin columns (BioVision). The supernatants were then collected, added to 96‐well plates (50 μL/well), and mixed with ATP reaction mixture (50 μL/well) consisting of the ATP probe, converter, developer mix, and assay buffer. After the plates had been incubated at room temperature for 30 min while being protected from light, the absorbance in each well was measured at 570 nm using a microplate reader. As ethanol is known to induce significant cellular ATP depletion,24 cells that had been incubated with 10% ethanol for 6 h were used as positive controls. The correct background value was obtained by subtracting the value of the no‐ATP standard from all standard and sample readings.

Statistical analysis

Data are shown as mean ± SD values. Differences between groups were evaluated using two‐tailed Student's t‐testing and spss 14.0 software (SPSS Inc., Chicago, IL, USA). A P‐value < 0.01 was considered an indication of statistical significance.

Results

Expression of hTERT and CAR in STS cells

To determine whether the human STS cell lines are appropriate targets for telomelysin treatment, the expression of hTERT, the catalytic subunit of human telomerase, and CAR, the cell surface receptor for adenoviral entry, were examined. All human STS cell lines tested (11/11) were found to express hTERT and CAR mRNA at detectable, albeit diverse, levels (Fig. 1). The level of CAR and hTERT mRNA expression was defined in relation to that of HEK‐293 or HeLa cells, which had been assigned a value of 1, according to the following parameters: a value ≥1.0 was considered an indication of a high level of expression; 0.1–1.0 was considered a moderate level; and <0.1 a low level. Compared with that of HEK‐293 cells, the relative mRNA expression of hTERT was found to be high in NEPS cells (2.19), moderate in HT‐1080, HS‐SY‐II, SFT‐8606, FU‐EPS‐1, ASPS‐KY, NMS‐2, SYO‐1, and 402‐92 cells (range, 0.18–0.93), and low in NMFH‐1 and NMFH‐2 cells (0.01 and 0.02, respectively; Fig. 1a). Compared with that of HeLa cells, the relative mRNA expression of CAR was found to be high in NMFH‐2 and NEPS cells (2.01 and 3.58, respectively), moderate in 402‐92, SYO‐1, NMS‐2, FU‐EPS‐1, and SFT‐8606 cells (range, 0.22–0.84), and low in NMFH‐1, HS‐SY‐II, ASPS‐KY, and HT‐1080 cells (range, 0.0001–0.04; Fig. 1b). Western blot analysis revealed that the CAR protein expression pattern was very consistent with the mRNA expression pattern (Fig. 1c). NMFH‐1 cells were found to have the lowest level and NEPS cells the highest level of CAR protein signaling.

Figure 1.

Figure 1

Expression of human telomerase reverse transcriptase (hTERT), coxsackie and adenovirus receptor (CAR) mRNA, and CAR protein in soft tissue sarcoma (STS) cell lines. (a,b) Expression levels of hTERT and CAR mRNA in STS cell lines (ASPS‐KY, HS‐SY‐II, SYO‐1, HT‐1080, NMFH‐1, NMFH‐2, NMS‐2, NEPS, SFT‐8606, FU‐EPS‐1, and 402‐92) were determined by quantitative real‐time RT‐PCR analysis using specific primers for hTERT and CAR. The relative level of mRNA expression was normalized by GAPDH mRNA expression in each cell line. The values of hTERT (a) and CAR (b) were calculated relative to that of the HEK‐293 or HeLa cell line, each of which served as a control cell line and had been assigned a value of 1.0. Each sample was tested at least in triplicate and data are expressed in mean ± SD values. (c) CAR protein expression as detected by Western blot analysis. Equivalent amounts (50 μg/lane) of cell lysates from the STS cell lines were separated on 10% SDS‐PAGE and detected by a CAR‐specific primary antibody in combination with an HRP‐conjugated secondary antibody and the ECL system. β‐actin levels were assessed in the same samples and served as loading controls. Representative results from two independent experiments are shown.

Expression of E1 mRNA and protein in STS cells following telomelysin infection

The transcriptional activity of the hTERT promoter was assessed in the NMFH‐1 cell line, which showed low hTRET and low CAR expression, the NMFH‐2 line, which showed low hTERT and high CAR expression, and the NEPS line, which showed high hTERT and high CAR expression, after infection with telomelysin. After the cells (5 × 105) had been infected with either TelomeScan at an MOI of 0.1 or 1 or with d1312 at an MOI of 1, the hTERT‐specific transcription capacity of telomelysin was tested by measuring adenovirus E1A and E1B mRNA (Fig. 2) and E1A protein (Fig. 2) expression at the indicated time periods. Telomelysin infection was found to induce marked expression of E1 mRNA/protein in the three STS cell lines in a dose‐ and time‐dependent manner such that the expression levels closely correlated with both the hTERT and CAR expression levels (Figs 1, 2). In contrast, cells treated with control virus d1312 expressed no detectable level of E1 mRNA/protein in spite of expressing an extremely low level of E1B mRNA (Fig. 2).

Figure 2.

Figure 2

Type 5 adenovirus early‐region 1A and 1B (E1A and E1B) mRNA and E1A protein expression levels after telomelysin infection in NMFH‐1, NMFH‐2, and NEPS human soft tissue sarcoma cell lines. (a) Cells were infected with telomelysin at an MOI of 0.1 or 1, mock infected with PBS as controls, or infected with E1A‐deleted adenovirus d1312 at an MOI of 1 as controls. After 24, 48, and 72 h of treatment, E1A and E1B mRNA expression was determined by real‐time quantitative RT‐PCR. After mRNA expression levels had been normalized to that of GAPDH, the mRNA expression of each cell line was calculated relative to that of the HEK‐293 cell line, which was used as a positive control and had been assigned a value of 1.0. Data are presented as mean ± SD values of three individual experiments. (b) After cells had been mock infected with PBS or infected with either d1312 or telomelysin, E1A protein expression was determined by Western blot analysis. Cell lysates (50 μg/lane) were then separated on SDS‐PAGE and probed with anti‐adenovirus type 5 E1A and anti‐β‐actin antibodies. The results of three independent representative experiments are shown.

Visualization and quantification of viral replication in STS cells

To confirm and quantify the viral replication efficacy of telomelysin, the NMFH‐1, NMFH‐2, and NEPS cell lines were examined under fluorescence microscopy for observation of GFP fluorescence after infection with TelomeScan. As shown in Figure 3, the three cell lines were found to express GFP of a gradually increasing brightness in a dose‐ and a time‐dependent manner after TelomeScan infection at an MOI of either 1 (Fig. 3a,b) or 10 (Fig. 3c). In the NEPS cells, GFP expression could be detected as early as 12 h after TelomeScan infection at an MOI of 1 before its subsequent attenuation at 96 h due to severe TelomeScan‐induced cell death. Quantification of TelomeScan viral infection rate by measurement of GFP fluorescence by flow cytometer revealed that GFP expression had gradually increased in a dose‐dependent manner in the three cell STS cell lines, with the percentage of GFP expression 4.8% and 23.4%, 93.7% and 98.6%, and 88.5% and 98.0% in the NMFH‐1, NMFH‐2, and NEPS cells at MOIs of 1 and 10, respectively (Fig. 3d).

Figure 3.

Figure 3

Visualization and quantification of viral replication in soft tissue sarcoma cells by TelomeScan, a telomerase‐specific, replication‐competent adenovirus variant in which telomelysin has been genetically modified to express GFP. (a–c) NEPS (a) and NMFH‐2 (b) cells were infected with TelomeScan at an MOI of 1 and NMFH‐1 cells (c) at an MOI of 10. Cell morphology was observed at the indicated time points for GFP expression under fluorescence microscopy (original magnification, ×100; scale bar = 20 μm). (d) To assess viral infection efficiency, cells were infected with TelomeScan at MOIs of 0, 0.1, 1, 5, or 10 and the percentage of GFP expression was analyzed using a FACSCalibur flow cytometer 48 h after infection. The results of three independent representative experiments are shown.

Cytotoxic effect of telomelysin on STS cells

The cytotoxic effect of telomelysin on STS cells was assessed in NMFH‐1, NMFH‐2, and NEPS cell lines that had either been infected with telomelysin at the indicated MOIs or mock infected with PBS. As shown in Figure 4(a), telomelysin infection was found to be cytotoxic to the NMFH‐2 and NEPS cell lines in a dose‐ and time‐ dependent fashion. At range from MOI of 1 to MOI of 10, the decrease in cell viability was found to be approximately 44% to 82% at day 3 and 75% to 92% at day 5 in the NEPS cell line, and approximately 18% to 35% at day 3 and 23% to 46% at day 5 in the NMFH‐2 cell line. In contrast, no evident cytotoxic effect was observed in the NMFH‐1 cell line after telomelysin infection, even at an MOI of 10, at day 5 (Fig. 4a). Phase‐contrast microscopy also showed that telomelysin exerted a distinct cell‐killing effect in the NMFH‐1 NMFH‐2 cell lines at 72 h after infection at MOIs of 1 and 10 (Fig. S1) but induced no clear cell lysis in the NMFH‐1 cell line at an MOI of 1 or 10.

Figure 4.

Figure 4

Inhibition of cell proliferation and induction of parallel apoptosis and autophagy in soft tissue sarcoma cell lines by telomelysin infection. (a) NMFH‐1, NMFH‐2, and NEPS cells were infected with telomelysin at the indicated MOI values and cell viability was quantitated by XTT assay at the indicated time points. Cell viability was calculated relative to that of mock‐infected cells on day 0, which had been assigned a value of 1.0. Points, means of quadruple experiments; bars, SD. (b,c) NMFH‐1, NMFH‐2, and NEPS cells were mock infected with PBS or infected with telomelysin at an MOI of 0.1 or 1 and harvested 72 h after infection. Equal amounts (50 μg/lane) of protein from cell lysates were then separated on SDS‐PAGE gels and induction of apoptosis or autophagy was determined by Western blot analysis. Expression of cleaved caspase‐3 and poly(ADP‐ribose) polymerase (PARP), markers of cell apoptosis, was detected with anti‐caspase‐3 and anti‐PARP antibodies, respectively (b). Expression of endogenous LC3B‐II, which directly correlates with autophagosome formation, was detected with anti‐LC3B antibody. The intensity of each protein band was quantified by densitometric scanning using NIH‐Image J software and normalized to that of the β‐actin signal. Representative densitometric LC3‐II/β‐actin ratios are shown underneath the blot (c). N, negative control; P, positive control.

Induction of apoptosis and autophagy in STS cells by telomelysin infection

To clarify the mechanism by which telomelysin efficiently exerts a cytotoxic effect in STS cell lines, apoptosis and autophagy were examined in the NMFH‐1, NMFH‐2, and NEPS cell lines at 72 h post infection. Western blot analysis carried out to detect activation (proteolytic cleavage) of caspase‐3 and PARP, regarded as specific markers for apoptosis,25, 26 revealed obvious dose‐dependent cleavage of caspase‐3 and PARP in the NMFH‐2 and NEPS cell lines after telomelysin infection (Fig. 4b). The TUNEL assay revealed a dose‐dependent increase in DNA fragmentation due to apoptosis in the NMFH‐2 and NEPS cell lines after telomelysin infection (Fig. 5), with the percentage of TUNEL‐positive cells reaching 13.4% and 26.1% at MOIs of 1 and 10, respectively, in NEPS cells and 5.56% and 14.7%, respectively, in NMFH‐2 cells (Fig. 5). Induction of apoptosis was further confirmed by observation of characteristic morphology during apoptosis, including cell shrinkage, membrane blebbing or blistering, and nuclear condensation and fragmentation (Fig. 5).

Figure 5.

Figure 5

Effects of inhibition of autophagosome formation and caspase activation on DNA fragmentation in telomelysin‐infected soft tissue sarcoma cells undergoing apoptosis. NEPS cells were pre‐incubated in either the presence or absence of autophagy inhibitor 3‐methyladenine (3‐MA; 2 mM) or pan‐caspase inhibitor Z‐Val‐Ala‐Asp‐CH2F (Z‐VAD; 40 μM) for 2 h before infection with telomelysin at an MOI of 1 or 10 or mock infection with PBS. Cells were harvested 72 h after treatment and stained using the DeadEnd Fluorometric TUNEL system. (a) DNA fragmentation of apoptotic STS cells was assessed using the FACScalibur flow cytometer to determine the number of TUNEL‐positive cells and the data collected were analyzed using BD Cellquest Pro software. DNase I treated cells were used as positive controls. The results of three independent representative measurements are plotted in the histogram shown. (b) TUNEL‐stained cells were counterstained with propidium iodide (PI) and representative images obtained by fluorescent microscopy. Light green fluorescence (white arrows) indicates TUNEL‐positive cells and red fluorescence indicates nuclear PI staining. Magnification, ×100; bars = 20 μm.

Among the isoforms LC3A, LC3B, and LC3C, only LC3B has been found to correlate with autophagy, with the level of LC3B‐II relative to actin or tubulin having been observed to directly correlate with autophagosome formation.27, 28 Based on these findings, LC3B‐I and LC3B‐II expression was examined to determine the involvement of autophagy in telomelysin‐induced cell death. As shown in Figure 4(c), Western blot analysis revealed increased levels of LC3B‐II/β‐actin in NMFH‐2 cells at an MOI of 1 (0.37) and in NEPS cells at MOIs of 0.1 (0.55) and MOI 1 (0.61) compared with their mock‐infected basal levels (0.26 and 0.32, respectively). The staining of LC3B‐I is diffusely cytoplasmic and that of LC3B‐II is punctuated.29 Immunofluorescence analysis carried out to examine autophagosome formation revealed that telomelysin infection had resulted in an increased number of LC3B‐II puncta in both the NEPS (Fig. S2) and NMFH‐2 cells (data not shown). Neither apoptosis nor autophagy was detected in the NMFH‐1 cell lines.

Changes in apoptosis and autophagy with 3‐MA or Z‐VAD‐FMK cotreatment in telomelysin‐infected STS cells

To examine the effects of inhibition of autophagosome formation and caspase activation on DNA fragmentation of apoptosis in telomelysin‐treated STS cells, NEPS and NMFH‐2 cells were treated with telomelysin alone at an MOI of 1 or 10 or cotreated with telomelysin and either the autophagosome inhibitor 3‐MA or the pan‐caspase inhibitor Z‐VAD‐FMK for 72 h. Compared to that of cells subjected to telomelysin‐alone treatment, the percentage of TUNEL‐positive cells significantly decreased (P < 0.01) to 2.54% and 9.58% of all cells at MOIs of 1 and 10, respectively, in the NEPS cells and to 2.12% and 2.39%, respectively, in the NMFH‐2 cells subjected to Z‐VAD‐FMK cotreatment (Figs 5,S3). In contrast, the percentage of TUNEL‐positive cells significantly increased (P < 0.01) to 18.0% and 34.5% at MOIs of 1 and 10, respectively, in the NEPS cells and to 7.39% and 16.8%, respectively, in the NMFH‐2 cells subjected to 3‐MA cotreatment compared to the cells subjected to telomelysin treatment alone (Figs 5,S3). Inhibition of telomelysin‐induced autophagy by 3‐MA cotreatment was found have induced a decrease in LC3B‐II expression levels to basal (mock treatment) levels while simultaneously markedly increasing expression levels of cleaved caspase‐3 and cleaved PARP (Fig. 6). Cotreatment with Z‐VAD‐FMK was also found to have decreased LC3B‐II expression levels to approximately basal levels (Fig. 6).

Figure 6.

Figure 6

Effects of 3‐methyladenine (3‐MA) and Z‐Val‐Ala‐Asp‐CH2F (Z‐VAD‐FMK) cotreatment on caspase activation or autophagosome formation in telomelysin‐infected soft tissue sarcoma cells. NEPS and NMFH‐2 cells were pre‐incubated in either the presence or absence of 3‐MA (2 mM) or Z‐VAD‐FMK (40 μM) for 2 h before infection with telomelysin at an MOI of 1 or mock infection with PBS. Cells were harvested 72 h after treatment for analysis of changes in cleaved caspase‐3, cleaved poly(ADP‐ribose) polymerase (PARP), and endogenous LC3B‐II expression levels by Western blot analysis. β‐actin was used as a loading control.

Changes in cell viability, architecture, and nuclear morphology by 3‐MA or Z‐VAD‐FMK cotreatment in telomelysin‐infected STS cells

The effect of cotreatment with 3‐MA or Z‐VAD‐FMK on the cell viability of STS cells was examined by cotreating NMFH‐2 and NEPS cells with telomelysin and either 3‐MA or Z‐VAD‐FMK, or with telomelysin alone, at the indicated times. Quantitation of cell viability by XTT assay revealed that telomelysin infection at an MOI of 1 had induced a time‐dependent, progressive loss of cell viability in both the NMFH‐2 and NEPS cells compared with mock‐treated cells. Cotreatment with 3‐MA was found to lead to further significant decreases in cell viability (P < 0.01) by inhibition of autophagy, with viability decreasing by 22–32% from days 3 to 5 in NMFH‐2 cells and by 23–77% from days 1 to 5 in NEPS cells subjected to 3‐MA cotreatment compared with cells subjected to telomelysin alone (14–21% in NMFH‐2 cells and 16–66% in NEPS cells; Fig. 7a). In contrast, cotreatment with caspase inhibitor Z‐VAD‐FMK was observed not to have prevented telomelysin‐induced cell death in either the NMFH‐2 or NEPS cells (Fig. 7b).

Figure 7.

Figure 7

Effects of 3‐methyladenine (3‐MA) and Z‐Val‐Ala‐Asp‐CH2F (Z‐VAD‐FMK) cotreatment on cell viability, architecture, and morphology in telomelysin‐treated soft tissue sarcoma cells. (a,b) NMFH‐2 and NEPS cells were pre‐incubated in either the presence or absence of 3‐MA (2 mM) (a) or Z‐VAD‐FMK (40 μM) (b) for 2 h before infection with telomelysin at an MOI of 1 or mock infection with PBS. Cell viability was examined by XTT assay at the indicated time points and calculated relative to that of mock‐infected cells on day 0, which had been assigned a value of 1.0. Points, means of quadruple experiments; bars, SD. Differences among groups were analyzed by the two‐tail paired sample t‐test. Asterisks indicate significant differences between telomelysin alone and either 3‐MA or Z‐VAD‐FMK cotreated cells at P < 0.01. (c,d) NMFH‐2 and NEPS cells were treated with telomelysin or cotreated with 3‐MA (2 mM) or Z‐VAD‐FMK (40 μM) for 72 h before cell morphology (c) and nuclear features (DAPI staining) (d) were observed under phase‐contrast and fluorescence microscopy, respectively. Arrow, typical apoptotic nuclear fragmentation; arrow head, atypical nuclear features. Scale bar = 20 μm (main images) or 5 μm (lower insets). Magnification, ×100 (main images) or ×200 (insets).

Examination of the effects of treatment with 3‐MA or Z‐VAD‐FMK alone at the same doses revealed that neither agent exerted cytotoxic effects on either cell line (Fig. 7a,b). Observation by phase‐contrast and fluorescence microscopy revealed no significant differences in cellular morphology (i.e., cell shrinkage, membrane blebbing, or membrane blistering) between the cells treated with telomelysin alone and those subjected to 3‐MA cotreatment (Fig. 7c, lanes 2 and 3). Nevertheless, the cells subjected to 3‐MA cotreatment showed less and more diffuse nuclear fragmentation (Fig. 7d, lane 3) compared to those treated with telomelysin alone, with the nuclei of some telomelysin‐treated cells observed to have become condensed and fragmented (Fig. 7d, lane 2, arrow) and others swollen and condensed but non‐fragmented (Fig. 7d, lane 2, arrowhead). The morphology of the NMFH‐2 and NEPS cells cotreated with Z‐VAD‐FMK appeared very different from that of the cells treated with telomelysin alone, displaying a more swollen and clustered morphology with non‐fragmented nuclei that were markedly enlarged, disintegrated, or condensed (Fig. 7c,d, lane 4), features typical of cells undergoing necrosis‐like cell death.30, 31, 32, 33

Levels of ATP in STS cells after telomelysin‐alone treatment or 3‐MA or Z‐VAD‐FMK cotreatment

Alteration in cellular ATP levels is known to play a crucial role in the transition from apoptosis to necrosis or vice versa.34, 35, 36 To evaluate whether necrosis‐like cell death is involved in telomelysin‐induced cell death, the cellular ATP level of NEPS and NMFH‐2 cells treated with telomelysin alone or with 10% EtOH, which served as a control for necrotic cell death, was examined using an ATP Colorimetric/Fluorometric Assay Kit (BioVision). As shown in Figure 8, the percentage of cellular total ATP depletion 48 h after telomelysin infection was found to be approximately 35% and 44% at MOIs of 1 and 10, respectively, in NEPS cells and 23% and 31%, respectively, in NMFH‐2 cells compared to mock‐treated cells. Nevertheless, the extent of total cellular ATP depletion was still found to be higher in telomelysin‐treated cells than EtOH‐treated cells, in which total cellular ATP was found to have been depleted by approximately by 43% in NEPS cells and 47% in NMFH‐2 cells compared to mock‐treated cells. Examination of the effects of 3‐MA or Z‐VAD‐FMK cotreatment on changes in cellular total ATP levels revealed that inhibition of autophagosome formation by 3‐MA cotreatment had significantly increased the total ATP level (P < 0.01) by 10% and 9% at MOIs of 1 and 10, respectively, in NEPS cells and by 7% and 10%, respectively, in NMFH‐2 cells compared to telomelysin‐alone treated cells. In contrast, inhibition of apoptosis by Z‐VAD‐FMK cotreatment was found to have significantly decreased the total ATP level (P < 0.01) by 14% and 11% at MOIs of 1 and 10, respectively, in NEPS cells and by 14% and 13%, respectively, in NMFH‐2 cells compared to telomelysin‐alone treated cells.

Figure 8.

Figure 8

Effects of 3‐methyladenine (3‐MA) and Z‐Val‐Ala‐Asp‐CH2F (Z‐VAD‐FMK) cotreatment on cellular ATP levels in telomelysin‐infected soft tissue sarcoma cells. NEPS cells were pre‐incubated in either the presence or absence of 3‐MA (2 mM) or Z‐VAD‐FMK (40 μM) for 2 h before infection with telomelysin at an MOI of 1 or 10 or mock infection with PBS. Cells were harvested 48 h after treatment and cellular total ATP levels analyzed using the ATP Colorimetric/Fluorometric Assay Kit. Cells treated with 10% ethanol were used as positive controls for cellular ATP depletion. Points, means of data collected from three independent experiments; bars, SD. Differences among groups were analyzed by the two‐tail paired sample t‐test. Asterisks indicate significant differences at P < 0.01.

Discussion

A high level of hTERT expression, which has been observed in various malignant tumors and cancer cell lines and found to be strongly correlated with telomerase activity,37 is crucial for telomelysin functioning. Moreover, the binding of an adenovirus to CAR, a cell surface receptor, has been observed to be a crucial step in adenoviral internalization that is closely correlated with infection efficiency.38 In the clinical field, Patel and Folpe39 examined the immunohistochemistry of hTERT in STS and found that hTERT was positive in >50% of osteosarcomas, malignant peripheral nerve sheath tumors, liposarcomas, and angiosarcomas. In accordance with these findings, all 11 of the human STS cell lines examined in this study were found to display detectable, albeit diverse, levels of hTERT mRNA expression, as well as diverse levels of CAR mRNA and protein expression. Assessment of the transcriptional activity of hTERT promoter and cell viability in three of the STS cell lines, the NMFH‐1 cell line, which shows low hTERT and low CAR expression, the NMFH‐2 line, which shows low hTERT and high CAR expression, and the NEPS line, which shows high hTERT and high CAR expression, after infection with telomelysin revealed marked dose‐ and time‐dependent increases in E1 gene/protein expression and viral replication in all three STS cell lines. However, a high level of cytotoxicity was found only in the NMFH‐1 cell line, with the MNFH‐2 and NEPS lines showing no clear cell cytotoxicity, even at high MOIs. The E1 mRNA/protein expression level of the NEPS cell line, which displays a high level of hTERT expression, was found to be significantly higher than that of the NMFH‐2 cell line, which displays a low level of hTERT expression, although the cell lines show similarly highly levels of CAR expression. In contrast, the E1 mRNA/protein expression level of the NMFH‐2 cell line, which displays a high level of CAR expression, was found to be significantly higher than that of the NMFH‐1 cell line, which displays a low level of CAR expression, although the cell lines show similarly low levels of hTERT expression. These findings suggest that CAR expression is closely correlated with the extent of initial internalization, whereas hTERT expression is closely correlated with the efficiency of viral replication; thus, both CAR and hTERT are important in telomelysin infection. Observation that a marked proportion of STS cells, including NMFH‐1 cells, displayed undetectable or low levels of CAR expression supports this suggestion, and indicates that treatment of STS tumors may benefit from use of fiber‐modified telomelysin‐RGD (OBP‐405), as has been described previously.40

The precise mechanism underlying telomelysin‐mediated cell death in human cancer cells remains unclear. Previous studies have noted that telomelysin infection does not induce apoptotic cell death in human lung cancer cells or autophagic cell death in human glioma cells.17, 41 However, in a recent study, we observed distinct apoptotic cell death in human osteosarcomas.11 Examination of the involvement of apoptotic cell death in three STS cell lines in this study revealed that telomelysin treatment could induce observable dose‐dependent apoptosis, as evidenced by observation of activated caspase cascading, TUNEL‐positive cell production, cell shrinkage, membrane blistering, and nuclear condensation and fragmentation in two of the three STS cell lines (NMFH‐2 and NEPS) with high CAR expression, whose levels of apoptosis were found to be positively correlated with the extent of hTERT expression and viral replication.

Autophagy is an important process in maintaining cellular homeostasis and providing protection against adverse environments, such as bacterial and viral infection.42 Although some research has indicated that the induction of autophagy to greater than basal levels may be associated with the activation of programmed cell death,29, 43 other research has suggested that autophagy promotes survival against apoptotic cell death.44, 45 In this study, telomelysin infection was found to not only induce apoptosis but also simultaneously increase the extent of autophagy, as evidenced by observation of an increased number of LC3B‐II/β‐actin and autophagosome puncta in the NEPS and NMFH‐2 cell lines. Examination of cotreatment of STS cells with telomelysin and 3‐MA, an inhibitor of telomelysin‐induced autophagy, to clarify whether the increase in autophagy was the result of a cell death protective or cell death promoting process, revealed that 3‐MA cotreatment significantly increases both apoptosis and cell viability compared to treatment with telomelysin alone. These results provide evidence that autophagy serves as a survival pathway against apoptotic cell death in STS cells that are infected with telomelysin, and thus provide evidence of the benefits of using combination oncolytic‐adenovirus–autophagy‐inhibitor cotherapy to enhance apoptotic cell death in the treatment of human cancers.

The results of cell viability assay, which revealed that fewer cells had become apoptotic (TUNEL positive) than had experienced total cell death, in telomelysin infected STS cells suggest that telomelysin‐induced cell death may occur through both an apoptotic and a non‐apoptotic pathway. During necrotic cell death, a type of non‐apoptotic cell death, cells show a relatively diverse range of morphological characteristics while dying, commonly a swollen and clustered phenotype and enlarged, disintegrated, or condensed non‐fragmented nuclei.30, 31, 32, 33 In the present study, cells that experienced telomelysin‐induced cell death were observed to have a mixed phenotype of apoptosis and atypical cell death resembling the features of necrotic cell death. Furthermore, inhibition of telomelysin‐induced apoptosis by Z‐VAD‐FMK cotreatment was not found to significantly affect cell viability but was found to lead most dead cells to assume the morphology of a necrotic cell phenotype, as described previously.

As necrotic cell death is often associated with cellular ATP depletion,34, 35, 36 total cellular ATP levels in STS cells treated with telomelysin alone or cotreated with 3‐MA or Z‐VAD‐FMK were examined to determine the extent of cell death. Whereas telomelysin‐alone treatment was found to have significantly depleted ATP levels compared to mock (control) treatment, 3‐MA cotreatment was found to have significantly recovered these depleted ATP levels by facilitating an increase in the ratio of apoptosis. In contrast, Z‐VAD‐FMK cotreatment was found to have significantly depleted ATP levels compared to both mock treatment and telomelysin‐alone treatment. The changes in morphology and ATP level that occur with Z‐VAD‐FMK cotreatment have been posited to be due to enhanced production of infectious adenovirus and attenuated virus release after caspase inhibition by Z‐VAD‐FMK.46 These processes result in severe cellular stress, ATP depletion, and disruption in the balance between apoptotic and non‐apoptotic cell death, which triggers non‐apoptotic necrosis‐like cell death in STS cells.

Necrotic cell death, in turn, triggers early leakage of cellular contents, resulting in massive tissue inflammation in an immune‐competent host.47 In contrast, apoptosis triggers cell elimination without inflammation. Thus, apoptotic cell death may be the preferred means of cell death, and its promotion by autophagy inhibitors, such as 3‐MA, may be an attractive therapeutic approach to oncolytic adenovirus infection. In this respect, if tumor cells have necrotic cell death programs other than an apoptotic program, activation of such programs using Z‐VAD‐FMK treatment could be a promising therapeutic strategy that complements apoptosis‐based therapies. However, a challenge in using this approach that must be considered is that cancer cells often develop resistance to apoptotic stimuli.48 Supportive mechanisms of induction of STS cell death by telomelysin are summarized in Table 1.

Table 1.

Supportive mechanisms of induction of cell death in soft tissue sarcoma cells by telomelysin

Apoptosisa Autophagyb Necrosisc
Telomelysin Induced Induced n.a.
+3‐MA Induced Reduced n.a.
+Z‐VAD‐FMK Reduced Reduced Induced
a

Activation (proteolytic cleavage) of caspase‐3 and poly(ADP‐ribose)polymerase, and increase in DNA fragmentation.

b

Increased level of LC3B‐II/β‐actin.

c

Swollen and clustered morphology, and cellular ATP depletion.

3‐MA, 3‐methyladenine; n.a., not available; Z‐VAD‐FMK,Z‐Val‐Ala‐Asp‐CH2F.

In summary, this study found that telomelysin treatment induces potent antitumor effects in CAR‐ and hTERT‐positive STS cells through both an apoptotic and a non‐apoptotic cell death pathway. Thus, cotreatment consisting of telomelysin combined with an autophagy or apoptosis inhibitor based on different cell environments may be a promising strategy for treatment of human STS tumors.

Disclosure Statement

The authors have no conflict of interest.

Abbreviations

3‐MA

3‐methyladenine

CAR

coxsackie and adenovirus receptor

CRAds

conditionally replicating oncolytic adenoviral agents

E1A

type 5 adenovirus early‐region 1A

E1B

type 5 adenovirus early‐region 1B

hTERT

human telomerase reverse transcriptase

LC3B

light chain 3B

MFH

malignant fibrous histocytoma

PARP

poly(ADP‐ribose) polymerase

STS

soft tissue sarcoma

Z‐VAD‐FMK

Z‐Val‐Ala‐Asp‐CH2F

Supporting information

Fig. S1. Cytotoxic effect of telomelysin on soft tissue sarcoma cells.

Fig. S2. Immunofluorescent images of telomelysin‐induced autophagy in NEPS soft tissue sarcoma cells.

Fig. S3. Effects of 3‐methyladenine (3‐MA) and Z‐Val‐Ala‐Asp‐CH2F (Z‐VAD‐FMK) cotreatment on telomelysin‐induced soft tissue sarcoma cell apoptosis.

Acknowledgments

We thank Keiko Tanaka (Division of Orthopedic Surgery, Niigata University Graduate School of Medical and Dental Sciences, Niigata, Japan) for his helpful assistance with the quantitative real‐time RT‐PCR and Western blotting assays. This work was supported partly by JSPS KAKENHI Grant No. 22689040.

(Cancer Sci, doi: 10.1111/cas.12208, 2013)

References

  • 1. Siegel R, Naishadham D, Jemal A. Cancer statistics. CA Cancer J Clin 2012; 62: 10–29. [DOI] [PubMed] [Google Scholar]
  • 2. Clark MA, Fisher C, Judson I, Thomas JM. Soft‐tissue sarcomas in adults. N Engl J Med 2005; 353: 701–11. [DOI] [PubMed] [Google Scholar]
  • 3. Matushansky I, Taub RN. Adjuvant chemotherapy in 2011 for patients with soft‐tissue sarcoma. Nat Rev Clin Oncol 2011; 8: 434–8. [DOI] [PubMed] [Google Scholar]
  • 4. Patrikidou A, Domont J, Cioffi A, Le Cesne A. Treating soft tissue sarcomas with adjuvant chemotherapy. Curr Treat Options Oncol 2011; 12: 21–31. [DOI] [PubMed] [Google Scholar]
  • 5. Hawkins LK, Lemoine NR, Kirn D. Oncolytic biotherapy: a novel therapeutic platform. Lancet Oncol 2002; 3: 17–26. [DOI] [PubMed] [Google Scholar]
  • 6. Chiocca EA. Oncolytic viruses. Nat Rev Cancer 2002; 2: 938–50. [DOI] [PubMed] [Google Scholar]
  • 7. Nemunaitis J, Khuri F, Ganly I et al Phase II trial of intratumoral administration of ONYX‐015, a replication‐selective adenovirus, in patients with refractory head and neck cancer. J Clin Oncol 2001; 19: 289–98. [DOI] [PubMed] [Google Scholar]
  • 8. Reid T, Galanis E, Abbruzzese J et al Hepatic arterial infusion of a replication‐selective oncolytic adenovirus (dl1520): phase II viral, immunologic, and clinical endpoints. Cancer Res 2001; 62: 6070–9. [PubMed] [Google Scholar]
  • 9. Hamid O, Varterasian ML, Wadler S et al Phase II trial of intravenous CI‐1042 in patients with metastatic colorectal cancer. J Clin Oncol 2003; 21: 1498–504. [DOI] [PubMed] [Google Scholar]
  • 10. Kim NW, Piatyszek MA, Prowse KR et al Specific association of human telomerase activity with immortal cells and cancer. Science 1994; 266: 2011–5. [DOI] [PubMed] [Google Scholar]
  • 11. Li G, Kawashima H, Ogose A et al Efficient virotherapy for osteosarcoma by telomerase‐specific oncolytic adenovirus. J Cancer Res Clin Oncol 2011; 137: 1037–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Wirth T, Zender L., Schulte B. et al A telomerase‐dependent conditionally replicating adenovirus for selective treatment of cancer. Cancer Res 2003; 63: 3181–8. [PubMed] [Google Scholar]
  • 13. Nemunaitis J, Tong AW, Nemunaitis M et al A phase I study of telomerase‐specific replication competent oncolytic adenovirus (telomelysin) for various solid tumors. Mol Ther 2010; 18: 429–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Umeoka T, Kawashima T, Kagawa S et al Visualization of intrathoracically disseminated solid tumors in mice with optical imaging by telomerase‐specific amplification of a transferred green fluorescent protein gene. Cancer Res 2004; 64: 6259–65. [DOI] [PubMed] [Google Scholar]
  • 15. Fujiwara T, Kagawa S, Kishimoto H et al Enhanced antitumor efficacy of telomerase‐selective oncolytic adenoviral agent OBP‐401 with docetaxel: preclinical evaluation of chemovirotherapy. Int J Cancer 2006; 119: 432–40. [DOI] [PubMed] [Google Scholar]
  • 16. Kishimoto H, Kojima T, Watanabe Y et al In vivo imaging of lymph node metastasis with telomerase‐specific replication‐selective adenovirus. Nat Med 2006; 12: 1213–9. [DOI] [PubMed] [Google Scholar]
  • 17. Kawashima T, Kagawa S, Kobayashi N et al Telomerase‐specific replication‐selective virotherapy for human cancer. Clin Cancer Res 2004; 10: 285–92. [DOI] [PubMed] [Google Scholar]
  • 18. Watanabe T, Hioki M, Fujiwara T et al Histone deacetylase inhibitor FR901228 enhances the antitumor effect of telomerase‐specific replication‐selective adenoviral agent OBP‐301 in human lung cancer cells. Exp Cell Res 2006; 312: 256–65. [DOI] [PubMed] [Google Scholar]
  • 19. Hashimoto Y, Watanabe Y, Shirakiya Y et al Establishment of biological and pharmacokinetic assays of telomerase‐specific replication‐selective adenovirus. Cancer Sci 2008; 99: 385–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Takakura M, Nakamura M, Kyo S et al Intraperitoneal administration of telomerase‐specific oncolytic adenovirus sensitizes ovarian cancer cells to cisplatin and affects survival in a xenograft model with peritoneal dissemination. Cancer Gene Ther 2010; 17: 11–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Gu W, Ogose A, Kawashima H et al High‐level expression of the coxsackievirus and adenovirus receptor messenger RNA in osteosarcoma, Ewing's sarcoma, and benign neurogenic tumors among musculoskeletal tumors. Clin Cancer Res 2004; 10: 3831–8. [DOI] [PubMed] [Google Scholar]
  • 22. Bergelson JM, Cunningham JA, Droguett G et al Finberg, Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 1997; 275: 1320–3. [DOI] [PubMed] [Google Scholar]
  • 23. Wuchter C, Ruppert V, Schrappe M, Dörken B, Ludwig WD, Karawajew L. In vitro susceptibility to dexamethasone‐ and doxorubicin‐induced apoptotic cell death in context of maturation stage, responsiveness to interleukin 7, and early cytoreduction in vivo in childhood T‐cell acute lymphoblastic leukemia. Blood 2002; 99: 4109–15. [DOI] [PubMed] [Google Scholar]
  • 24. Wang SM, Wu R. The double danger of ethanol and hypoxia: their effects on a hepatoma cell line. Int J Clin Exp Pathol 2009; 2: 182–9. [PMC free article] [PubMed] [Google Scholar]
  • 25. Fernandes‐Alnemri T, Litwack G, Alnemri ES. CPP32, a novel human apoptotic protein with homology to Caenorhabditis elegans cell death protein Ced‐3 and mammalian interleukin‐1 beta‐converting enzyme. J Biol Chem 1994; 269: 30761–4. [PubMed] [Google Scholar]
  • 26. Oliver FJ, de la Rubia G, Rolli V, Ruiz‐Ruiz MC, de Murcia G, Murcia JM. Importance of poly(ADP‐ribose) polymerase and its cleavage in apoptosis. Lesson from an uncleavable mutant. J Biol Chem 1998; 273: 33533–9. [DOI] [PubMed] [Google Scholar]
  • 27. Vergne I, Roberts E, Elmaoued RA et al Deretic, Control of autophagy initiation by phosphoinositide 3‐phosphatase Jumpy. EMBO J 2009; 28: 2244–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Barth S, Glick D, Macleod KF. Autophagy: assays and artifacts. J Pathol 2010; 221: 117–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Kabeya Y, Mizushima M, Ueno T et al LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 2000; 19: 5720–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Bell SE, Quinn DM, Kellett GL, Warr JR. 2‐Deoxy‐D‐glucose preferentially kills multidrug‐resistant human KB carcinoma cell lines by apoptosis. Br J Cancer 1998; 78: 1464–70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Koyama AH, Irie H, Ueno F, Ogawa M, Nomoto A, Adachi A. Suppression of apoptotic and necrotic cell death by poliovirus. J Gen Virol 2001; 82: 2965–72. [DOI] [PubMed] [Google Scholar]
  • 32. Los M, Mozoluk M, Ferrari D et al Activation and caspase‐mediated inhibition of PARP: a molecular switch between fibroblast necrosis and apoptosis in death receptor signaling. Mol Biol Cell 2002; 13: 978–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Hamahata K, Adachi S, Matsubara H et al Mitochondrial dysfunction is related to necrosis‐like programmed cell death induced by A23187 in CEM cells. Eur J Pharmacol 2005; 516: 187–96. [DOI] [PubMed] [Google Scholar]
  • 34. Richter C, Schweizer M, Cossarizza A, Franceschi C. Control of apoptosis by the cellular ATP level. FEBS Lett 1996; 378: 107–10. [DOI] [PubMed] [Google Scholar]
  • 35. Leist M, Single B, Castoldi AF, Kuhnle S, Nicotera P. Intracellular adenosine triphosphate (ATP) concentration: a switch in the decision between apoptosis and necrosis. J Exp Med 1997; 185: 1481–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. van der Toorn M, Slebos DJ, de Bruin HG et al Cigarette smoke‐induced blockade of the mitochondrial respiratory chain switches lung epithelial cell apoptosis into necrosis. Am J Physiol Lung Cell Mol Physiol 2007; 292: L1211–8. [DOI] [PubMed] [Google Scholar]
  • 37. Takakura M, Kyo S, Kanya T et al Cloning of human telomerase catalytic subunit (hTERT) gene for transcriptional activation in immortalized and cancer cells. Cancer Res 1999; 59: 551–7. [PubMed] [Google Scholar]
  • 38. Begelson JM. Receptors mediating adenovirus attachment and internalization. Biochem Pharmacol 1999; 57: 975–9. [DOI] [PubMed] [Google Scholar]
  • 39. Patel RM, Folpe AL. Immunohistochemistry for human telomerase reverse transcriptase catalytic subunit (hTERT): a study of 143 benign and malignant soft tissue and bone tumours. Pathology 2009; 41: 527–32. [DOI] [PubMed] [Google Scholar]
  • 40. Taki M, Kagawa S, Nishizaki M et al Enhanced oncolysis by a tropism‐modified telomerase‐specific replication‐selective adenoviral agent OBP‐405 (‘Telomelysin‐RGD’). Oncogene 2005; 24: 3130–40. [DOI] [PubMed] [Google Scholar]
  • 41. Yokoyama T, Iwado E, Kondo Y et al Autophagy‐inducing agents augment the antitumor effect of telomerase‐selective oncolytic adenovirus OBP‐405 on glioblastoma cells. Gene Ther 2008; 15: 1233–9. [DOI] [PubMed] [Google Scholar]
  • 42. He C, Klionsky DJ. Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet 2009; 43: 67–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Berry DL, Baehrecke DH. Autophagy functions in programmed cell death. Autophagy 2008; 4: 359–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Amaravadi RK, Yu D, Lum JJ et al Autophagy inhibition enhances therapy‐induced apoptosis in a Myc‐induced model of lymphoma. J Clin Invest 2007; 117: 326–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Nakamura O, Hitora T, Akisue T, Kawamoto T, Yamagami Y, Yamamoto T. Inhibition of induced autophagy increases apoptosis of Nara‐H cells. Int J Oncol 2011; 39: 1545–52. [DOI] [PubMed] [Google Scholar]
  • 46. Chiou SK, White E. Inhibition of ICE‐like proteases inhibits apoptosis and increases virus production during adenovirus infection. Virology 1998; 244: 108–18. [DOI] [PubMed] [Google Scholar]
  • 47. Grivennikov SI, Greten FR, Karin M. Immunity, inflammation, and cancer. Cell 2010; 140: 883–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Fisher DE. Apoptosis in cancer therapy: crossing the threshold. Cell 1994; 78: 539–42. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1. Cytotoxic effect of telomelysin on soft tissue sarcoma cells.

Fig. S2. Immunofluorescent images of telomelysin‐induced autophagy in NEPS soft tissue sarcoma cells.

Fig. S3. Effects of 3‐methyladenine (3‐MA) and Z‐Val‐Ala‐Asp‐CH2F (Z‐VAD‐FMK) cotreatment on telomelysin‐induced soft tissue sarcoma cell apoptosis.


Articles from Cancer Science are provided here courtesy of Wiley

RESOURCES