Skip to main content
Cancer Science logoLink to Cancer Science
. 2013 Mar 29;104(6):663–671. doi: 10.1111/cas.12134

Klotho suppresses tumor progression via inhibiting PI3K/Akt/GSK3β/Snail signaling in renal cell carcinoma

Yu Zhu 1,†, Le Xu 1,†, Jianping Zhang 1, Wenping Xu 1, Yujun Liu 1, Hankun Yin 1, Tao Lv 1, Huimin An 1, Li Liu 1, Hongyong He 2, Heng Zhang 2, Jing Liu 5, Jiejie Xu 3,4,✉, Zongming Lin 1,✉
PMCID: PMC7657207  PMID: 23433103

Abstract

Klotho is an anti‐aging protein predominantly expressed in renal tubular epithelial cells. Although Klotho was recently identified as a tumor suppressor gene in a variety of cancers, the potential role and molecular events for Klotho in renal cell carcinoma (RCC) remain obscure. In the present study, immunohistochemical staining in tissue microarrays containing 125 RCC samples showed that intratumoral Klotho levels were negatively correlated with tumor size, TNM stage and nuclear grade. The overall survival rate of RCC patients with high Klotho expression was significantly higher than that of patients with low Klotho expression. Functional analysis after gain and loss of Klotho expression revealed that Klotho blunted epithelial‐mesenchymal transition and cellular migration and invasion in RCC. Also, no alteration of α‐2,6‐sialidase activity was found after Klotho overexpression in RCC. The molecular signals for this phenomenon involved the Klotho‐mediated inhibition of PI3K/Akt/GSK3β/Snail pathway. Importantly, compared to localized RCC tissues, advanced RCC tissues exhibited low Klotho expression accompanied with high pAkt and Snail expression. These results indicate Klotho acts as a tumor suppressor by inhibiting PI3K/Akt/GSK3β/Snail signaling, thus suppressing epithelial‐mesenchymal transition and tumor migration and invasion during RCC progression. As a result, Klotho might be used as a potential therapy for advanced RCC.


Renal cell carcinoma (RCC) is the most common type of kidney cancer. It is the third most frequent malignancy within urological oncology, accounting for 2–3% of all cancers worldwide.1 Although early detection approaches are available for localized RCC, approximately 25–30% of patients have undiagnosed with metastatic diseases.2 Partial and radical nephrectomies remain the gold standard in treatment for localized RCC, and cytoreductive nephrectomy is often recommended before systemic treatment targeting invasiveness reduction and renal function preservation for metastatic diseases.3 Nevertheless, 20–40% of RCC patients will relapse after resection depending on the tumor stage and grade.4 Metastatic RCC (mRCC), which is uniquely resistant to chemotherapy and radiotherapy, has only a 26% 5‐year survival.5 The therapeutic effectiveness of immunotherapy and anti‐angiogenic intervention is still controversial.6 Moreover, present systemic therapies show limited overall survival benefit concomitant with substantial toxicities. Thus, explorations of molecular pathways for RCC tumorigenesis are likely to expand therapeutic options for mRCC.

Klotho is an aging suppressor gene that has been shown to extend lifespan when overexpressed in mice.7 Genetic ablation of the Klotho gene in mice leads to a syndrome closely resembling human aging that involves a shortened lifespan, growth arrest, premature thymic involution, arterial calcification, osteoporosis and emphysema.7, 8, 9 The Klotho gene encodes a single‐pass transmembrane protein of ~135 kDa expressed predominantly in distal renal tubular epithelial cells and shared amino acid sequence homology with family 1 glycosidases.10, 11 The extracellular domain could be cleaved and secreted into the blood, urine, and cerebrospinal fluid, thus comprising membranous form and secreted form of Klotho.12 In the kidney, membranous Klotho functions as a co‐receptor and relays signaling for fibroblast growth factor 23 (FGF23), an endocrine hormone that lowers blood phosphate and vitamin D levels.13, 14 The secreted Klotho can act as α‐2,6‐sialidase and become involved in the regulating activities of multiple ion channels at the cell surface.10, 15 Although the tumor suppressive function of Klotho has been indicated in breast cancer,16 pancreatic cancer,17 and melanoma,18 the functional roles and molecular events for Klotho in RCC remain poorly understood.

Epithelial‐mesenchymal transition (EMT) is the process by which polarized epithelial cells undergo multiple biochemical changes and convert into motile mesenchymal cells that perform with migratory capacity, invasiveness and elevated resistance to apoptosis.19, 20 This dramatic phenotype switch has emerged as a recognized mechanism for initiating RCC invasion and metastasis.21, 22 Moreover, Klotho suppresses transforming growth factors‐β1‐induced EMT responses in renal fibrosis and cancer metastasis in mice.11

In this study, we examined whether Klotho could suppress RCC invasion and metastasis through EMT inhibition. Intratumoral Klotho levels were inversely correlated with tumor size, stage, nuclear grade, and overall survival in RCC patients. Moreover, Klotho expression could blunt RCC migration and invasion by repressing EMT mediated by PI3K/Akt/GSK3β/Snail signal activation in vitro and in vivo. These data identify the potential tumor suppressive role of Klotho in RCC tumorigenesis and open a new avenue for therapeutic intervention with Klotho protein administration for mRCC patients.

Materials and Methods

Cell lines and human samples

Four human RCC cell lines 786‐O, OS‐RC‐2, ACHN, Caki‐1 and one murine RCC cell line, Renca, were obtained from the Shanghai Cell Bank (Shanghai, China). One human renal proximal tubular epithelial cell line, HKC, was provided by Dr Donghai Wen (Fudan University, Shanghai, China). Cells were cultured in DMEM or RPMI 1640 supplemented with 10% FBS at 37°C in a humidified 5% CO2 incubator. These cell lines have been characterized at the bank by DNA fingerprinting analysis using short tandem repeat markers. Information on human RCC tissues is described in detail in the Supporting Information.

Plasmids construction

The plasmid containing full‐length Klotho (pcDNA3.1/V5‐His‐TOPO‐Klotho) was kindly provided by Dr Ci‐Di Chen (Boston University School of Medicine, Boston, MA, USA). The Snail WT and Snail (8SA) constitutively active plasmids were kindly provided by Dr Mien‐Chie Hung (MD Anderson Cancer Center, Houston, TX, USA). All constructs were confirmed by DNA sequencing.

Plasmid transfection and RNA interference

Transient and stable transfections with various plasmids and corresponding empty vectors as control were performed as before.23 These are described in detail in the Supporting Information. The shRNA against Klotho gene, Klotho shRNA (h), and control shRNA (h) lentiviral particles (Santa Cruz Biotechnology, Santa Cruz, CA, USA) were used for RNA interference as described previously.24 The gene‐silencing effect was confirmed by Western blot and RT‐PCR at 72 h post‐transfection.

Western blot and qRT‐PCR

Western blot and qRT‐PCR were carried out as previously described.25 Primary antibodies used in Western blot included those against Klotho (Abcam, Cambridge, MA, USA), E‐cadherin, N‐cadherin, vimentin, GAPDH (Santa Cruz Biotechnology), and pAkt, Akt, pGSK3β, GSK3β, Snail (Cell Signaling Technologies, Beverly, MA, USA). The PCR primers used in qRT‐PCR were as follows: Klotho (5′‐ACTCCCCCAGTCAGGTGGCGGTA‐3′ and 5′‐ TGGGCCC GGGAAACCATTGCTGTC‐3′) and GAPDH (5′‐CGCGGGG CTCTCCAGAACATCATCC‐3′ and 5′‐CTCCGACGCCTGCT TCACCACCTTCTT‐3′).

Immunofluorescence, wound healing assay, cell migration assay, cell invasion assay, lectin blot, and flow cytometry analysis

All abovementioned experiments were performed as before or according to the manufacturer's instructions.26 Details are described in the Supporting Information.

Immunohistochemistry staining and evaluation

Tumor sections from patients with RCC were immunohistochemically analyzed as before and are described in detail in the Supporting Information.27 Primary antibodies against Klotho (Abcam), pAkt, Snail (Cell Signaling Technologies) were used in the procedure.

Statistical analyses

Experimental data were presented as mean ± SD or SEM using GraphPad Prism 5 (GraphPad Software, La Jolla, CA, USA). Values and percentages between groups were compared using Student's t‐test and χ2 test, respectively. Survival was calculated from the date of surgery to date of death or last follow‐up. Survival curves and univariate analysis were estimated using the Kaplan–Meier method and the log‐rank test. Those parameters demonstrated a statistically significant effect on overall survival in the univariate analysis were included in a Cox multivariate proportional hazards regression model. P < 0.05 was considered statistically significant.

Results

Intratumoral Klotho levels correlate with RCC progression and prognosis

To explore the clinical significance of Klotho in RCC patients, we analyzed Klotho levels in a cohort of 125 RCC specimens with immunohistochemical staining. Klotho staining, located predominantly on cell surfaces and in cytoplasm, was much lower in tumor tissues compared with surrounding non‐tumor tissues (Fig. 1a). Additionally, intratumoral Klotho levels declined gradually with disease progression from TNM stage I to IV (Fig. 1b). As shown in Table 1, low intratumoral Klotho levels strongly correlated with primary tumor size (P < 0.001), tumor thrombus (P = 0.005), primary tumor classification (P < 0.001), regional lymph node involvement (P = 0.011), distant metastasis (P = 0.005), TNM stage grouping (P < 0.001), and nuclear grade (P < 0.001). Univariate analysis revealed that age at surgery (P = 0.024), primary tumor size (P < 0.001), tumor thrombus (P < 0.001), primary tumor classification (P < 0.001), regional lymph node involvement (P < 0.001), distant metastasis (P < 0.001), TNM stage group (P < 0.001), nuclear grade (P < 0.001), and Klotho expression (P < 0.001) all significantly influenced overall survival (Table 2). More importantly, the overall survival of RCC patients with low intratumoral Klotho expression was significantly poorer than those patients with high intratumoral Klotho expression (P < 0.001) (Fig. 1c). Furthermore, Cox multivariate regression analysis suggested that Klotho expression (P = 0.022), primary tumor size (P = 0.044) and nuclear grade (P = 0.022) are independent prognostic factors in RCC patients. These data indicate that low intratumoral Klotho expression represents a novel marker for RCC progression and poor prognosis.

Figure 1.

Figure 1

Klotho declination correlates with RCC progression and poor prognosis. (a) Representative immunohistochemical staining with high Klotho expression in surrounding non‐tumor tissues (left) and low Klotho expression in tumor tissues (right) of 125 RCC specimens. Scale bars, 50.0 μm. (b) Representative immunohistochemical staining with Klotho gradual declination during RCC progression from TNM stage I to IV. Scale bars, 50.0 μm. (c) Kaplan–Meier survival analysis between RCC patients with high Klotho expression (n = 69) and low Klotho expression (n = 56) from a cohort of 125 samples. RCC, renal cell carcinoma.

Table 1.

Clinicopathological features of the 125 clear cell renal cell carcinoma patients and their correlations with Klotho expression

Characteristics No. of patients (%) Klotho expression P‐valuea
Low (n = 56) High (n = 69)
Age at surgery, years 0.687
<65 65 (52.0) 28 37
≥65 60 (48.0) 28 32
Sex 0.445
Men 78 (62.4) 37 41
Women 47 (37.6) 19 28
WHO performance status 0.318
0 53 (73.6) 21 32
≥1 72 (26.4) 35 37
Primary tumor size, cm <0.001
<7 89 (71.2) 27 62
≥7 36 (28.8) 29 7
Tumor thrombus 0.005
None 119 (95.2) 50 69
Level 0–IV 6 (4.8) 6 0
Primary tumor classification <0.001
T1 + T2 99 (79.2) 31 68
T3 + T4 26 (20.8) 25 1
Regional lymph node involvement 0.011
NX + N0 120 (96.0) 51 69
N1 + N2 5 (4.0) 5 0
Distant metastasis 0.005
M0 119 (95.2) 50 69
M1 6 (4.8) 6 0
TNM stage <0.001
I + II 96 (76.8) 28 68
III + IV 29 (23.2) 28 1
Nuclear grade <0.001
1 + 2 93 (74.4) 26 66
3 + 4 32 (25.6) 30 3
a

χ 2 test.

Table 2.

Univariate and multivariate analyses of overall survival in patients with clear cell renal cell carcinoma (n = 125)

Characteristic Overall survival
Univariate Multivariate
HR (95% CI) P‐value* HR (95% CI) P‐value**
Age at surgery, years (<65 vs ≥65) 1.950 (1.077–3.531) 0.024 1.766 (0.959–3.252) 0.068
Sex (men vs women) 0.659 (0.351–1.237) 0.194 NA NA
WHO performance status (0 vs ≥1) 1.678 (0.904–3.113) 0.101 NA NA
Primary tumor size, cm (<7 vs ≥7) 5.080 (2.763–9.342) <0.001 2.079 (1.021–4.232) 0.044
Tumor thrombus (None vs Level 0–IV) 10.447 (3.769–28.956) <0.001 NA NA
Primary tumor classification (T1 + T2 vs T3 + T4) 5.260 (2.843–9.732) <0.001 NA NA
Regional lymph node involvement (NX + N0 vs N1 + N2) 8.202 (2.817–23.885) <0.001 NA NA
Distant metastasis (M0 vs M1) 9.883 (3.234–30.205) <0.001 NA NA
TNM stage (I + II vs III + IV) 5.589 (3.184–10.781) <0.001 0.518 (0.133–2.014) 0.342
Nuclear grade (1 + 2 vs 3 + 4) 6.929 (3.751–12.800) <0.001 4.882 (1.261–18.902) 0.022
Klotho expression (low vs high) 0.202 (0.106–0.382) <0.001 0.386 (0.171–0.870) 0.022

95% CI, 95% confidence interval; HR, hazard ratio; NA, not applicable. *Log‐rank test; **Cox regression model.

Klotho expression suppresses RCC cellular migration and invasion

To elucidate the functional relevance of Klotho in RCC progression, we performed functional analysis in RCC cells after Klotho expression or treatment. As shown in Figure 2(a–c), RCC cells, including 786‐O, OS‐RC‐2, ACHN, Caki‐1 and Renca, exhibit lower protein and mRNA levels of Klotho compared with the renal proximal tubular epithelial cell HKC. We next evaluated the effect of Klotho on RCC cellular EMT, a fundamental step of tumor invasion and metastasis. We found that RCC cells with Klotho overexpression or recombinant Klotho (rKlotho, 250 ng/mL) administration displayed increased expression of the epithelial marker E‐cadherin and decreased levels of the mesenchymal markers N‐cadherin and vimentin (Fig. 2d). Moreover, an in vitro scratch wound healing assay, a transwell cell migration assay, and a collagen‐based cell invasion assay showed that RCC cells with Klotho overexpression or rKlotho administration had decreased cell migratory and invasive capabilities (Fig. 2e–g). These results collectively suggest that Klotho expression blunts RCC cellular migration and invasion in vitro.

Figure 2.

Figure 2

Klotho expression suppresses RCC cellular EMT phenotype. (a) Western blot analysis and (b) qRT‐PCR analysis of Klotho relative to GAPDH for HKC, 786‐O, OS‐RC‐2, ACHN, Caki‐1 and Renca cells. (c) Immunofluorescence staining of Klotho in HKC, 786‐O, OS‐RC‐2, ACHN, and Renca cells. (d) Western blot analysis of an epithelial marker (E‐cadherin), mesenchymal markers (N‐cadherin, vimentin), and Klotho relative to GAPDH in 786‐O, OS‐RC‐2 and ACHN cells after Klotho overexpression (left) or rKlotho (250 ng/mL) administration (right). (e) In vitro scratch wound healing assay, (f) transwell cell migration assay, and (g) collagen‐based cell invasion assay for 786‐O and OS‐RC‐2 cells after Klotho overexpression and OS‐RC‐2 cells after rKlotho (250 ng/mL) administration. *P < 0.05. Con, control; EMT, epithelial‐mesenchymal transition; OD, optical density; RCC, renal cell carcinoma; rKlotho, recombinant Klotho.

Klotho ablation improves RCC cellular migration and invasion

To further confirm the crucial role of Klotho in RCC cellular EMT, we examined functional alterations in ACHN cells, which have relatively high intrinsic Klotho levels, after shRNA‐mediated Klotho ablation. Consistent with the results in RCC cells undergoing Klotho overexpression or rKlotho administration, ACHN cells with Klotho ablation displayed decreased expression of the epithelial marker E‐cadherin and increased levels of the mesenchymal markers N‐cadherin and vimentin (Fig. 3a). Additionally, an in vitro scratch wound healing assay, a transwell cell migration assay, and a collagen‐based cell invasion assay showed that ACHN cells with Klotho knockdown had increased cell migratory and invasive capabilities (Fig. 3b–d). These data suggest that Klotho ablation accelerates RCC cellular migration and invasion in vitro.

Figure 3.

Figure 3

Klotho ablation induces RCC cellular EMT phenotype. (a) Western blot analysis of E‐cadherin, N‐cadherin, Vimentin and Klotho relative to GAPDH, (b) in vitro scratch wound healing assay, (c) transwell cell migration assay, and (d) collagen‐based cell invasion assay for ACHN cells after shRNA‐mediated Klotho ablation. *P < 0.05. Con, control; EMT, epithelial‐mesenchymal transition; OD, optical density; RCC, renal cell carcinoma.

No alterations of α‐2,6‐sialidase activity involves in RCC cellular Klotho overexpression

Klotho participates in the specific removal of α‐2,6‐linked sialic acids and regulates multiple ion channels through this activity.10, 15 Plant lectin Sambucus nigra agglutinin specifically bind to α‐2,6‐sialylated glyco‐conjugates.28 To determine the potential involvement of α‐2,6‐sialidase activity in the Klotho‐mediated RCC cellular phenotype, we investigated alterations of α‐2,6‐sialidase activity by probing with Sambucus nigra agglutinin in RCC cells after Klotho overexpression. Immunofluorescence staining, flow cytometry analysis and lectin blot analysis showed that HKC, ACHN and 786‐O cells exhibited lower α‐2,6‐sialidase activity compared with OS‐RC‐2 and Renca cells, which is mostly consistent with the earlier findings of Klotho expression (Fig. 4a–c). However, no alterations of α‐2,6‐sialidase activity were found in RCC cells after Klotho overexpression with immunofluorescence staining, flow cytometry analysis, and lectin blot (Fig. 4d–g). These findings indicate that Klotho overexpression might regulate RCC cellular phenotype independent on α‐2,6‐sialidase activity.

Figure 4.

Figure 4

There are no alterations of α‐2,6‐sialidase activity involved in RCC cellular Klotho overexpression. (a) Immunofluorescence staining, (b) flow cytometry analysis, and (c) lectin blot analysis of α‐2,6‐linked sialic acids probed with SNA in HKC, OS‐RC‐2, 786‐O, ACHN and Renca cells. Western blot analysis of Klotho relative to (d) GAPDH, (e) immunofluorescence staining with SNA, and (f) flow cytometry analysis with SNA for OS‐RC‐2 and ACHN cells after Klotho overexpression. (g) Lectin blot analysis with SNA for OS‐RC‐2 cells after Klotho overexpression. Con, control; EMT, epithelial‐mesenchymal transition; RCC, renal cell carcinoma; SNA,Sambucus nigra agglutinin.

Klotho blunts RCC cellular EMT by inhibiting PI3K/Akt/GSK3β/Snail signaling

Our previous study indicated the crucial role of the PI3K/Akt signal in RCC tumorigenesis.27 Recent investigations have implicated Klotho molecular events in mammalian PI3K/Akt pathway inhibition, which could lead to GSK3β activity for Snail degradation.29, 30, 31, 32 Another work has suggested that Snail has a pivotal role in RCC progression.33 To dissect the molecular signals underlying a Klotho‐induced functional phenotype, we examined the potential link between Klotho and Snail, a recognized extensive EMT inducer relaying signals from the PI3K/Akt/GSK3β pathway, in RCC cells. 786‐O and OS‐RC‐2 cells displayed decreased pAkt, Snail and pGSK3β levels after Klotho overexpression (Fig. 5a). Consistent with this finding, ACHN cells showed increased pAkt and Snail levels concomitant with increased pGSK3β after shRNA‐mediated Klotho knockdown (Fig. 5b). Moreover, PI3K inhibition with LY294002 and GSK3β knockdown with LiCl imitate the phenomenon displayed in OS‐RC‐2 cells after Klotho overexpression and knockdown, respectively (Fig. 5c). Also, ACHN cellular EMT phenotype induced by shRNA‐mediated Klotho knockdown, which including decreased expression of the epithelial marker E‐cadherin, increased levels of the mesenchymal markers N‐cadherin and vimentin levels, and enhanced invasion ability, could be alleviated upon PI3K inhibition with LY294002 (Fig. 5d,e). Consistent with this finding, the OS‐RC‐2 cellular mesenchymal‐epithelial transition phenotype induced by Klotho overexpression, which included increased expression of the epithelial marker E‐cadherin, decreased levels of mesenchymal markers N‐cadherin and vimentin, and reduced invasion ability, could be reversed by Snail activity (Fig. 5f,g). These data elucidate that Klotho blunts RCC cellular EMT by suppressing the PI3K/Akt/GSK3β/Snail pathway.

Figure 5.

Figure 5

Klotho alleviates RCC cellular EMT via PI3K/Akt/GSK3β/Snail inhibition. Western blot analysis of Klotho, pAkt, Akt, pGSK3β, GSK3β and Snail relative to GAPDH (a) for 786‐O and OS‐RC‐2 cells after Klotho overexpression, (b) for ACHN cells after shRNA‐mediated Klotho ablation. (c) Western blot analysis of pAkt, Akt, pGSK3β, GSK3β and Snail relative to GAPDH for OS‐RC‐2 cells after treatment with LY294002 (24 μM, 24 h) or LiCl (10 mM, 24 h). (d) Western blot analysis of Klotho, E‐cadherin, N‐cadherin and vimentin relative to GAPDH for ACHN cells after shRNA‐mediated Klotho ablation without or with LY294002 (24 μM, 24 h) treatment. (e) Collagen‐based cell invasion assay for ACHN cells after shRNA‐mediated Klotho ablation without or with LY294002 (24 μM, 24 h) treatment. (f) Western blot analysis of Klotho, E‐cadherin, N‐cadherin and vimentin relative to GAPDH for OS‐RC‐2 cells after Klotho overexpression with Snail WT plasmid or Snail CA plasmid co‐transfection. (g) Collagen‐based cell invasion assay for OS‐RC‐2 cells after Klotho overexpression with Snail WT plasmid or Snail CA plasmid co‐transfection. *P < 0.05. CA, constitutively active; Con, control; EMT, epithelial‐mesenchymal transition; GSK3β, glycogen synthase kinase 3‐β; OD, optical density; PI3K, phosphoinositide 3‐kinase; RCC, renal cell carcinoma; SNA,Sambucus nigra agglutinin.

Klotho levels negatively correlate with pAkt and Snail expression in RCC samples

To ascertain PI3K/Akt/GSK3β/Snail molecular pathway relays signaling downstream Klotho in clinical RCC tumorigenesis, we analyzed Klotho, pAkt and Snail immunohistochemical staining in a cohort of 125 RCC specimens. Relative to localized RCC tissues, advanced RCC tissues displayed lower Klotho staining, concomitant with higher cytoplasmic pAkt staining and higher nuclear Snail staining (Fig. 6). Correlation analysis indicated that Klotho immunostaining in the 125 RCC specimens showed significant negative correlations with pAkt (P = 0.005, r = −0.251) and Snail staining (P = 0.017, r = −0.213) (Table 3). This supports our in vitro data indicating that the PI3K/Akt/GSK3β/Snail molecular pathway relays oncogenic signals resulting from decreased Klotho in RCC tumorigenesis.

Figure 6.

Figure 6

Klotho declination accompanies Akt/Snail activation in RCC progression. Representative immunohistochemical staining with lower Klotho expression concomitant with higher pAkt and Snail levels in advanced RCC tissues compared with localized RCC tissues from a cohort of 125 patients. Scale bars, 50.0 μm. RCC, renal cell carcinoma.

Table 3.

Klotho immunostaining negatively correlates with pAkt and Snail in clear cell renal cell carcinoma samples (n = 125)

Klotho pAkt Snail
Low High Low High
Low 25 31 29 27
High 48 21 51 18
r –0.251 –0.213
P‐value 0.005 0.017

Akt; r, Spearman correlation coefficient.

Discussion

Our present study identifies Klotho as a potential tumor suppressor in RCC tumorigenesis. Klotho declination during disease progression initiates an EMT phenotypic switch through PI3K/Akt/GSK3β/Snail signal activation in vitro and in vivo. Additionally, intratumoral Klotho declination, which correlates with RCC progression and a poor prognosis, is indicated as an independent prognosticator for overall survival in clinical patients. This work illuminates a crucial molecular pathway and a functional phenotype downstream of Klotho declination in RCC progression, highlighting potential applications for intratumoral Klotho immunostaining and rKlotho administration in future clinical prognostic strati?cation and therapeutic intervention, respectively.

Klotho is a type‐I transmembrane protein predominantly expressed in renal tubules, parathyroid gland, and choroid plexus epithelium.34 The secreted form of Klotho is generated either when the extracellular domain of the transmembrane protein is shed or as a product of alternative splicing.35 Klotho exerts diverse effects on the physiological regulation of mineral ions, especially calcium and phosphate, and energy metabolism by influencing the endocrine activities of fibroblast growth factors.13, 36 Recently, the tumor suppressive function of Klotho has been extensively identified in various cancers. Functional loss of Klotho due to epigenetic silencing promotes tumor progression in cervical,37 colorectal,38 and gastric cancers.39 Klotho can also inhibit tumor growth, promote apoptosis, and predict clinical outcome in human lung cancers.40, 41 Decreased Klotho is associated with invasiveness of breast cancers and melanomas.16, 18 Consistent with previous findings, our present study indicates that Klotho is a potential tumor suppressor that works by blunting the Snail‐induced EMT phenotype mediated by PI3K/Akt/GSK3β signal activation. This extends our understanding of molecular mechanisms underlying RCC progression. However, upstream events for Klotho declination during RCC tumorigenesis are not addressed here and merit further investigation.

Klotho exhibits α‐2,6‐sialidase activity and regulates cell‐surface expression of transient receptor potential type 5 and renal outer medullary potassium channels.10, 15 However, no alterations of α‐2,6‐sialidase activity were found in RCC cells undergoing Klotho overexpression, which excludes the potential effects of Klotho on cancer sialylation during RCC development. Further molecular analysis of the increased or decreased function of Klotho indicates that Klotho blunts the RCC cellular EMT phenotypic switch through PI3K/Akt/GSK3β/Snail signal suppression. In addition to previous findings implicating this pathway's pivotal role in RCC tumorigenesis,27, 42 our current data interlink Klotho declination and Snail‐induced EMT with PI3K/Akt/GSK3β signal activation in vitro and in vivo. Interestingly, we found negative correlation between Klotho with pAkt and Snail staining in human specimens, strengthening the clinical significance of the Klotho/Akt/Snail pathway in RCC tumorigenesis. However, molecular mechanisms for Klotho‐mediated PI3K/Akt inhibition during RCC development remain to be addressed in future investigation.

Klotho is essential for endogenous FGF23 function, the newest member of FGF family.13 Although studies regarding the role of FGF in renal cancer remain sparse, increased basic FGF serum levels have been found to be associated with poor survival and high frequency of pulmonary metastases in RCC.43 Furthermore, abnormal regulation of FGF23–Klotho axis in renal cancer could severely disrupt mineral ion homeostasis and vitamin D metabolism and induce disease pathology.44 The expression of FGF23 is probably one of the major causes of tumor‐induced osteomalacia.45 Thus, the potential relevance of the FGF23 signal in tumor suppressive Klotho during renal carcinogenesis requires clarification.

In summary, this study elucidated the crucial role of PI3K/Akt/GSK3β/Snail signal activation in EMT‐driving RCC progression mediated by Klotho declination. Furthermore, being an endogenous circulating hormone, Klotho administration in mice is safe and inhibits tumor growth effectively.8, 17 Our data presented here reveal a novel molecular mechanism underlying RCC progression, leading to a potential therapeutic intervention with rKlotho administration for mRCC treatment.

Disclosure Statement

The authors have no conflict of interest.

Supporting information

Data S1. Supplementary materials and methods.

Acknowledgments

We thank Dr Ci‐Di Chen (Boston University School of Medicine, Boston, MA, USA) and Dr Mien‐Chie Hung (MD Anderson Cancer Center, Houston, TX, USA) for the generous gifts of plasmids. This work was supported by grants from the National Natural Science Foundation of China (grant numbers 31100629, 31270863).

(Cancer Sci, doi: 10.1111/cas.12134, 2013)

References

  • 1. Ljungberg B, Hanbury DC, Kuczyk MA et al Renal cell carcinoma guideline. Eur Urol 2007; 51: 1502–10. [DOI] [PubMed] [Google Scholar]
  • 2. Linehan WM. The genetic basis of kidney cancer: implications for management and use of targeted therapeutic approaches. Eur Urol 2012; 61: 896–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Rini BI, Campbell SC, Escudier B. Renal cell carcinoma. Lancet 2009; 373: 1119–32. [DOI] [PubMed] [Google Scholar]
  • 4. Stewart GD, O'Mahony FC, Powles T, Riddick AC, Harrison DJ, Faratian D. What can molecular pathology contribute to the management of renal cell carcinoma? Nat Rev Urol 2011; 8: 255–65. [DOI] [PubMed] [Google Scholar]
  • 5. Linehan WM, Bratslavsky G, Pinto PA et al Molecular diagnosis and therapy of kidney cancer. Annu Rev Med 2010; 61: 329–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Sun M, Lughezzani G, Perrotte P, Karakiewicz PI. Treatment of metastatic renal cell carcinoma. Nat Rev Urol 2010; 7: 327–38. [DOI] [PubMed] [Google Scholar]
  • 7. Kuro‐o M, Matsumura Y, Aizawa H et al Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 1997; 390: 45–51. [DOI] [PubMed] [Google Scholar]
  • 8. Kurosu H, Yamamoto M, Clark JD et al Suppression of aging in mice by the hormone Klotho. Science 2005; 309: 1829–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Liu F, Wu S, Ren H, Gu J. Klotho suppresses RIG‐I‐mediated senescence‐associated inflammation. Nat Cell Biol 2011; 13: 254–62. [DOI] [PubMed] [Google Scholar]
  • 10. Cha SK, Ortega B, Kurosu H, Rosenblatt KP, Kuro OM, Huang CL. Removal of sialic acid involving Klotho causes cell‐surface retention of TRPV5 channel via binding to galectin‐1. Proc Natl Acad Sci U S A 2008; 105: 9805–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Doi S, Zou Y, Togao O et al Klotho inhibits transforming growth factor‐beta1 (TGF‐beta1) signaling and suppresses renal fibrosis and cancer metastasis in mice. J Biol Chem 2011; 286: 8655–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Moe SM. Klotho: a master regulator of cardiovascular disease? Circulation 2012; 125: 2181–3. [DOI] [PubMed] [Google Scholar]
  • 13. Urakawa I, Yamazaki Y, Shimada T et al Klotho converts canonical FGF receptor into a specific receptor for FGF23. Nature 2006; 444: 770–4. [DOI] [PubMed] [Google Scholar]
  • 14. Kurosu H, Ogawa Y, Miyoshi M et al Regulation of fibroblast growth factor‐23 signaling by klotho. J Biol Chem 2006; 281: 6120–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Cha SK, Hu MC, Kurosu H, Kuro‐o M, Moe O, Huang CL. Regulation of renal outer medullary potassium channel and renal K(+) excretion by Klotho. Mol Pharmacol 2009; 76: 38–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Wolf I, Levanon‐Cohen S, Bose S et al Klotho: a tumor suppressor and a modulator of the IGF‐1 and FGF pathways in human breast cancer. Oncogene 2008; 27: 7094–105. [DOI] [PubMed] [Google Scholar]
  • 17. Abramovitz L, Rubinek T, Ligumsky H et al KL1 internal repeat mediates klotho tumor suppressor activities and inhibits bFGF and IGF‐I signaling in pancreatic cancer. Clin Cancer Res 2011; 17: 4254–66. [DOI] [PubMed] [Google Scholar]
  • 18. Camilli TC, Xu M, O'Connell MP et al Loss of Klotho during melanoma progression leads to increased filamin cleavage, increased Wnt5A expression, and enhanced melanoma cell motility. Pigment Cell Melanoma Res 2010; 24: 175–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Kalluri R, Weinberg RA. The basics of epithelial‐mesenchymal transition. J Clin Invest 2009; 119: 1420–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Kalluri R. EMT: when epithelial cells decide to become mesenchymal‐like cells. J Clin Invest 2009; 119: 1417–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Roussos ET, Keckesova Z, Haley JD, Epstein DM, Weinberg RA, Condeelis JS. AACR special conference on epithelial‐mesenchymal transition and cancer progression and treatment. Cancer Res 2010; 70: 7360–4. [DOI] [PubMed] [Google Scholar]
  • 22. Harada KI, Miyake H, Kusuda Y, Fujisawa M. Expression of epithelial‐mesenchymal transition markers in renal cell carcinoma: impact on prognostic outcomes in patients undergoing radical nephrectomy. BJU Int 2012; 110: e1131–7. [DOI] [PubMed] [Google Scholar]
  • 23. Xu J, Yun X, Jiang J et al Hepatitis B virus X protein blunts senescence‐like growth arrest of human hepatocellular carcinoma by reducing Notch1 cleavage. Hepatology 2010; 52: 142–54. [DOI] [PubMed] [Google Scholar]
  • 24. Xu J, Liu H, Chen L et al Hepatitis B virus X protein confers resistance of hepatoma cells to anoikis by up‐regulating and activating p21‐activated kinase 1. Gastroenterology 2012; 143: 199–212. [DOI] [PubMed] [Google Scholar]
  • 25. Liu H, Xu J, Zhou L et al Hepatitis B virus large surface antigen promotes liver carcinogenesis by activating the Src/PI3K/Akt pathway. Cancer Res 2011; 71: 7547–57. [DOI] [PubMed] [Google Scholar]
  • 26. Liu H, Xu L, He H et al Hepatitis B virus X protein promotes hepatoma cell invasion and metastasis by stabilizing Snail protein. Cancer Sci 2012; 103: 2072–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Xu L, Zhu Y, Xu J et al Notch1 activation promotes renal cell carcinoma growth via PI3K/Akt signaling. Cancer Sci 2012; 103: 1253–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Brinkman‐Van der Linden EC, Sonnenburg JL, Varki A. Effects of sialic acid substitutions on recognition by Sambucus nigra agglutinin and Maackia amurensis hemagglutinin. Anal Biochem 2002; 303: 98–104. [DOI] [PubMed] [Google Scholar]
  • 29. Franke TF. PI3K/Akt: getting it right matters. Oncogene 2008; 27: 6473–88. [DOI] [PubMed] [Google Scholar]
  • 30. Yamamoto M, Clark JD, Pastor JV et al Regulation of oxidative stress by the anti‐aging hormone klotho. J Biol Chem 2005; 280: 38029–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Doble BW, Woodgett JR. GSK‐3: tricks of the trade for a multi‐tasking kinase. J Cell Sci 2003; 116: 1175–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Barrallo‐Gimeno A, Nieto MA. The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development 2005; 132: 3151–61. [DOI] [PubMed] [Google Scholar]
  • 33. Mikami S, Katsube K, Oya M et al Expression of Snail and Slug in renal cell carcinoma: E‐cadherin repressor Snail is associated with cancer invasion and prognosis. Lab Invest 2011; 91: 1443–58. [DOI] [PubMed] [Google Scholar]
  • 34. Kuro‐o M. Klotho. Pflugers Arch 2009; 459: 333–43. [DOI] [PubMed] [Google Scholar]
  • 35. Chen CD, Podvin S, Gillespie E, Leeman SE, Abraham CR. Insulin stimulates the cleavage and release of the extracellular domain of Klotho by ADAM10 and ADAM17. Proc Natl Acad Sci U S A 2007; 104: 19796–801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Tomiyama K, Maeda R, Urakawa I et al Relevant use of Klotho in FGF19 subfamily signaling system in vivo. Proc Natl Acad Sci U S A 2010; 107: 1666–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Lee J, Jeong DJ, Kim J et al The anti‐aging gene KLOTHO is a novel target for epigenetic silencing in human cervical carcinoma. Mol Cancer 2010; 9: 109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Pan J, Zhong J, Gan LH et al Klotho, an anti‐senescence related gene, is frequently inactivated through promoter hypermethylation in colorectal cancer. Tumour Biol 2011; 32: 729–35. [DOI] [PubMed] [Google Scholar]
  • 39. Wang L, Wang X, Jie P et al Klotho is silenced through promoter hypermethylation in gastric cancer. Am J Cancer Res 2011; 1: 111–9. [PMC free article] [PubMed] [Google Scholar]
  • 40. Chen B, Wang X, Zhao W, Wu J. Klotho inhibits growth and promotes apoptosis in human lung cancer cell line A549. J Exp Clin Cancer Res 2011; 29: 99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Usuda J, Ichinose S, Ishizumi T et al Klotho predicts good clinical outcome in patients with limited‐disease small cell lung cancer who received surgery. Lung Cancer 2011; 74: 332–7. [DOI] [PubMed] [Google Scholar]
  • 42. Sourbier C, Lindner V, Lang H et al The phosphoinositide 3‐kinase/Akt pathway: a new target in human renal cell carcinoma therapy. Cancer Res 2006; 66: 5130–42. [DOI] [PubMed] [Google Scholar]
  • 43. Duensing S, Grosse J, Atzpodien J. Increased serum levels of basic fibroblast growth factor (bFGF) are associated with progressive lung metastases in advanced renal cell carcinoma patients. Anticancer Res 1995; 15: 2331–3. [PubMed] [Google Scholar]
  • 44. Torres PU, Prie D, Molina‐Bletry V, Beck L, Silve C, Friedlander G. Klotho: an antiaging protein involved in mineral and vitamin D metabolism. Kidney Int 2007; 71: 730–7. [DOI] [PubMed] [Google Scholar]
  • 45. Shimada T, Mizutani S, Muto T et al Cloning and characterization of FGF23 as a causative factor of tumor‐induced osteomalacia. Proc Natl Acad Sci U S A 2001; 98: 6500–5. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1. Supplementary materials and methods.


Articles from Cancer Science are provided here courtesy of Wiley

RESOURCES