Skip to main content
Cancer Science logoLink to Cancer Science
. 2013 Mar 8;104(4):516–523. doi: 10.1111/cas.12110

Interaction of monocytes/macrophages with ovarian cancer cells promotes angiogenesis in vitro

Xipeng Wang 1,†,✉, Xiaobo Zhao 1,†, Kai Wang 1, Li Wu 1, Tao Duan 1,✉
PMCID: PMC7657218  PMID: 23347208

Abstract

It has been established that macrophages and endothelial cells infiltrate peritoneum in the vicinity of tumor implants of epithelial ovarian cancer (EOC). This study investigates whether the interaction of ovarian cancer cells and tumor‐associated macrophages could promote the involvement of endothelial cells in angiogenesis. Macrophage phenotypes were detected by fluorescence‐activated cell sorting, and cytokine/chemokine secretion was measured by enzyme linked immunosorbent assay. The effect of co‐culture of ovarian cancer cells and tumor‐associated macrophage (TAM) cells on endothelial cell migration and tube formation was investigated. Signaling pathway mediators were also evaluated for their potential roles in endothelial cell activation by ovarian cancer cells co‐cultured with TAM cells. Our results showed that higher expression of interleukin‐8 (IL‐8) expression associated with 54.26 ± 34.46% of TAM infiltration of peritoneum was significantly higher than 16.58 ± 17.74% of CD3+ T‐cell by immunofluorescence co‐staining and confocal microscopy. THP‐1 cells exhibited M2‐polarized phenotype markers with high proportion of CD68+, CD206+ and CD204+ markers after phorbol 12‐myristate 13‐acetate (PMA) treatment, After co‐culturing with TAM cells in a transwell chamber system, EOC cells (SKOV3) increased their IL‐8 expression at the level of mRNA and protein. After exposure to the conditioned medium obtained by co‐culturing TAM and SKOV3 cells, the migration and tube formation of endothelial cells were enhanced significantly. Furthermore, the upregulation of IL‐8 expression in ovarian cancer cells induced by macrophages could be inhibited by pyrollidine dithiocarbamate, an inhibitor of nuclear factor (NF)‐ κB signal pathway. We suggest that the interaction of ovarian cancer cells and tumor‐associated macrophages enhances the ability of endothelial cells to promote the progression of ovarian cancer.


Epithelial ovarian cancer (EOC) accounts for 90% of all ovarian cancers and has become the leading cause of death from gynecological cancers in North America and Europe.1 A remarkable feature of advanced EOC is the presence of widespread peritoneal metastases at the time of the initial diagnosis. However, the mechanisms of peritoneal seeding, spreading and progression remain elusive.

Tumor microenvironment consists of various stromal cells, including activated endothelial cells, tumor‐associated macrophages (TAMs), fibroblasts, and bone marrow‐derived cells.2 Our previous study has confirmed that more than 75% of mononuclear immune cells in peritoneum close to a tumor implant were TAM, which mimic chronic inflammation.3 Most studies reported that infiltrating TAMs were associated with cancer progression.4, 5, 6, 7 Tumor‐associated macrophages might be recruited from peripheral blood by chemokines and then positioned in the tumor stroma. Those macrophages could be ‘educated’ and differentiated into M1 or M2 forms as a result of activation by some molecular factors. Interferon‐γ (IFN‐γ) can induce M1 phenotype: typically, IL‐12high and IL‐10low. Interleukin‐13 (IL‐13) and IL‐4 can induce the differentiation of macrophages into M2 cells, with IL‐10high and IL‐12low phenotype. Our previous study have reported that coagulation factors II, III and XII induce the differentiation of peripheral blood monocytes from healthy women into M2‐like macrophages, and participate in promoting EOC progression.8, 9, 10 In our previous study, we have demonstrated that CD68+ macrophages are in close contact with CD31+ endothelial cells in peritoneum in the presence of EOC. We have found that 53% of CD68+ cells and CD31+ endothelial cells display high levels of VCAM1 adhesion molecule expression, in contrast to 3.6% of CD3+ T cells, which express VCAM1 infrequently.3 It is well known that angiogenesis is regulated by many factors, such as IL‐8, vascular endothelial growth factor (VEGF), and basic fibroblast growth factor (bFGF).11, 12 However, little is known about the interaction of cancer and other stromal cells on endothelial cell involvement in new vessel formation in tumor microenvironment.

We hypothesized that macrophages recruited from peripheral blood, after ‘re‐education’ by ovarian cancer cells, could stimulate endothelial cell function, mediating EOC seeding and metastasis in peritoneum. The interaction of cancer cells and TAMs might affect the angiogenic potential of endothelial cells.

Materials and Methods

Reagents

RMPI1640 Medium (RPMI1640), FBS, trypsin‐EDTA, and penicillin–streptomycin were obtained from Gibco‐BRL Life Technologies (Grand Island, NY, USA). Paraffin‐embedded, formalin‐fixed EOC surgical specimens were collected from the Department of Pathology in Shanghai First Maternity and Infant Hospital affiliated to Tongji University School of Medicine. Pyrollidine dithiocarbamate (PDTC) and phorbol 12‐ myristate13‐acetate (PMA) were from Sigma (St. Louis, MO, USA). For immunohistochemistry, the following primary antibodies were used: rabbit anti‐human IL‐8 from Novus (Littleton, CO, USA), and mouse anti‐human CD68 and CD31 from Abcam (Cambridge, UK). Goat anti‐mouse/rabbit IgG antibody conjugated to horseradish peroxidase (HRP) (Gene Tech, Shanghai, China) was used as the secondary antibody. Antibodies for FACS were: PE‐CD68 mAb, PECY‐CD206 mAb (BD Biosciences, Franklin Lakes, NJ, USA), and PE‐CD204 mAb (R&D, Minneapolis, MN, USA). For CD68 staining, the cells were fixed and permeabilized with a BD Cytofix/CytopermTM Fixation/Permeabilization Solution Kit (BD Biosciences). Interleukin‐8 expression was determined using a commercial ELISA kit (R&D Systems). For tube formation, we used matrigel purchased from BD Biosciences (Bedford, MA, USA). Interleukin ‐8‐neutralizing monoclonal antibody (IL‐8 nmAb) (Abcam, Cambridge, UK) was used to determine whether IL‐8 played a role in endothelial cell migration and tuber formation. Nuclear factor (NF)‐κb P65 protein was detected using rabbit anti‐NF‐κB polyclonal antibody (1:200; NF‐κB p65, c20; Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Cell preparation and media

Ovarian cancer cell lines SKOV3 and human monocyte cell line THP‐1 cells were obtained from the cell bank of the Chinese Academy of Sciences, Shanghai, China. Human umbilical vein endothelial cell line (HUVEC) was isolated in the Central Laboratory of Shanghai First Maternity and Infant Hospital. The cells were cultured in RPMI 1640 Gibco, supplemented with 10% FBS, 100 U/mL penicillin and 100 U/mL streptomycin.

Ascites, peripheral blood, and other specimen samples were collected after obtaining a written informed consent of study participants in accordance with the requirements of the Institutional Review Board at Shanghai First Maternity and Infant Hospital.

Immunofluorescence costaining and confocal microscopy of IL‐8 and CD68+ macrophages

Immunofluorescence costaining (of 6 mm‐thick sections) for IL‐8, CD3+ T cell and CD68+ macrophages in cryopreserved peritoneal biopsy specimens of 18 EOC patients. Staining was performed using a two‐step method with a poly‐clonal rabbit anti‐IL‐8 antibody (1:100 dilution; Novus) and a mouse monoclonal antibody to CD68 (1:40 dilution; Abcam) as the primary antibodies, and goat anti‐rabbit/mouse IgG antibody conjugated to HRP (Gene Tech) as the secondary antibody. Briefly, 6‐μm sections of cryopreserved peritoneal tissues were immediately fixed with acetone for 10 min, air dried for 30 min, and then kept at 20°C overnight. Sections were then air‐dried for 30 min at room temperature and endogenous peroxidase activity was blocked by incubation in 0.3% H2O2 in PBS for 15 min. Sections were then washed three times in PBS, and nonspecific reactions were blocked with 2% normal horse serum for 30 min. Sections were then incubated for 2 h at room temperature with the primary antibodies as follows.

Co‐culture of human EOC cell line with macrophages

THP‐1 cells differentiated into macrophages after treatment with phorbol‐12‐myristate‐13‐acetate (PMA). To generate macrophages, 1 × 106 THP‐1 cells were seeded in the upper insert of a six‐well transwell apparatus with 0.4‐μm pore size (Corning, Lowell, MA, USA) and treated with 320 nM PMA (Sigma) for 24 h. After a thorough wash to remove all PMA, the upper inserts were placed directly on top of the six‐well plates containing the SKOV3 cells (5 × 105) and co‐cultured for 6, 12 and 24 h. At the specific time points, the conditioned medium was collected and centrifuged to remove cellular debris, and the supernatants were frozen at –80°C, to be assayed for IL‐8 by ELISA. Total RNA was extracted from the SKOV3 cells in the wells.

Flow cytometry assay

1 × 106 THP‐1 cells were stimulated with 320 nM PMA for 24 h in order to induce monocyte transformation into macrophages. The cells were washed and resuspended in PBS supplemented with 2% FBS and 0.01% NaN3. For CD68 staining, the cells were fixed and permeabilized with a BD Cytofix/CytopermTM Fixation/Permeabilization Solution Kit (BD Biosciences). Cells were then incubated with 20 μL of PE‐CD68 mAb (BD Biosciences). For surface markers, the cells were incubated with 20 μL of PECYCD206 mAb (BD Biosciences) or 10 μL of PE‐CD204 mAb (R&D). After the last washing step, the labeled cells were analyzed using BD FACS Calibur System (BD Biosciences).

Interleukin‐8 gene expression detected by real‐time PCR

Total RNA was extracted from SKOV3 cells with Trizol reagent (Invitrogen, Carlsbad, CA, USA). After purification and establishing RNA concentration using Thermo Scientific Nano Drop 2000c spectrophotometer, 400 ng aliquots of total RNA from each sample were reverse‐transcribed into cDNAs using Prime Script RT Reagent Kit (TaKaRa Biotechnology, Dalian, China) according to the manufacturer's recommendation. For each sample, 40 ng of cDNA was used as a template for PCR. The primers were: IL‐8 sense primer ‐ 5′‐CAGAGACAGCAGAGCACACAA‐3′, and antisense primer ‐ 5′‐TTAGCACTCCTTGGCAAAAC‐3′. Real‐time PCR was performed using SYBR Premix Ex Taq (TaKaRa Biotechnology). Relative gene expression was calculated using the 2−ΔΔCT method with β‐actin as calibrator.

Interleukin‐8 secretion measured by ELISA

The supernatants of SKOV3 co‐cultured with TAMs were collected at different time intervals. The concentration of IL‐8 in the supernatants was determined using ELISA kit from R&D.

Endothelial cell migration assay

Transwell chambers (6.5 mm) (Corning Costar, Cambridge, MA, USA) with polycarbonate membrane with 8.0‐μm pores were coated with matrigel. Human umbilical vascular endothelial cells (50 000 cells/well) were incubated in the upper chamber at 37°C in 5% CO2 and allowed to migrate for 6 h toward the lower chamber (serum free). The incubation took place with or without the supernatants obtained by culturing SKOV3 cells alone, TAMs alone, or SKOV3 with TAMs for 24 h. Interleukin‐8 nmAb at 0.1 μg/mL and 1.0 μg/mL were added to the conditioned medium of SKOV3/macrophage cocultured supernants. Cells from the top of the Transwell chambers were removed using a cotton swab and the cells that had migrated to the lower surface were fixed with 4% formaldehyde for quantification and stained with crystal violet. Cells in the lower chamber were counted in three random microscopic fields using an inverted microscope (Nikon, Japan).

Tube formation assay

A total of 50 μL of Matrigel Basement Membrane Matrix was coated on a 96‐well plate (Corning Costar), for 1 h at 37°C. Human umbilical vascular endothelial cells were detached by trypsinization; after neutralization of trypsin the cells were resuspended in serum‐free RPMI1640, and 50 μL of 1 × 104 HUVECs were seeded into a Matrigel‐coated 96‐well plate. Then, 50 μL aliquots of supernatants from 24‐h cultures of SKOV3 cells, TAMs alone or SKOV3 with TAMs were added to HUVECs, IL‐8 nmAb at 0.1 μg/mL and 1.0 μg/mL were added to the conditioned medium of SKOV3/macrophage cocultured supernants. The cells were incubated for 6 h at 37°C in 5% CO2. Tube‐like structures of HUVECs formed after 6 h were counted under a microscope.

Assay of NF‐κB signaling pathway

Pyrollidine dithiocarbamate (Sigma) is a specific inhibitor of NF‐κB signaling pathway. It was added to the macrophage/cancer cell co‐cultures at different concentrations. After incubation for 24 h, the supernatants were collected and frozen at −80°C for IL‐8 assay by ELISA, whereas the cells were harvested, and their RNA was extracted and used for IL‐8 mRNA quantification. In the mean time, NF‐κB protein was measured by Western blot.

Statistical analysis

Data are expressed as mean ± SD or standard error (SE) and were analyzed with the Mann–Whitney U‐test, one‐way anova, or t‐test using spss (version 13.0, Chicago, IL, USA). If an anova F‐value was significant, then post hoc comparisons were performed among groups. The P‐value <0.05 was considered statistically significant.

Results

Macrophage infiltration is associated with enhanced IL‐8 expression in EOC

CD3+ T cell, CD68+ macrophage and expression of IL‐8 were stained in peritoneum nearby tumor implants from 18 patients with advanced EOC. It was found that the enhanced expression of IL‐8 was associated with higher proportion of CD68+ macrophage (54.26 ± 34.46%) infiltration than 16.58 ± 17.74% of CD3+ T cells (Fig. 1), which reached statistical difference (P < 0.01). This phenomenon suggested that more angiogenic IL‐8 could be remarkably produced from macrophage infiltrating in peritoneum.

Figure 1.

Figure 1

Expression of interleukin‐8 (IL‐8) and tumor associated macrophage. Macrophages and IL‐8 expression in epithelial ovarian cancer (EOC) samples. (a) Immunostaining of CD68+ macrophages; (b) IL‐8. Original magnifications; (c) CD4+T cell: ×400.

THP‐1 cells differentiated into M2‐like macrophages treated by PMA

After treatment with 320 nM PMA for 24 h, THP‐1 cells (Fig. 2a) quickly stopped proliferating, attached and differentiated to macrophages (Fig. 2b). The PMA‐treated THP‐1 macrophages had significantly enhanced M2 macrophage phenotype surface markers, including CD206 (mannose receptor, Fig. 2c), CD68 (mannose receptor, Fig. 2d), and CD204 (scavenger receptor A, Fig. 2e);

Figure 2.

Figure 2

THP‐1 induced by phorbol 12‐myristate 13‐acetate (PMA) and differentiated into M2 macrophage. PMA treatment differentiated THP‐1 cells to M2 macrophages. When treated with 320 nM PMA for 24 h, human THP‐1 cells (a) quickly stopped proliferating, attached and differentiated to monocytes, and subsequently to macrophages (b). Bar = 5 μm. The THP‐1 cells treated with 320 nM PMA for 24 h showed significant increase in CD206 content (marker of macrophage differentiation) (c) and cell surface markers of M2 macrophages CD68 (d) and CD204 (e).

Elevated IL‐8 expression in SKOV3 cells after culture with macrophages

Interleukin‐8 expression at mRNA and protein levels was measured by RT‐Q‐PCR and ELISA assay, respectively. Interleukin‐8 mRNA expression increased significantly in SKOV3 cells grown with PMA‐induced THP‐1 cells for 6, 12 and 24 h (96‐, 239‐, and 368‐fold; P < 0.05) in comparison with the cells grown alone. Similarly, IL‐8 protein expression was higher in SKOV3 cell cultured with PMA‐induced THP1 cells than in SKOV3 cells grown on their own (Fig. 3a). Interleukin‐8 protein levels increased between 2.2‐ and 3‐fold, and the trend of IL‐8 protein expression correlated with IL‐8 mRNA expression (Fig. 3b). In order to elucidate IL‐8 expression, we measure TNF‐α and IL‐1α from conditioned medium of THP1 induced by PMA, we found TNF‐α exhibited a very high level (5567.5 pg/mL) and IL‐1α was at a very low level by ELISA measurement (Fig. S1).

Figure 3.

Figure 3

Expression of interleukin‐8 (IL‐8) mRNA and protein. Induction of IL‐8 mRNA expression in co‐cultured cancer cell lines and protein levels in the co‐culture media. After macrophages and SKOV3 cells were co‐cultured for different time intervals, SKOV3 cells were harvested to extract total RNA. Total RNA (40 ng) for each sample was used to determine IL‐8 mRNA expression by RT‐Q‐PCR. The media were saved to perform IL‐8 enzyme linked immunosorbent assay (ELISA). In Figure 3a, IL‐8 mRNA level increased with co‐culture time. In Figure 3b, more IL‐8 protein is secreted in SKOV3 cell/macrophage co‐culture media than media from cells cultured on their own. The trend in protein expression is similar to that for the mRNA. All results are shown as the mean ± SD (**P < 0.01, by analysis of variance [anova]).

Endothelial cell migration induced by supernatants from co‐cultures

The addition of supernatants from macrophages and SKOV3 cells (Fig. 4d) co‐cultured for 24 h significantly enhanced migration of endothelial cells (164.5 ± 9.4 HUVEC cells) in comparison with the addition of medium alone (40 ± 5.6), supernatants from macrophage cultures (72.5 ± 4.9) or from SKOV3 cell cultures (76.2 ± 6.0) (Fig. 4a–d). Isotype IgG as control antibody stimulated 137.9 ± 11.2 cell migration. Interleukin‐8 nmAb produced concentration‐dependent inhibitory effects on the number of HUVEC migration cells, which were 142.83 ± 7.94 at 0.1 μg/mL and 61.5 ± 8.11 at 1.0 μg/mL (Fig. 4e,f). When compared with SKOV3/macrophage coculture, IL‐8 nmAb at 1.0 μg/mL could significantly inhibit cell migration (Fig. 4d,f).

Figure 4.

Figure 4

Migration assay of endothelial cell. Co‐culture supernatants induced endothelial cell migration. The supernatants were collected from THP‐1‐derived macrophage culture (b), SKOV3 culture (c), macrophage and SKOV3 co‐cultured for 24 h (d), and RPMI1640 was used as a negative control (a). Il‐8nmb at 0.1 μg/mL (e) and 1.0 μg/mL (f). Interleukin‐8 (IL‐8) isotype IgG (g) Cells that migrated into the lower chamber were counted in three random microscopic fields using an inverted microscope. We found significant differences in cell migration for TAM, SKOV3, TAM/SKOV3 and negative controls (e). All results are shown as the mean ± standard deviation (SD) (**P < 0.01, by analysis of variance (anova)compared with negative control. ##P < 0.01, comparison of macrophage and SKOV3 co‐cultured and IL‐8 nmab at 1.0 μg/ml).

Endothelial cell tube formation

The cells were placed in matrigel‐coated 96‐well plates with medium alone, supernatants from the cultures of THP‐1‐derived macrophages, SKOV3 cells alone or from co‐culture of the macrophages and SKOV3 cells. After 6 h of incubation, the plates were examined for capillary tube formation under an inverted microscope. We observed an increased capillary tube formation in endothelial cells incubated with supernatants from macrophage/SKOV3 co‐culture (12.3 ± 2.6) when compared to cells grown in medium alone (2.0 ± 0.6), with supernatants of macrophages (5.0 ± 1.2) or supernatants of SKOV3 cultures (7.6 ± 1.8). These results suggest a specific and direct involvement of IL‐8 in mediating endothelial cell capillary tube formation (Fig. 5). Interleukin‐8 nmAb produced a concentration‐dependent inhibitory effect on Tuber‐structures, which were 7.1 ± 2.3 at 0.1 μg/mL and 2.5 ± 0.81 at 1.0 μg/mL. It seems that co‐culture of SKOV3 and macrophage exhibit additive effects in mediating tube formation.

Figure 5.

Figure 5

Tube formation of endothelial cell. Supernatants from co‐cultures induced endothelial cell tube formation. Supernatants from TAMs (b), SKOV3 cells (c), or SKOV3 cells co‐cultured with TAMs for 24 h (d), Il‐8nmb at 0.1 μg/mL (e), 1.0 μg/mL (f) and isotype IL‐8 IgG (g) were added to the umbilical vein endothelial cells (HUVECs). RPMI1640 was used as a negative control (a). Tube‐like structures of HUVECs formed at 6 h were captured under a (100×) microscope.

Upregulation of IL‐8 in SKOV3 cells mediated by NF‐κB signal pathway

In the present study, PDTC, a specific inhibitor of NF‐κB pathway, was added to the macrophage/SKOV3 co‐culture system for 24 h at concentrations of 12.5 μM, 25 μM and 50 μM. Coculture of SKOV3 and TAM without PDTC was positive control and culture of SKOV3 alone without PDTC was negative control. This treatment resulted in significant reduction in IL‐8 mRNA levels in co‐cultured SKOV3 cells when compared with SKOV3 cells without PDTC: 37.4 ± 22.7, 18.0 ± 8.1, and 4.7 ± 0.5‐fold, respectively. The IL‐8 mRNA level in the absence of PDTC was 368.2 ± 108.8 times higher than that for separately cultured SKOV3 cells (Fig. 6a). Interleukin‐8 protein levels dropped from 2072.3 ± 285.5 pg/mL (coculture system in the absence of PDTC) to 873.6 ± 39.4 pg/mL, 773.7 ± 32.3 pg/mL, and 750.5 ± 23.7 pg/mL when SKVO3 was treated with 12.5 μM, 25 μM, and 50 μM PDTC, respectively. The level of IL‐8 secreted by single SKOV3 culture was 725.6 ± 119.0 pg/mL in this experiment (Fig. 6b). Nuclear factor‐κb P65 protein was significantly decreased in SKOV3 cells in the presence of PDTC at a concentration‐dependent inhibitory effect (Fig. 6c).

Figure 6.

Figure 6

Expression of Interleukin‐8 (IL‐8)suppressed by pyrollidine dithiocarbamate (PDTC). Enhanced IL‐8 mRNA expression (a) and protein level (b) in SKOV3 cells co‐cultured with macrophages was suppressed by PDTC in a dose‐dependent manner. Nuclear factor (NF)‐κb P65 protein were measured by Western blot (c). All results are shown as the mean ± standard deviation (SD) (**P < 0.01, by analysis of variance [anova])

Discussion

It is widely accepted that peritoneum is a most frequent location for ovarian cancer implants. Our previous morphology study had confirmed that tumor‐associated macrophages are in close contact with endothelial cells.3 Endothelial cells are the major source for the formation of new vessels necessary to support cancer cell growth and metastasis. Various growth factors (e.g. transforming growth factor‐β [TGF‐β], IL‐8, VEGF),12 via their autocrine and paracrine effects, and some stroma cells13 are involved in neovascularity in EOC. In this study, we investigated the possible macrophage involvement in the activation of endothelial cells in peritoneum in the presence of ovarian cancer.

The results of Immunofluorescence costaining suggested a close relationship between the TAM infiltration and enhanced IL‐8 expression in EOC peritoneum. We hypothesized that TAMs might be regulated by EOC and involved in an angiogenesis process through upregulating IL‐8 expression in EOC. To verify our hypothesis, we used THP‐1‐derived macrophages and a cancer cells in vitro co‐culture system.

Human THP‐1 cells are widely used as models for monocyte/macrophage differentiation. After phorbol myristate acetate (PMA, 320 nM) treatment for 24 h, THP‐1 cells stopped proliferating, became attached, and differentiated to macrophages. They also exhibited significant expression of CD68, CD206 and CD204, characteristic M2 macrophage surface markers.14, 15 Our studies confirm this result. Most TAMs in the tumor microenvironments are M2 macrophages. It has been shown that PMA‐treated THP‐1 macrophages secrete little TNF‐α, IL‐1‐β, and IL‐6 but have high levels of TGF‐β, thus sharing the cytokine profiles with M2 type macrophages.15 In this study, all TAM‐like cells were derived from THP‐1 cells treated with PMA. In malignant tumors, the number of activated tumor‐infiltrating macrophages strongly correlates with the extent of angiogenesis.16, 17 It has been demonstrated that the tumor‐associated macrophages produce some angiogenic factors, including VEGF, bFGF, PDGF, TNF‐α and IL‐8.18, 19 It is possible that, apart from secreting angiogenic factors themselves, TAMs can induce the production of these factors in the cancer cells. Liss et al. have proposed that tumor cells might be activated by the macrophages and secrete angiogenic factors in head‐and‐neck squamous cell carcinomas.20 Our previous studies have certified TNF‐α expression upstream of IL‐8 expression in macrophage, when we added TNF‐α blocking antibody, IL‐8 expression was decreased.8 It has been reported that indirect interactions between tumor and stroma cells20, 21 enhance the expression of angiogenic factors, such as IL‐1, and TNF‐α, in a conditioned medium, can increase IL‐8 expression. Our study supported this hypothesis by showing that after interaction with macrophages, IL‐8 expression in cancer cells was increased.

In the present study, we found that the supernatants from SKOV3 cells co‐cultured with TAMs enhanced the endothelial cell migration and tube formation in comparison with the supernatants from SKOV3 cultures or TAMs cultured alone. It seems to be an additive effect, but not a synergistic effect. We concluded that this phenomenon was closely associated with the upregulation of IL‐8 expression.

Our previous studies have demonstrated that coagulation factor II (thrombin) induces monocyte polarization to M2 phenotype, and IL8 is associated with monocyte differentiation behavior and involved in ovarian cancer cell migration. Interleukin‐8 has been observed in EOC patients – in ovarian cyst fluid, ascites, serum, and tumor tissue.22, 23, 24 Increased expression levels of IL‐8 and/or its receptors CXCR1/2 have been found in ovarian cancer cells, endothelial cells, and TAMs. These data suggest that in a tumor microenvironment, IL‐8 might have an important role as a regulatory factor in the promotion of cancer proliferation and angiogenesis. The results reported here show a positive correlation between TAM infiltration and the IL‐8 expression in EOC peritoneum.

The mechanism by which TAMs promote tumor progression might involve the production of cytokines, which activate some signaling pathways, such as NF‐κB in tumor cells, to induce the genes responsible for cell survival, proliferation and migration.9 In this study, we used PDTC, a specific inhibitor of NF‐κB signal pathway. We found that in the presence of this inhibitor, the upregulation of IL‐8 expression in SKOV3 cells co‐cultured with THP‐1 differentiated macrophages was abrogated in a dose‐dependent manner. On the basis of these findings, we believe that the upregulation in IL‐8 expression in cancer cells induced by co‐culture with macrophages is, at least in the case of SKOV3 cells, regulated in part through the NF‐κB pathway.

To summarize, our results suggested that the behavior of cancer cells could be affected by stromal cells; the cancer cells would promote tumor progression by increasing the production of angiogenic factors. Therefore, the strategies for developing new antitumor therapies by disrupting the communication between tumor and stromal cells could be possible.

Disclosure Statement

The authors have no conflict of interest.

Supporting information

Fig. S1. Tumor necrosis factor‐α (TNF‐α) and interleukin‐1α (IL‐1α) expression. TNF‐α and IL‐1α were detected in condition medium of THP1 in serum free and THP1 induced by phorbol 12‐ myristate13‐acetate (PMA). Only TNF‐α exhibit very high expression in THP1 induced by PMA.

Acknowledgment

This work was supported by the National Science Foundation of China (81072136) and Shanghai Educational Committee Grant (09ZZ113).

(Cancer Sci 2013; 104: 516–523)

References

  • 1. Jemal A, Siegel R, Ward E et al Cancer statistics, 2008. CA Cancer J Clin 2008; 58: 71–96. [DOI] [PubMed] [Google Scholar]
  • 2. Lewis CE, Pollard JW. Distinct role of macrophages in different tumor microenvironments. Cancer Res 2006; 66: 605–12. [DOI] [PubMed] [Google Scholar]
  • 3. Wang X, Deavers M, Patenia R et al Monocyte/macrophage and T‐cell infiltrates in peritoneum of patients with ovarian cancer or benign pelvic disease. J Transl Med 2006; 4: 30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Condeelis J, Pollard JW. Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell 2006; 124: 263–66. [DOI] [PubMed] [Google Scholar]
  • 5. Hagemann T, Biswas SK, Lawrence T, Sica A, Lewis CE. Regulation of macrophage function in tumors: the multifaceted role of NF‐kappaB. Blood 2009; 113: 3139–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Hagemann T, Lawrence T, McNeish I et al “Re‐educating” tumor‐associated macrophages by targeting NF‐kappaB. J Exp Med 2008; 205: 1261–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Hallam S, Escorcio‐Correia M, Soper R, Schultheiss A, Hagemann T. Activated macrophages in the tumour microenvironment‐dancing to the tune of TLR and NF‐kappaB. J Pathol 2009; 219: 143–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Ma Z, Zhang T, Wang R et al Tissue factor‐factor VIIa complex induces epithelial ovarian cancer cell invasion and metastasis through a monocytes‐dependent mechanism. Int J Gynecol Cancer 2011; 21: 616–24. [DOI] [PubMed] [Google Scholar]
  • 9. Zhang T, Ma Z, Wang R et al Thrombin facilitates invasion of ovarian cancer along peritoneum by inducing monocyte differentiation toward tumor‐associated macrophage‐like cells. Cancer Immunol Immunother 2010; 59: 1097–108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Wang R, Zhang T, Ma Z et al The interaction of coagulation factor XII and monocyte/macrophages mediating peritoneal metastasis of epithelial ovarian cancer. Gynecol Oncol 2010; 117: 460–6. [DOI] [PubMed] [Google Scholar]
  • 11. Hanahan D, Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 1996; 86: 353–64. [DOI] [PubMed] [Google Scholar]
  • 12. Olofsson B, Pajusola K, Kaipainen A et al Vascular endothelial growth factor B, a novel growth factor for endothelial cells. Proc Natl Acad Sci USA 1996; 93: 2576–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Alvero AB, Montagna MK, Craveiro V, Liu L, Mor G. Distinct subpopulations of epithelial ovarian cancer cells can differentially induce macrophages and T regulatory cells toward a pro‐tumor phenotype. Am J Reprod Immunol 2012; 67: 256–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Ma YY, He XJ, Wang HJ et al Interaction of coagulation factors and tumor‐associated macrophages mediates migration and invasion of gastric cancer. Cancer Sci 2011; 102: 336–42. [DOI] [PubMed] [Google Scholar]
  • 15. Tjiu JW, Chen JS, Shun CT et al Tumor‐associated macrophage‐induced invasion and angiogenesis of human basal cell carcinoma cells by cyclooxygenase‐2 induction. J Invest Dermatol 2009; 129: 1016–25. [DOI] [PubMed] [Google Scholar]
  • 16. Fujimoto J, Sakaguchi H, Aoki I, Tamaya T. Clinical implications of expression of interleukin 8 related to angiogenesis in uterine cervical cancers. Cancer Res 2000; 60: 2632–5. [PubMed] [Google Scholar]
  • 17. Lissbrant IF, Stattin P, Wikstrom P, Damber JE, Egevad L, Bergh A. Tumor associated macrophages in human prostate cancer: relation to clinicopathological variables and survival. Int J Oncol 2000; 17: 445–51. [DOI] [PubMed] [Google Scholar]
  • 18. Torisu H, Ono M, Kiryu H et al Macrophage infiltration correlates with tumor stage and angiogenesis in human malignant melanoma: possible involvement of TNFalpha and IL‐1 alpha. Int J Cancer 2000; 85: 182–8. [PubMed] [Google Scholar]
  • 19. Leek RD, Hunt NC, Landers RJ, Lewis CE, Royds JA, Harris AL. Macrophage infiltration is associated with VEGF and EGFR expression in breast cancer. J Pathol 2000; 190: 430–6. [DOI] [PubMed] [Google Scholar]
  • 20. Liss C, Fekete MJ, Hasina R, Lam CD, Lingen MW. Paracrine angiogenic loop between head‐and‐neck squamous‐cell carcinomas and macrophages. Int J Cancer 2001; 93: 781–5. [DOI] [PubMed] [Google Scholar]
  • 21. White ES, Strom SR, Wys NL, Arenberg DA. Non‐small cell lung cancer cells induce monocytes to increase expression of angiogenic activity. J Immunol 2001; 166: 7549–55. [DOI] [PubMed] [Google Scholar]
  • 22. Ivarsson K, Ekerydh A, Fyhr IM, Janson PO, Brannstrom M. Upregulation of interleukin‐8 and polarized epithelial expression of interleukin‐8 receptor A in ovarian carcinomas. Acta Obstet Gynecol Scand 2000; 79: 777–84. [PubMed] [Google Scholar]
  • 23. Fasciani A, D'Ambrogio G, Bocci G, Luisi S, Artini PG, Genazzani AR. Vascular endothelial growth factor and interleukin‐8 in ovarian cystic pathology. Fertil Steril 2001; 75: 1218–21. [DOI] [PubMed] [Google Scholar]
  • 24. Herrera CA, Xu L, Bucana CD et al Expression of metastasis‐related genes in human epithelial ovarian tumors. Int J Oncol 2002; 20: 5–13. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1. Tumor necrosis factor‐α (TNF‐α) and interleukin‐1α (IL‐1α) expression. TNF‐α and IL‐1α were detected in condition medium of THP1 in serum free and THP1 induced by phorbol 12‐ myristate13‐acetate (PMA). Only TNF‐α exhibit very high expression in THP1 induced by PMA.


Articles from Cancer Science are provided here courtesy of Wiley

RESOURCES