Skip to main content
Royal Society Open Science logoLink to Royal Society Open Science
. 2020 Oct 14;7(10):201200. doi: 10.1098/rsos.201200

Adaptation of the carbamoyl-phosphate synthetase enzyme in an extremophile fish

Lewis J White 1,✉, Gemma Sutton 1, Asilatu Shechonge 2, Julia J Day 3, Kanchon K Dasmahapatra 1, Mary E Pownall 1
PMCID: PMC7657897  PMID: 33204476

Abstract

Tetrapods and fish have adapted distinct carbamoyl-phosphate synthase (CPS) enzymes to initiate the ornithine urea cycle during the detoxification of nitrogenous wastes. We report evidence that in the ureotelic subgenus of extremophile fish Oreochromis Alcolapia, CPS III has undergone convergent evolution and adapted its substrate affinity to ammonia, which is typical of terrestrial vertebrate CPS I. Unusually, unlike in other vertebrates, the expression of CPS III in Alcolapia is localized to the skeletal muscle and is activated in the myogenic lineage during early embryonic development with expression remaining in mature fish. We propose that adaptation in Alcolapia included both convergent evolution of CPS function to that of terrestrial vertebrates, as well as changes in development mechanisms redirecting CPS III gene expression to the skeletal muscle.

Keywords: urea, carbamoyl-phosphate synthetase, Alcolapia, extremophile, fish

1. Introduction

In living organisms, protein metabolism results in the production of nitrogenous wastes which need to be excreted. Most teleosts are ammonotelic, excreting their toxic nitrogenous waste as ammonia across gill tissue by diffusion. As an adaptation to living on land, amphibians and mammals are ureotelic, using liver and kidney tissues to convert waste ammonia into the less toxic and more water-soluble urea, which is then excreted in urine. Other terrestrial animals such as insects, birds and reptiles are uricolotic and convert nitrogenous waste into uric acid, which is eliminated as a paste; a process which requires more energy but wastes less water [1].

While most adult fish are ammonotelic, the larval stages of some teleosts excrete nitrogenous waste as both ammonia and urea before their gills are fully developed [2]. Additionally, some adult fish species such as the gulf toad fish (Opsanus beta; [3]) and the African catfish (Clarias gariepinus; [4]) also excrete a proportion of their nitrogenous waste as urea. This is usually in response to changes in aquatic conditions, such as high alkalinity. It has been shown experimentally that high external pH prevents diffusion of ammonia across gill tissue [5,6]. Unusually, the cichlid fish species in the subgenus Alcolapia (described by some authors as a genus but shown to nest within the genus Oreochromis) [7], which inhabit the highly alkaline soda lakes of Natron (Tanzania) and Magadi (Kenya), are reported to be 100% ureotelic [8,9].

Once part of a single palaeolake, Orolonga [10], Lakes Natron and Magadi are one of the most extreme environments supporting fish life, with water temperatures up to 42.8°C, pH approximately 10.5, fluctuating dissolved oxygen levels, and salt concentrations above 20 parts per thousand [11]. Alcolapia is the only group of fish to survive in these lakes, forming a recent adaptive radiation including the four species: Alcolapia grahami (Lake Magadi) and A. latilabris, A. ndlalani and A. alcalica (Lake Natron) [11,12]. The harsh environment of the soda lakes presents certain physiological challenges that Alcolapia have evolved to overcome, including the basic need to excrete nitrogenous waste. While other species are able to excrete urea in response to extreme conditions, none do so to the level of Alcolapia [13,14], and unlike facultative ureotelic species, the adaptation of urea production and excretion in Alcolapia is considered fixed [15]. Moreover, the heightened metabolic rate in Alcolapia, a by-product from living in such an extreme environment [8,16], requires an efficient method of detoxification.

Alcolapia and ureotelic tetrapods (including humans) detoxify ammonia using the ornithine urea cycle (OUC) where the mitochondrial enzyme carbamoyl-phosphate synthetase (CPS) is essential for the first and rate-limiting step of urea production [17]. This enzyme, together with the accessory enzyme glutamine synthase, provide an important switch regulating the balance between ammonia removal for detoxification and maintaining a source of ammonia for the biosynthesis of amino acids [18]. CPS has evolved into two biochemically distinct proteins: in terrestrial vertebrates CPS I uses ammonia as its preferential nitrogen donor, while in teleosts CPS III accepts glutamine to produce urea during larval stages (reviewed Zimmer et al. [2]). While CPS I/III are mitochondrial enzymes and part of the urea cycle, CPS II is present in the cytosol catalysing the synthesis of carbamoyl phosphate for pyrimidine nucleotide biosynthesis. CPS I/III are syntenic, representing orthologous genes; their somewhat confusing nomenclature is based on the distinct biochemical properties of their proteins. CPS I/III genes from different vertebrate species clade together, separate from CPS II (electronic supplementary material, figure). For simplicity, we will continue to refer to fish, glutamine binding CPS as CPS III and tetrapod, ammonia binding CPS as CPS I. The teleost CPS III binds glutamine in the glutamine amidotransferase (GAT) domain using two amino acid residues [19], subsequently, the nitrogen source provided by the amide group is catalysed by a conserved catalytic triad; Cys-His-Glu [20]. In terrestrial vertebrates CPS I lacks a complete catalytic triad and can only generate carbamoyl-phosphate in the presence of free ammonia [21]. This change in function from glutamine binding CPS III to ammonia binding CPS I is believed to have evolved in the stem lineage of living tetrapods, first appearing in ancestral amphibians [21].

In tetrapods and most fish, the OUC enzymes are largely localized to the liver [22], the main urogenic organ [23]. Alcolapia are different, and the primary site for urea production in these extremophile fishes is the skeletal muscle [24]. Notably, glutamine synthase activity is reportedly absent in Alcolapia muscle tissue. The kinetic properties of CPS III in Alcolapia, therefore, differ from that of other teleosts in that it preferentially uses ammonia as its primary substrate, having maximal enzymatic rates above that of binding glutamine (although it is still capable of doing so) as opposed to in other species where the use of ammonia yields enzymatic rates of around 10% to that of glutamine [24]. These rates are similar to ureotelic terrestrial species, where CPS I preferentially binds ammonia and is incapable of using glutamine [20].

Here, we report the amino acid sequence of two Alcolapia species (A. alcalica and A. grahami) that reveals a change in CPS III substrate binding site. In addition, we show that the expression of Alcolapia CPS III in skeletal muscle arises early in embryonic development where transcripts are restricted to the somites, the source of skeletal muscle in all vertebrates, and migrating myogenic precursors. We discuss changes to the structure of functional domains and modular gene enhancers that probably underpin evolutionary changes in Alcolapia CPS III substrate binding and the redirection of gene expression from the hepatogenic to myogenic lineage [25]. Our findings point to adaptation in Alcolapia including both convergent evolution of CPS function to that of terrestrial vertebrates, as well as changes in development mechanisms redirecting CPS III gene expression to the skeletal muscle.

2. Methods

2.1. Experimental animals

Fieldwork at Lake Natron, Tanzania, was conducted during June and July of 2017 to collect live specimens of the three endemic species in an attempt to produce stable breeding populations of these fishes in the UK. Live fish were all collected from a single spring (site 5 [11,26]) containing all three species found in Lake Natron and identified using morphology as described in Seegers & Tichy [12]. A stand-alone, recirculating aquarium was adapted to house male and female A. alcalica in 10 or 30 l tanks at a constant temperature of 30°C, pH 9 and salt concentration of 3800 µS at the University of York.

2.2. Expression of CPS III in adult tissues

Reverse transcription–polymerase chain reaction (RT-PCR) was used to determine the presence of CPS III in different tissues (gill, muscle, liver, brain) of three different adult A. alcalica. RNA was extracted from dissected tissues with TriReagent (Sigma-Aldrich) to the manufacturers' guidelines. For cDNA synthesis, 1 µg of total RNA was reverse transcribed with random hexamers (Thermo Scientific) and superscript IV (Invitrogen). PCR was performed on 2 µl of the above cDNA with Promega PCR master mix and 0.5 mM of each primer (forward: CAGTGGGAGGTCAGATTGC, reverse: CTCACAGCGAAGCACAGGG). Gel electrophoresis of the PCR products determined the presence or absence of CPS III RNA.

2.3. In situ hybridization

For the production of antisense probes, complementary to the mRNA of CPS III to use in in situ hybridization, the above 399 bp PCR product was ligated into PGem-tEasy and transformed into the Escherichia coli strain DH5α. This was linearized and in vitro run-off transcription was used to incorporate a DIG-labelled UTP analogue. To determine the temporal expression of these proteins in A. alcalica, embryos were collected at different stages of development (2, 4 and 7 days post fertilization (between 15 and 20 for each stage)), fixed for 1 hour in MEMFA (0.1 M MOPS pH 7.4, 2 mM EGTA, 1 mM MgSO4, 3.7% formaldehyde) at room temperature and stored at −20°C in 100% methanol. For in situ hybridization, embryos were rehydrated and treated with 10 µg mg−1 proteinase K at room temperature. After post-fixation and a 2 h pre-hybridization, embryos were hybridized with the probe at 68°C in hybridization buffer (50% formamide (Ambion), 1 mg ml−1 total yeast RNA, 5×SSC, 100 µg ml−1 heparin, 1× denharts, 0.1% Tween-20, 0.1% CHAPS, 10 mM EDTA. Embryos were extensively washed at 68°C in 2×SSC + 0.1% Tween-20, 0.2×SSC + 0.1% Tween-20 and maleic acid buffer (MAB; 100 mM maleic acid, 150 mM NaCl, 0.1% Tween-20, pH 7.8). This was replaced with pre-incubation buffer (4× MAB, 10% BMB, 20% heat-treated lamb serum) for 2 h. Embryos were incubated overnight (rolling at 4°C) with fresh pre-incubation buffer and 1/2000 dilution of anti-DIG coupled with alkaline phosphatase (AP) (Roche). These were then visualized by the application of BM purple until staining had occurred.

2.4. Sequence analysis of CPS III

cDNA was produced from the RNA extracted from whole embryos using the above method for A. alcalica and A. grahami. Multiple primer pairs (electronic supplementary material, table S1) were used to amplify fragments of CPS III from the cDNA via PCR and the products sent for sequencing. The coding region of CPS III was then constructed using multiple alignments against the CPS I and III from other species. The amino acid sequence was then examined for potential changes which could predict the functional differences seen in Alcolapia. Phylogenetic analysis was also used to confirm the Alcolapia genes analysed here are CPS III (electronic supplementary material, figure S1). To determine potential changes in the promoter region, a 3500 bp section of genome (accession number NCBI: MW014910) upstream of the transcriptional site start of CPS from A. alcalica (unpublished genome), Oreochromis niloticus (Nile tilapia), Xenopus tropicalis (western clawed frog) and Danio rerio (zebrafish) genomes was accessed on Ensembl, aligned and examined for binding sites specific to the muscle transcription factor Myod1 (E-boxes) which preferentially binds paired E-boxes in the enhancer regions of myogenic genes with the consensus motif CAG(G/C)TG, as well as E-boxes more broadly (CANNTG). The published genomes of O. niloticus, D. rerio and X. tropicalis were accessed using Ensembl, whereas the Alcolapia genome was constructed from whole-genome sequences.

3. Results

3.1. CPS III expression is activated early in the skeletal muscle lineage in A. alcalica

Analysis of gene expression of CPS III in dissected tissues of three adult A. alcalica shows that transcripts were only detected in adult muscle (figure 1a). In situ hybridization methods on A. alcalica embryos at different stages were carried out to investigate whether this restricted muscle expression was established during development (figure 1b–f). Blue coloration indicates hybridization of the complementary RNA probe and shows the strongest expression in the developing somites along the body axis (black arrows). Expression was also detected in migratory muscle precursors (MMP; black arrowheads), which go on to form the body wall and limb musculature, and in the developing pectoral fin buds (white arrows). All regions of the embryo that show expression of CPS III are in the muscle lineage indicating that in A. alcalica CPS III expression is restricted to muscle tissues in both adults and the developing embryo.

Figure 1.

Figure 1.

Expression analysis of carbamoyl-phosphate synthetase III (CPS III) from adult tissues and developing embryos of Alcolapia alcalica. (a) Reverse transcriptase PCR and gel electrophoresis showing the muscle-specific expression of CPS III, EF1α shown as normalization control. (b–f) Lateral (c and e) and dorsal (b, d and f) views of in situ hybridization for CPS III in developing A. alcalica embryos at different stages (number of days post fertilization [dpf] indicated). The blue colour indicates the detection of mRNA. The black/brown is endogenous pigment apparent in the retina and the chromatophores. Black arrows show somites, black arrowheads indicate region of migrating muscle progenitors (MMP), white arrows show facial muscle (FM) and white arrowheads indicate developing pectoral fin bud (PFB). Black dots around the yolk and on the body are chromatophores (pigment cells).

Many muscle-specific genes are activated during development by the muscle-specific transcription factor, MyoD. The promoter region of CPS III (3.5 kb upstream of the transcriptional start site) in A. alcalica was compared to that in O. niloticus, X. tropicalis and D. rerio (figure 2). Examination of this region revealed a putative paired E-box MyoD binding site 940–970 bases (CAGGTGACTGTGATTATATAGTTCACAGGTG) upstream of the transcriptional start site of CPS III only in Alcolapia species. Intriguingly, while no pair of MyoD E-boxes were found in the upstream region of any other species examined, O. niloticus does have a single MyoD E-box motif in the same region upstream of CPS III, and within 19 bases of this is a CAGGTT motif which a single point mutation would convert into a pair of E-boxes (CAGGTGACTGTGATTATATAGTTCACAGGTT). This suggests that it is possible that MyoD could bind and activate transcription of CPS III in the muscle of Alcolapia species, but not in the closely related O. niloticus.

Figure 2.

Figure 2.

Sequence comparison of a 3500 bp region upstream of exon 1 of CPS III. Presence of generic E-box sites with the consensus motif of CANNTG are annotated by black bars and MyoD preferential E-box motifs of CAG(G/C)TG are represented by blue bars. Insert shows sequence of Alcolapia alcalica potential paired E-box, MyoD enhancer (blue nucleotides) compared to Oreochromis niloticus which has a single MyoD E-box upstream of a ‘presumptive' MyoD E-box (red nucleotides).

3.2. Convergent evolution in the adaptive function of CPS III

Sequence analysis of A. alcalica and A. grahami CPS III revealed a discrepancy in the catalytic triad compared to the published sequence for CPS III in A. grahami (accession number NCBI: AF119250). The coding region for A. alcalica and A. grahami was cloned and sequenced (accession numbers NCBI: MT119353, MT119354). Our data confirmed the error in the published sequence of A. grahami CPS III and shows Alcolapia species maintain a catalytic triad essential for catalysing the breakdown of glutamine (red boxes in figure 3). However, similar to terrestrial vertebrate CPS I which lack either one but usually both residues essential for binding glutamine for utilization by the catalytic triad (arrowheads in figure 3), Alcolapia also lack one of these residues (asterisk in figure 3). This amino acid sequence is consistent with a change in function permitting Alcolapia CPS III to bind and catalyse ammonia directly, an activity usually restricted to terrestrial vertebrate CPS I, as elucidated by extensive previous biochemical analyses [20,21].

Figure 3.

Figure 3.

Multiple amino acid alignment of residues 278–397 (aligned to Alcolapia alcalica) of carbamoyl-phosphate synthetase I and III from a number of tetrapod and teleost species, respectively. Conserved amino acids are shaded in black, amino acids in the catalytic triad are boxed in red and arrowheads indicate residues vital for glutamine utilization of the catalytic triad. The blue asterisk indicates the divergent glutamine binding residue in Alcolapia species that probably results in a functional change (inability to bind glutamine).

4. Discussion

While most teleosts are ammonotelic, larval fish can convert ammonia to urea for excretion and to do so express the genes coding for the enzymes of the OUC, including CPS III [27]. Later these genes are silenced in most fish. In the rare cases where urea is produced in adult fish, the OUC enzymes are expressed in the liver [23]; however, there are some reports of expression in non-hepatic tissues [28,29]. We report here the expression of CPS III in the muscle of adult A. alcalica, which is consistent with the detection of CPS III protein and enzyme activity in muscle of A. grahami [24]. We also find conserved changes to the amino acid sequence which explains the convergent evolution of A. alcalica and A. grahami CPS III function with CPS I in terrestrial vertebrates. This conserved change in both Alcolapia species suggests that the adaptations in the OUC are likely to have evolved in the ancestral species inhabiting palaeolake Orolongo during the period of changing aquatic conditions (over the past 10 000 years) that led to the extreme conditions currently found in Lakes Natron and Magadi.

4.1. Activation of CPS III in the myogenic lineage

We find that the expression of CPS III is activated in somites and in migratory muscle precursors that will form body wall and limb musculature (indeed expression is seen in developing limb buds). All skeletal muscle in the vertebrate body is derived from the somites, and these CPS III expression patterns are similar to those of muscle-specific genes like myosin, actins and troponins [30–32].

Muscle-specific expression of CPS III in A. alcalica embryos is a remarkable finding as most ureotelic species convert nitrogenous waste to urea in the liver [8,20]. The expression of CPS III, the first enzyme in the OUC, in muscle tissue is probably significant for supporting the high catabolism in a fish species with the highest recorded metabolic rate [33]. There are few reports of some OUC gene expression or enzyme activity in non-hepatic tissue including muscle [28,29,34]; nonetheless, other fish species only evoke the activity of the OUC when exposed to high external pH or during larval stages [13,14,35,36], and even then, urea production is never to the high level of activity occurring in Alcolapia [24]. There is some heterogeneity of the expression patterns of CPS III during the development of different species in the teleost lineage; for example, D. rerio has reported expression in the body [37], Oncorhynchus mykiss (rainbow trout) shows expression in the developing body but not in hepatic tissue [38] and C. gariepinus (African catfish) had CPS III expression detected in the dissected muscle from larvae [4]. The early and sustained expression of CPS III in the muscle lineage is at this point an observation unique to Alcolapia.

Skeletal muscle-specific gene expression is activated in cells of the myogenic lineage by a family of bHLH transcription factors, including MyoD [30]. MyoD binds specifically at paired E-boxes in the enhancers of myogenic genes with a preference for the consensus motif of CAG(G/C)TG [39,40]. MyoD is known to require the cooperative binding at two E-boxes in close proximity, to modulate transcription of myogenic genes [41]. The presence of a pair of E-boxes in Alcolapia, upstream of a gene which has switched to muscle-specific expression, is suggestive that MyoD is driving expression early in development. Enhancer modularity is a known mechanism for selectable variation [42] and although a single MyoD binding site does not define an enhancer, MyoD is known to interact with pioneer factors and histone deacetylases to open chromatin and activate gene transcription in the muscle lineage [40,43]. Experimental analysis to determine the activity of any regulatory sequences upstream of OUC genes in different species would shed light on the significance of putative transcription factor binding sites. This approach could also address another intriguing question as to the elements that drive the post-larval silencing of OUC genes in most fish species [37], an area with only minimal research, especially when compared to the well-characterized promoter region in mammalian species, for instance, Christoffels et al. [44]. A further instance of an extremophile organism redirecting the expression of a hepatic enzyme to muscle tissue occurs in the crucian carp [45]. Under conditions of anoxia, this species switches to anaerobic metabolism, producing ethanol as the end product of glycolysis [46,47]. This is associated with the expression of alcohol dehydrogenase in muscle [48]. Together with our findings, this potentially reveals an example of convergent evolution whereby the muscle becomes the site for detoxifying by-products of metabolism. Elucidating any mechanisms that may include modular enhancers that facilitate the adaptation of gene regulation in response to changing environmental conditions will be of significant interest.

4.2. Convergent evolution of adaptive CPS III function

CPS proteins catalyse the production of carbamoyl-phosphate as the first step in nitrogen detoxification by accepting either glutamine or ammonia as a nitrogen donor [17]. Teleost CPS III binds glutamine: the nitrogen source provided by the amide group of glutamine is catalysed by the conserved catalytic triad Cys-His-Glu in the glutamine amidotransferase (GAT) domain in the amino terminal part of CPS [20]. In terrestrial vertebrates, CPS I lacks the catalytic cysteine residue and only generates carbamoyl-phosphate in the presence of free ammonia [21]. Although CPS in Alcolapia shares the most sequence identity with fish CPS III (figure 3), its ammonia binding activity is more similar in function to terrestrial vertebrate CPS I [20,24]. This adaptation to preferentially bind ammonia over glutamine supports efficient waste management in a fish with an exceptionally high metabolic rate [33]. CPS I in terrestrial vertebrates have amino acid changes in the catalytic triad which explains their binding ammonia over glutamine; a reduction in glutamine binding capacity drives the use of ammonia [21]. Here, we show that Alcolapia maintain the catalytic triad, but (similar to mouse and human) lack one of the two residues required for efficient glutamine binding, weakening its affinity to glutamine and driving the use of ammonia as a primary substrate.

The interesting observation that bullfrog (Rana catesbeiana) CPS I retains the catalytic triad, but lacks the two additional conserved amino acids required for glutamine binding, has led to the suggestion that the change from preferential glutamine to ammonia binding originally evolved in the early tetrapod lineage [21]. A further frog species, the tree frog Litoria caerulea, retains its catalytic triad and only one of the two residues required for glutamine binding has been altered, weakening its affinity for glutamine and allowing for direct catabolism of ammonia [49]. Much the same as in Alcolapia, L. caerulea CPS I is still capable of using glutamine to some extent which lends further support to the notion that the evolutionary transition from CPS III to CPS I occurring in amphibians and the early tetrapod lineage. The changes in the protein sequence of Alcolapia CPS III represents a convergent evolution in this extremophile fish species, with acquired changes in functionally important domains which probably also evolved in early terrestrial vertebrate CPS I.

5. Conclusion

Alcolapia have acquired multiple adaptations that allow continued excretion of nitrogenous waste in a high pH environment. Among these is the novel expression of CPS in skeletal muscle, as well as the acquisition of mutations that change its function. Sequence evidence indicates that like terrestrial vertebrates, and unique among fish, Alcolapia CPS III is capable of binding and catalysing the breakdown of ammonia to carbamoyl-phosphate; a convergent evolution of CPS function. The mechanism by which the novel and unique expression of CPS in muscle evolved is probably a function of enhancer regions of A. alcalica and A. grahami that result in its regulation by muscle regulatory factors to direct CPS expression in the myogenic lineage during embryonic development. Environmentally driven adaptations have resulted in changes in both the expression and activity of CPS III in Alcolapia that underpin its ability to turn over nitrogenous waste in a challenging environment while maintaining a high metabolic rate.

Supplementary Material

Table of primers for sequencing CPS III
rsos201200supp1.docx (12KB, docx)
Reviewer comments

Supplementary Material

Phylogenetic analysis of CPSI, II and III
rsos201200supp2.docx (26.4KB, docx)

Supplementary Material

Sequences of CPS in A. grahami and A. alcalica (CDS)
rsos201200supp3.fas (8.9KB, fas)

Acknowledgements

The authors are grateful to Antonia Ford and George Turner for their help in collecting the fish from Lake Natron (COSTECH permit no. 2017-259-NA-2011-182) and their continued support in this project.

Ethics

The research was approved by the University of York AWERB and under the Home Office licence for Dr. M.E. Pownall (POF 245945).

Data accessibility

Sequence data has been made available on NCBI (accession numbers: MT119353, MT119354) and in the electronic supplementary material, files.

Authors' contributions

Experiments were designed by L.J.W. and M.E.P., work was carried out by L.J.W. and G.S. and the manuscript written and edited by all authors. L.J.W., J.J.D. and A.S. collected the fish from Lake Natron.

Competing interests

We declare we have no competing interests.

Funding

This work was supported by the BBSRC as a studentship to L.J.W. (BB/M011151/1). Additional support for fieldwork was provided by the Fisheries Society of the British Isles (small research grant) and the Genetics Society (Heredity fieldwork grant).

References

  • 1.Wright PA. 1995. Nitrogen excretion: three end products, many physiological roles. J. Exp. Biol. 198, 273–281. [DOI] [PubMed] [Google Scholar]
  • 2.Zimmer AM, Wright PA, Wood CM. 2017. Ammonia and urea handling by early life stages of fishes. J. Exp. Biol. 220, 3843–3855. ( 10.1242/jeb.140210) [DOI] [PubMed] [Google Scholar]
  • 3.Barimo JF, Steele SL, Wright PA, Walsh PJ. 2004. Dogmas and controversies in the handling of nitrogenous wastes: ureotely and ammonia tolerance in early life stages of the gulf toadfish, Opsanus beta. J. Exp. Biol. 207, 2011–2020. ( 10.1242/jeb.00956) [DOI] [PubMed] [Google Scholar]
  • 4.Terjesen BF, Chadwick TD, Verreth JA, Rønnestad I, Wright PA. 2001. Pathways for urea production during early life of an air-breathing teleost, the African catfish Clarias gariepinus Burchell. J. Exp. Biol. 204, 2155–2165. [DOI] [PubMed] [Google Scholar]
  • 5.Handy R, Poxton M. 1993. Nitrogen pollution in mariculture: toxicity and excretion of nitrogenous compounds by marine fish. Rev. Fish Biol. Fish. 3, 205–241. ( 10.1007/BF00043929) [DOI] [Google Scholar]
  • 6.Wright PA, Wood C. 1985. An analysis of branchial ammonia excretion in the freshwater rainbow trout: effects of environmental pH change and sodium uptake blockade. J. Exp. Biol. 114, 329–353. [Google Scholar]
  • 7.Ford AGP, et al. 2019. Molecular phylogeny of Oreochromis (Cichlidae: Oreochromini) reveals mito-nuclear discordance and multiple colonisation of adverse aquatic environments. Mol. Phylogenet. Evol. 136, 215–226. ( 10.1016/j.ympev.2019.04.008) [DOI] [PubMed] [Google Scholar]
  • 8.Randall D, Wood C, Perry S, Bergman H, Maloiy G, Mommsen T, Wright PA. 1989. Urea excretion as a strategy for survival in a fish living in a very alkaline environment. Nature 337, 165–166. ( 10.1038/337165a0) [DOI] [PubMed] [Google Scholar]
  • 9.Wilson PJ, Wood CM, Walsh PJ, Bergman AN, Bergman HL, Laurent P, White BN. 2004. Discordance between genetic structure and morphological, ecological, and physiological adaptation in Lake Magadi tilapia. Physiol. Biochem. Zool. 77, 537–555. ( 10.1086/422054) [DOI] [PubMed] [Google Scholar]
  • 10.Roberts N, Taieb M, Barker P, Damnati B, Icole M, Williamson D. 1993. Timing of the Younger Dryas event in East Africa from lake-level changes. Nature 366, 146–148. ( 10.1038/366146a0) [DOI] [Google Scholar]
  • 11.Ford AGP, Dasmahapatra KK, Rüber L, Gharbi K, Cezard T, Day JJ. 2015. High levels of interspecific gene flow in an endemic cichlid fish adaptive radiation from an extreme lake environment. Mol. Ecol. 24, 3421–3440. ( 10.1111/mec.13247) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Seegers L, Tichy H. 1999. The Oreochromis alcalicus flock (Teleostei: Cichlidae) from lakes Natron and Magadi, Tanzania and Kenya, with descriptions of two new species. Ichthyol. Explor. Freshw. 10, 97–146. [Google Scholar]
  • 13.Walsh P, Danulat E, Mommsen T. 1990. Variation in urea excretion in the gulf toadfish Opsanus beta. Mar. Biol. 106, 323–328. ( 10.1007/BF01344308) [DOI] [Google Scholar]
  • 14.Wright PA, Iwama GK, Wood CM. 1993. Ammonia and urea excretion in Lahontan cutthroat trout (Oncorhynchus clarki henshawi) adapted to the highly alkaline Pyramid Lake (pH 9.4). J. Exp. Biol. 175, 153–172. [Google Scholar]
  • 15.Wood CM, Wilson P, Bergman HL, Bergman AN, Laurent P, Otiang'a-Owiti G, Walsh PJ. 2002. Obligatory urea production and the cost of living in the Magadi tilapia revealed by acclimation to reduced salinity and alkalinity. Physiol. Biochem. Zool. 75, 111–122. ( 10.1086/340626) [DOI] [PubMed] [Google Scholar]
  • 16.Kavembe GD, Franchini P, Irisarri I, Machado-Schiaffino G, Meyer A. 2015. Genomics of adaptation to multiple concurrent stresses: insights from comparative transcriptomics of a cichlid fish from one of earth's most extreme environments, the Hypersaline Soda Lake Magadi in Kenya, East Africa. J. Mol. Evol. 81, 90–109. ( 10.1007/s00239-015-9696-6) [DOI] [PubMed] [Google Scholar]
  • 17.Rubio V, Cervera J. 1995. The carbamoyl-phosphate synthase family and carbamate kinase: structure-function studies. Biochem. Soc. Trans. 23, 879–883. ( 10.1042/bst0230879) [DOI] [PubMed] [Google Scholar]
  • 18.de Cima S, Polo LM, Díez-Fernández C, Martínez AI, Cervera J, Fita I, Rubio V. 2015. Structure of human carbamoyl phosphate synthetase: deciphering the on/off switch of human ureagenesis. Sci. Rep. 5, 16950 ( 10.1038/srep16950) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hong J, Salo WL, Lusty CJ, Anderson PM. 1994. Carbamyl phosphate synthetase III, an evolutionary intermediate in the transition between glutamine-dependent and ammonia-dependent carbamyl phosphate synthetases. Mol. Biol. 243, 131–140. ( 10.1006/jmbi.1994.1638) [DOI] [PubMed] [Google Scholar]
  • 20.Loong A, Chng Y, Chew S, Wong W, Ip Y. 2012. Molecular characterization and mRNA expression of carbamoyl phosphate synthetase III in the liver of the African lungfish, Protopterus annectens, during aestivation or exposure to ammonia. J. Comp. Physiol. B 182, 367–379. ( 10.1007/s00360-011-0626-7) [DOI] [PubMed] [Google Scholar]
  • 21.Saeed-Kothe A, Powers-Lee SG. 2002. Specificity determining residues in ammonia- and glutamine-dependent carbamoyl phosphate synthetases. J. Biol. Chem. 277, 7231–7238. ( 10.1074/jbc.M110926200) [DOI] [PubMed] [Google Scholar]
  • 22.Ip AY, Chew SF. 2010. Ammonia production, excretion, toxicity, and defense in fish: a review. Front. Physiol. 1, 134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mommsen TP, Walsh PJ. 1989. Evolution of urea synthesis in vertebrates: the piscine connection. Science 243, 72–75. ( 10.1126/science.2563172) [DOI] [PubMed] [Google Scholar]
  • 24.Lindley TE, Scheiderer CL, Walsh PJ, Wood CM, Bergman HL, Bergman AL, Laurent P, Wilson P, Anderson PM. 1999. Muscle as the primary site of urea cycle enzyme activity in an alkaline lake-adapted tilapia, Oreochromis alcalicus grahami. J. Biol. Chem. 274, 29 858–29 861. ( 10.1074/jbc.274.42.29858) [DOI] [PubMed] [Google Scholar]
  • 25.Rebeiz M, Tsiantis M. 2017. Enhancer evolution and the origins of morphological novelty. Curr. Opin Genet. Dev. 45, 115–123. ( 10.1016/j.gde.2017.04.006) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ford AGP, Rüber L, Newton J, Dasmahapatra KK, Balarin JD, Bruun K, Day JJ. 2016. Niche divergence facilitated by fine-scale ecological partitioning in a recent cichlid fish adaptive radiation. Evolution 70, 2718–2735. ( 10.1111/evo.13072) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zimmer AM, Wood CM. 2016. Physiological and molecular ontogeny of branchial and extra-branchial urea excretion in posthatch rainbow trout (Oncorhynchus mykiss). Am. J. Physiol.-Regul. Integr. Comp. Physiol. 310, R305–RR12. ( 10.1152/ajpregu.00403.2015) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Korte JJ, Salo WL, Cabrera VM, Wright PA, Felskie AK, Anderson PM. 1997. Expression of carbamoyl-phosphate synthetase III mRNA during the early stages of development and in muscle of adult rainbow trout (Oncorhynchus mykiss). J. Biol. Chem. 272, 6270–6277. ( 10.1074/jbc.272.10.6270) [DOI] [PubMed] [Google Scholar]
  • 29.Banerjee B, Koner D, Hasan R, Saha N. 2020. Molecular characterization and ornithine-urea cycle genes expression in air-breathing magur catfish (Clarias magur) during exposure to high external ammonia. Genomics 112, 2247–2260. ( 10.1016/j.ygeno.2019.12.021) [DOI] [PubMed] [Google Scholar]
  • 30.Pownall ME, Gustafsson MK, Emerson CP Jr. 2002. Myogenic regulatory factors and the specification of muscle progenitors in vertebrate embryos. Annu. Rev. Cell Dev. Biol. 18, 747–783. ( 10.1146/annurev.cellbio.18.012502.105758) [DOI] [PubMed] [Google Scholar]
  • 31.Talbot JC, Teets EM, Ratnayake D, Duy PQ, Currie PD, Amacher SL. 2019. Muscle precursor cell movements in zebrafish are dynamic and require six family genes. Development 146, dev171421 ( 10.1242/dev.171421) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Bucher EA, Maisonpierre P, Konieczny S, Emerson C. 1988. Expression of the troponin complex genes: transcriptional coactivation during myoblast differentiation and independent control in heart and skeletal muscles. Mol. Cell. Biol. 8, 4134–4142. ( 10.1128/MCB.8.10.4134) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wood CM, et al. 2016. Mammalian metabolic rates in the hottest fish on earth. Sci. Rep. 6, 26990 ( 10.1038/srep26990) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Kong H, Edberg DD, Korte JJ, Salo WL, Wright PA, Anderson PM. 1998. Nitrogen excretion and expression of carbamoyl-phosphate synthetase III activity and mRNA in extrahepatic tissues of largemouth bass (Micropterus salmoides). Arch. Biochem. Biophys. 350, 157–168. ( 10.1006/abbi.1997.0522) [DOI] [PubMed] [Google Scholar]
  • 35.Randall DJ, Tsui T. 2002. Ammonia toxicity in fish. Mar. Pollut. Bull. 45, 17–23. ( 10.1016/S0025-326X(02)00227-8) [DOI] [PubMed] [Google Scholar]
  • 36.Mommsen TP, Walsh PJ. 1991. Urea synthesis in fishes: evolutionary and biochemical perspectives. Biochem. Mol. Biol. Fish. 1, 137–163 [Google Scholar]
  • 37.LeMoine CM, Walsh PJ. 2013. Ontogeny of ornithine-urea cycle gene expression in zebrafish (Danio rerio). Am. J. Physiol. Regul. Integr. Comp. Physiol. 304, R991–R1000. ( 10.1152/ajpregu.00411.2012) [DOI] [PubMed] [Google Scholar]
  • 38.Steele SL, Chadwick TD, Wright PA. 2001. Ammonia detoxification and localization of urea cycle enzyme activity in embryos of the rainbow trout (Oncorhynchus mykiss) in relation to early tolerance to high environmental ammonia levels. J. Exp. Biol. 204, 2145–2154. [DOI] [PubMed] [Google Scholar]
  • 39.Fong AP, Yao Z, Zhong JW, Cao Y, Ruzzo WL, Gentleman RC, Tapscott SJ. 2012. Genetic and epigenetic determinants of neurogenesis and myogenesis. Dev. Cell 22, 721–735. ( 10.1016/j.devcel.2012.01.015) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Conerly ML, Yao Z, Zhong JW, Groudine M, Tapscott SJ. 2016. Distinct activities of Myf5 and MyoD indicate separate roles in skeletal muscle lineage specification and differentiation. Dev. Cell 36, 375–385. ( 10.1016/j.devcel.2016.01.021) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Weintraub H, Davis R, Lockshon D, Lassar A. 1990. MyoD binds cooperatively to two sites in a target enhancer sequence: occupancy of two sites is required for activation. Proc. Natl Acad. Sci. USA 87, 5623–5627. ( 10.1073/pnas.87.15.5623) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Shapiro MD, Marks ME, Peichel CL, Blackman BK, Nereng KS, Jónsson B, Schluter D, Kingsley DM. 2004. Genetic and developmental basis of evolutionary pelvic reduction in threespine sticklebacks. Nature 428, 717 ( 10.1038/nature02415) [DOI] [PubMed] [Google Scholar]
  • 43.Berkes CA, Bergstrom DA, Penn BH, Seaver KJ, Knoepfler PS, Tapscott SJ. 2004. Pbx marks genes for activation by MyoD indicating a role for a homeodomain protein in establishing myogenic potential. Mol. Cell 14, 465–477. ( 10.1016/S1097-2765(04)00260-6) [DOI] [PubMed] [Google Scholar]
  • 44.Christoffels VM, Grange T, Kaestner KH, Cole TJ, Darlington GJ, Croniger CM, Lamers WH. 1998. Glucocorticoid receptor, C/EBP, HNF3, and protein kinase A coordinately activate the glucocorticoid response unit of the carbamoylphosphate synthetase I gene. Mol. Cell. Biol. 18, 6305–6315. ( 10.1128/MCB.18.11.6305) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Fagernes CE, Stensløkken K-O, Røhr ÅK, Berenbrink M, Ellefsen S, Nilsson GE. 2017. Extreme anoxia tolerance in crucian carp and goldfish through neofunctionalization of duplicated genes creating a new ethanol-producing pyruvate decarboxylase pathway. Sci. Rep. 7, 7884 ( 10.1038/s41598-017-07385-4) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Johnston IA, Bernard LM. 1983. Utilization of the ethanol pathway in carp following exposure to anoxia. J. Exp. Biol. 104, 73–78. [Google Scholar]
  • 47.Dhillon RS, Mandic M, Yao L, Cao Z-D, Fu S-J, Brauner CJ, Wang YS, Richards JG. 2018. Ethanol metabolism varies with hypoxia tolerance in ten cyprinid species. J. Comp. Physiol. B 188, 283–293. ( 10.1007/s00360-017-1131-4) [DOI] [PubMed] [Google Scholar]
  • 48.Nilsson GE. 1988. A comparative study of aldehyde dehydrogenase and alcohol dehydrogenase activities in crucian carp and three other vertebrates: apparent adaptations to ethanol production. J. Comp. Physiol. B 158, 479–485. ( 10.1007/BF00691145) [DOI] [PubMed] [Google Scholar]
  • 49.Ip YK, Loong AM, Chng YR, Hiong KC, Chew SF. 2012. Hepatic carbamoyl phosphate synthetase (CPS) I and urea contents in the hylid tree frog, Litoria caerulea: transition from CPS III to CPS I. J. Comp. Physiol. B 182, 1081–1094. ( 10.1007/s00360-012-0682-7) [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table of primers for sequencing CPS III
rsos201200supp1.docx (12KB, docx)
Reviewer comments
Phylogenetic analysis of CPSI, II and III
rsos201200supp2.docx (26.4KB, docx)
Sequences of CPS in A. grahami and A. alcalica (CDS)
rsos201200supp3.fas (8.9KB, fas)

Data Availability Statement

Sequence data has been made available on NCBI (accession numbers: MT119353, MT119354) and in the electronic supplementary material, files.


Articles from Royal Society Open Science are provided here courtesy of The Royal Society

RESOURCES