Skip to main content
NCBI home page
ZooKeys logoLink to ZooKeys
. 2020 Nov 4;984:1–21. doi: 10.3897/zookeys.984.56380

New record of Nausithoe werneri (Scyphozoa, Coronatae, Nausithoidae) from the Brazilian coast and a new synonymy for Nausithoe maculata

Clarissa Garbi Molinari 1,✉, Maximiliano Manuel Maronna 1, André Carrara Morandini 1,2
PMCID: PMC7658188  PMID: 33223866

Abstract

The order Coronatae (Scyphozoa) includes six families, of which Nausithoidae Haeckel, 1880 is the most diverse with 26 species. Along the Brazilian coast, three species of the genus Nausithoe Kölliker, 1853 have been recorded: Nausithoe atlantica Broch, 1914, Nausithoe punctata Kölliker, 1853, and Nausithoe aurea Silveira & Morandini, 1997. Living polyps (n = 9) of an unidentified nausithoid were collected in September 2002 off Arraial do Cabo (Rio de Janeiro, southeastern Brazil) at a depth of 227 m, and have been kept in culture since then. We compared these specimens with three species cultured in our laboratory: Nausithoe aurea (from Ilhabela, São Paulo, Brazil), Nausithoe maculata Jarms, 1990 (from Cuba and Puerto Rico), and Nausithoe werneri Jarms, 1990 (from the Atlantic Ocean off Morocco and from the Mediterranean Sea). The criteria used for comparison were: main aspects of the morphology, life cycle, and DNA sequences (18S, 28S, and COI). The results indicate that the unidentified polyps belong to N. werneri. Furthermore, N. aurea is considered a junior synonym of N. maculata.

Keywords: Coronamedusae, jellyfish, life cycle, periderm, polyp, scyphomedusae, systematics

Introduction

The class Scyphozoa Goette, 1887 (true jellyfishes) comprises two main clades: Coronamedusae Calder, 2009 and Discomedusae Haeckel, 1880 (Jarms and Morandini 2019). The Coronamedusae have a single class, Coronatae Vanhöffen, 1892, which is mostly known from the deep-sea medusae of the genera Atolla Haeckel, 1880, Periphylla Müller, 1861, and Paraphyllina Maas, 1903. In addition, the group also includes several shallow-water species in the genera Nausithoe Kölliker, 1853 and Linuche Eschscholtz, 1829 (Jarms and Morandini 2019). Coronate species are distinguished from other scyphomedusae by the presence of a coronal furrow (groove) on the exumbrella (Mayer 1910; Russell 1970). Of the 59 species of coronates, the life cycles of 16 have been described (Jarms 2010). All of these have a metagenetic life cycle, with the holoplanktonic Periphylla periphylla (Péron & Lesueur, 1810) as an exception (Jarms et al. 1999). An additional feature of coronates is the presence of a periderm tube in species that have a known polyp stage (Russell 1970; Jarms 1991).

The high morphological similarity among polyps in this order and the difficulty in relating the polyp to the medusa (as they are usually not collected together) have led to two classification systems. Polyps were historically identified only as “Coronatae polyps” or were classified as belonging to the genus Stephanoscyphus Allman, 1874 (later changed to Stephanoscyphistoma Jarms, 1990, to accommodate these specimens). Studying the life cycle has been essential for advancing the systematics and understand the evolution of the group (Jarms 1990, 2010). Such an approach allows integration of the two classification systems, ensuring more precise recognition, diagnosis, and eventual identification of species and specimens.

Recent studies have advanced our taxonomic understanding of the group, using morphological characters of the periderm tube to differentiate species relying only on the polyp stage (Morandini and Jarms 2005, 2010, 2012). These characters consist of several tube measurements (total length, opening diameter, and diameter at different heights along the tube, following Jarms 1990, 1991), the number of internal cusps, and differentiation of the tube’s external ornamentation (number of rings). Although useful to distinguish genera and some species, this analysis is not as effective in differentiating all species, especially in the genus Nausithoe (Molinari and Morandini 2019). These limitations are even more evident in the sister clade Discomedusae, in which species cannot be identified solely on the polyp stage (van Walraven et al. 2020). Thus, it is important to state that genetic information, together with morphological data, has been fundamental in differentiating and identifying cnidarian species (Dawson 2005; Gómez Daglio and Dawson 2017).

The order Coronatae is composed of six families (13 genera and 59 species), of which Nausithoidae Haeckel, 1880, is the most speciose, with three genera and 26 species (Jarms and Morandini 2019). The most diverse genus, Nausithoe, contains 22 accepted species, which are distributed worldwide in shallow to deep waters, and from the tropics to polar regions (Jarms and Morandini 2019). Along the coast and in offshore territorial waters of Brazil, three species of the family have been described or recorded: the medusae of Nausithoe atlantica Broch, 1913 and Nausithoe punctata Kölliker, 1853, and the polyp of Nausithoe aurea Silveira & Morandini, 1997 (Oliveira et al. 2016).

The purpose of this study was to identify coronate polyps from the Brazilian continental slope off Arraial do Cabo (southeastern Brazil, western South Atlantic) and to compare them with the other known species from the Atlantic Ocean and the Brazilian coast, and thus, to improve our knowledge of coronate biodiversity and distribution.

Materials and methods

Deep-sea specimens from Brazil were collected during a cruise of the Navio Oceanográfico Prof. Wladimir Besnard off the coast of Arraial do Cabo (Rio de Janeiro state, southeastern Brazil, 23°45.80'S, 41°44.40'W) on 15 September 2002, at a depth of 227 m. Calcareous substrates were collected using a box-corer, and the polyps were found on these. The collected polyps were provisionally named Nausithoe sp. and numbered as follows: AC01, AC02, AC08, AC10, AC17, AC18, and AC20 (Table 2). They were kept alive in small dishes for a few days aboard ship (under room temperature 20–23 °C) and brought to the laboratory on 18 September 2002. Since their establishment in culture, three polyps (AC01, AC02, and AC10) reproduced asexually by forming tissue balls from the ephyrae (Fig. 1A, B), consistent with the observations of Silveira et al. (2003).

Table 2.

Measurements of the polyps according to Jarms (1990) and Jarms et al. (2002). Specimens of Nausithoe sp. were measured twice, in 2002 and 2018 (except for tissue balls, measured only in 2018). Da = diameter at aperture, Dbd = diameter of basal disc, Db = diameter just above basal disc, D2 mm = diameter at 2 mm height, D5 mm = diameter at 5 mm height, Ltot = total length, Nwt = number of whorls of internal cusps, Nw = number of cusps per whorl, – = not measured.

Polyp ID Ltot (mm) Da (mm) Ddb (mm) Db (mm) D2 mm D5 mm Da/Ltot Nwt Nw
AC01 (2002) 6.60 0.70 – – 0.35 0.45 0.1061 7 8 / 16
AC01 (2018) 13.46 1.29 – – – – 0.0958
AC02 (2002) 11.15 0.90 – 0.15 0.30 0.50 0.0807 8 8 / 16
AC02 (2018) 17.74 1.09 – – – – 0.0614
AC02 (tissue ball 2018) 15.71 1.17 – 0.14 0.09 0.44 0.0746 6 8 / 16
AC08 (2002) 9.10 – – 0.30 0.50 0.0769 9 8 / 16
AC08 (2018) 16.44 1.00 – – – – 0.0608
AC10 (2002) 14.25 1.15 – 0.15 0.20 0.40 0.0807 12 8 / 16
AC10 (2018) 15.33 1.15 – – – – 0.0753
AC10 (tissue ball 2018) 11.79 0.92 0.66 0.15 0.09 0.46 0.0782 6 8 / 16
AC17 (2002) 5.05 0.55 – 0.40 0.45 0.55 0.1089 9 8 / 16
AC17 (2018) 20.20 1.65 – – – – 0.0818
AC18 (2002) 10.50 0.95 – 0.15 0.35 0.5 0.0905 5 8 / 16
AC18 (2018) 12.27 1.02 – – – – 0.0830
AC20 (2002) 5.15 0.35 – 0.20 0.30 0.35 0.0680 10 8 / 16
AC20 (2018) 20.13 1.47 – – – – 0.0733
Mean ± SD (2002) 8.83 ± 3.17 0.77 ± 0.27 – 0.21 ± 0.10 0.32 ± 0.07 0.46 ± 0.06 0.09 ± 0.01 8 ± 3 8 / 16
Mean ± SD (2018) 15.90 ± 2.91 1.20 ± 0.22 0.66 ± 0 0.15 ± 0 0.09 ± 0 0.45 ± 0 0.08 ± 0.01
N. werneri 1 11.35 1.29 0.53 0.11 0.12 0.15 0.1139 6 8
N. werneri 2 15.27 0.95 – 0.23 0.11 0.17 0.0620 6 8
N. werneri 3 31.43 0.93 0.24 0.07 0.07 0.07 0.0297 7 8
N. werneri 4 19.37 1.28 0.40 0.08 0.08 0.11 0.0660 13 8
N. werneri 5 13.70 1.02 0.29 0.09 0.09 0.13 0.0744 8 8
N. werneri 6 5.24 0.55 – 0.10 0.10 0.11 0.1048 8 8
N. werneri 7 13.49 0.68 0.35 0.08 0.09 0.13 0.0502 14 8
N. werneri 8 6.47 0.65 0.34 0.08 0.12 0.15 0.1003 8 8
N. werneri 9 2.56 0.33 0.30 0.10 – 0.13 0.1293 7 8
Mean ± SD 13.21 ± 8.17 0.85 ± 0.31 0.35 ± 0.09 0.10 ± 0.05 0.10 ± 0.02 0.13 ± 0.03 0.08 ± 0.03 8.56 ± 2.75 8
N. maculata 1 13.58 0.88 0.42 0.15 0.12 0.14 0.0646 3 16
N. maculata 2 14.41 1.21 – – – – 0.0843 – 16
N. maculata 3 15.01 1.18 – – – – 0.0785 – –
N. maculata 4 18.64 1.08 – – – – 0.0578 – –
N. maculata 5 14.60 1.58 – 0.20 0.12 0.19 0.1083 4 16
N. maculata 6 15.82 1.29 – – – – 0.0817 – 16
N. maculata 7 16.42 0.66 – 0.17 0.09 0.20 0.0405 6 16
N. maculata 8 12.85 0.74 0.51 0.10 0.10 0.18 0.0580 – –
N. maculata 9 8.75 0.83 0.41 0.10 0.16 0.19 0.0955 5 16
N. maculata 10 3.79 0.39 0.38 0.13 – 0.16 0.1041 4 16
N. maculata 11 7.23 0.69 0.30 0.10 0.12 0.19 0.0949 4 16
N. maculata 12 12.72 0.64 0.41 0.13 0.12 0.16 0.0504 8 16
N. maculata 13 4.91 0.77 – – 0.14 0.21 0.1576 5 16
N. maculata 14 8.01 1.19 – 0.11 0.11 0.17 0.1382 3 16
Mean ± SD 11.91 ± 4.39 0.94 ± 0.06 0.41 ± 0.06 0.13 ± 0.03 0.12 ± 0.02 0.18 ± 0.02 0.09 ± 0.03 4.67 ± 1.49 16
N. maculata (= N. aurea) 1 3.93 0.38 0.17 0.08 – 0.17 0.0979 6 16
N. maculata (= N. aurea) 2 3.86 0.53 0.36 0.11 – 0.16 0.1388 5 16
N. maculata (= N. aurea) 3 5.47 0.60 0.60 0.13 0.11 0.19 0.1091 6 16
Mean ± SD 4.42 ± 0.74 0.50 ± 0.09 0.38 ± 0.18 0.11 ± 0.02 0.11 ± 0 0.17 ± 0.01 0.12 ± 0.02 5.67 ± 0.47 16
Open in a new tab

Figure 1.

Figure 1.

Open in a new tab

Nausithoe sp. from Brazil. A tissue balls originated from polyp AC02 ephyrae B emerged polyps from same tissue balls in A after 22 weeks, showing the polyp opening; note that the basal parts are fused C external view of part of polyp AC18, showing by transparency the internal whorls of cusps (wc) D oral disc of polyp AC01, showing the tentacle crown (tc) and the mouth opening (m) with the gastric longitudinal septa (gs) E polyp AC02 releasing ephyrae.

The study was conducted at the Laboratório de Cultivo e Estudos de Cnidaria, in the Zoology Department of the Biosciences Institute, University of São Paulo (IB–USP). For comparison, we used living polyps of several species: nine Nausithoe sp., nine Nausithoe werneri Jarms, 1990, 14 Nausithoe maculata Jarms, 1990, and three Nausithoe aurea (Table 1). They were selected due to their availability in culture at our laboratory and for their distribution in the Atlantic Ocean, which we considered important for comparison.

Table 1.

Data from studied species of Nausithose (Nausithoe sp., N. werneri, N. maculata, and N. maculata (= N. aurea).

Locality # of polyps Depth (m) Culture temperature (°C) Sampling date Culture codes # of ephyrae cultivated # of mature medusae
Nausithoe sp. off Arraial do Cabo, Brazil 9 227 15 15.09.2002 AC01, AC02, AC08, AC10, AC17, AC18, and AC20 850 25
Nausithoe werneri Atlantic off Morocco 4 800–3,000 15 Original culture clones (1980) ACM156 69 4
Nausithoe werneri Mediterranean 5 200 15 2008 ACM157 70 9
Nausithoe maculata (= N. aurea) Ilhabela, Brazil 3 3–9 20–22 02.2018 ACM120 85 0
Nausithoe maculata Girón, Cuba 8 5–10 20–22 02.2004 ACM026, ACM027 50 8
Nausithoe maculata Puerto Rico 6 5–10 20–22 Original culture clones (1971) ACM025 160 33
Open in a new tab

Voucher specimens of Nausithoe sp. were deposited in the Museu de Zoologia da Universidade de São Paulo as: MZUSP8502 (one medusa), MZUSP8503 (two polyps), MZUSP8504 (50+ ephyrae).

Cultivation

All polyps were fed with 1–2-day-old nauplii of Artemia sp. once a week. Strobilation usually produced hundreds of ephyrae (Fig. 1E), and excessive feeding to increase the number of jellyfish was not necessary. Polyps and ephyrae were kept separately in 200-mL acrylic containers (maximum of 20 ephyrae per dish) in incubation chambers at the appropriate temperature for each species (N. werneri and Nausithoe sp. at 15 °C; N. maculata and N. aurea at 20 °C). Once ephyrae were released, they were fed daily with macerated mussel gonads (Perna perna). As soon as they grew large enough to catch Artemia, we began to vary their diet, adding 1-day-old nauplii. Food was provided in abundance. The water in the polyp dishes was changed 1 day after feeding, and in the medusae and ephyrae containers, it was changed 1 hour after feeding (as these stages are more responsive to variations in water quality). Measurements and photographs of all stages were taken for comparison using a Nikon SMZ800 stereomicroscope and a Nikon Eclipse 80i microscope.

Morphological analyses

Measurements followed the protocols established by Jarms (1990, 1991) and Jarms et al. (2002). The main measurements were: i) total tube length, ii) tube diameter at 2 mm above the base, iii) tube diameter at 5 mm above the base, iv) diameter of the basal disc, v) diameter just above the basal disc, and vi) aperture diameter. The type of external ornamentation (number of transverse rings per 4-mm length) and whether these rings were more or less prominent with respect to an imaginary line tangential to the tube contour was noted for possible comparison (according to Morandini and Jarms 2005). For the more translucent tubes, we were able to observe the number of whorls of the cusps and the number of cusps per whorl. We also took scanning electron microscope (SEM) photographs of the internal cusps of some polyps (Nausithoe sp. and N. werneri) in order to observe their shape and ornamentation (with special attention to whether they had additional cusps on the margin and surface). Characters and measurements of the ephyrae and medusae are shown in Fig. 2. The SEM observations were conducted at the Laboratório de Biologia Celular e Microscopia of the IB–USP, and the method of preparing the specimens followed the protocols of Morandini and Jarms (2005, 2010, 2012).

Figure 2.

Figure 2.

Open in a new tab

Schematic view of a typical Nausithoe sp. adult medusa, illustrating the main characters. A aboral view B lateral view. dc diameter of coronal furrow dr diameter between rhopalia dt total diameter cg coronal grove gc gastric cirri m manubrium ml marginal lappets r rhopalium t tentacle e eyespot g gonad s statolith.

Cnidome analyses

Capsule types and sizes of nematocysts in the different life-cycle stages (polyp, ephyra, medusa) were measured (Mariscal 1974; Östman 2000) using a Nikon Eclipse 80i light microscope. A total of 60 measurements were performed on each type per life-cycle stage of Nausithoe sp. and on the medusa tentacles of N. werneri and N. maculata.

DNA analyses

Because hundreds of ephyrae were produced, most of the molecular tissue for DNA extractions came from them (and some from mature medusae). We extracted DNA from specimens representing all the putative species in this study: Nausithoe sp., Nausithoe aurea, Nausithoe maculata, and Nausithoe werneri. DNA was extracted using an ammonium acetate-based protocol adapted from Fetzner (1999). Preliminary tests established that the minimum number of ephyrae for a satisfactory extraction was around 30, considering their size. Three partial genes were amplified by polymerase chain reaction (PCR): mitochondrial protein coding cytochrome oxidase subunit I (COI), and nuclear ribosomal markers 18S and 28S, using published primers and PCR conditions (Table 3). PCR products were purified with the Agencourt AMPure kit (#A63881). The BigDye reaction was conducted using the same primers and annealing temperature in each case. These steps were performed in the Laboratório de Evolução Molecular of the Zoology Department (IB–USP). Finally, the precipitated DNA were sequenced at the Laboratório de Sinalização de Redes Regulatórias de Plantas at the Botanical Department, IB–USP, with a Hitachi 3730xl DNA Analyzer. Chromatograms (.abi files) and consensus sequences were created and checked to identify potential sequencing errors and/or contamination, using Geneious software 9.1 (Kearse et al. 2012; all COI sequences were translated to check potential mitochondrial pseudogenes (NUMTs) or indel artifacts – genetic code: Invertebrate Mitochondrial). Sequence alignments were performed with the Geneious 9.1 MAFFT module for 18S and 28S markers (auto-mode; Katoh and Standley 2013), and Translation Align module for COI marker (genetic code: Invertebrate Mitochondrial; MAFFT alignment: E-INS-i); this way, we avoid inserting any spurious gap in the COI alignment. To avoid any difference (artifact) on COI distances (the most relevant dataset to discuss species delimitation), we edited ends of COI alignment. Doing so, all sequences present the same basic information (sequence length). Corrected distance values from each molecular marker alignment were obtained using MEGA X – Kimura 2 Parameters (Kumar et al. 2018).

Table 3.

List of primers used to amplify each gene. *LEM = Laboratório de Evolução Molecular (IB–USP).

Gene Primer Primer sequence 5'–3' F/R Temp. – base pairs Source
COI COXl-F2 TCGACTAATCATAAAGATATCGGCAC F 52 °C – 26 bp Ward et al. 2005
MEDCOXR TGGTGNGCYCANACNATRAANCC R 52 °C – 23 bp Lawley et al. 2016
LCO1490JJ4 CIACIAAYCAYAARGAYATYGG F 55 °C+45 °C – 22 bp Astrin et al. 2016
HCO2198JJ4 ANACTTCNGGRTGNCCAAARAATC R 55 °C+45 °C – 25 bp Astrin et al. 2016
LCO1490JJ2 CHACWAAYCAYAARGAYATYGG F 60 °C+45 °C – 22 bp Astrin et al. 2016
HCO2198JJ2 ANACTTCNGGRTGNCCAAARAATCA R 60 °C+45 °C – 25 bp Astrin et al. 2016
28S F15 CTAACAAGGATTCCCCTAGTAACGGCGAG F 55.5 °C – 30 bp LEM *
R798 GGTCCGTGTTTCAAGACGG R 55.5 °C – 19 bp Medina et al. 2001
F798 CCGTCTTGAAACACGGACC F 55.5 °C – 19 bp Medina et al. 2001
R1446 GTTGTTACACACTCCTTAGCGG R 55.5 °C – 22 bp Medina et al. 2001
18S 18S – A AACCTGGTTGATCCTGCCAGT F 54 °C – 21 bp Medlin et al. 1988
18S – L CCAACTACGAGCTTTTTAACTG R 54 °C – 22 bp Apakupakul et al. 1999
18S – C CGGTAATTCCAGCTCCAATAG F 54 °C – 21 bp Apakupakul et al. 1999
18S – Y CAGACAAATCGCTCCACCAAC R 54 °C – 21 bp Apakupakul et al. 1999
18S – O AAGGGCACCACCAGGAGTGGAG F 54 °C – 22 bp Apakupakul et al. 1999
18S – B TGATCCTTCCGCAGGTTCACCT R 54 °C – 22 bp Medlin et al. 1988
Open in a new tab

Results

All the morphological features observed on the available specimens are summarized in Tables 2, 4. The time periods until medusae developed distinct morphological characters are listed in Table 5.

Table 4.

Morphological data for studied species of Nausithoe. Data combined from literature and observations on specimens. Brazilian state abbreviations: BA, Bahia; RJ, Rio de Janeiro; SP, São Paulo.

N. sp. N. maculata (= N. aurea) N. maculata N. werneri
Medusae Number / shape of lappets 16, slightly elongate with rounded margins 16, slightly elongate with rounded margins 16, slightly elongate with rounded margins 16, slightly elongate with rounded margins
Rhopalium with ocellus yes yes yes yes
Number of gastric filaments 8 (2 × 4) 12–24 (3–6 × 4) 28 (7 × 4) 4–12 (1–3 × 4)
Gonad shape round round round round
Central disc shape central dome slightly elevated flattened flattened central dome elevated
Total diameter (mm) /
Central disc diameter (mm)		 9.5 / 2.83 5 / 1.9 4 / 1.5 12 / 4.5
General coloration transparent transparent with yellow pigment spot on lappets transparent with yellow pigment spot on lappets transparent
Gonad color dark brown yellow to brown yellow to brown dark brown
Tentacle length (mm) 5 1.5 2 3
Polyp Habitus solitary solitary solitary solitary
Occurrence off Cabo Frio, RJ (Brazil) Brazil (SP to BA) Puerto Rico; Cuba Atlantic off Morocco; Greenland
Depth (m) 227 3–9 5–10 200–3000
Length (mm) 5.05–20.2 1.35–9.18 3.79–18.64 2.56–31.46
Number of cusps/whorls 8 + 16 16 16 8
Number of whorls of cusps 3–10 2–7 3–8 6–14
Open in a new tab

Table 5.

Development times (in weeks, under laboratory conditions) of several structures in the species studied.

N. werneri N. maculata (= N. aurea) N. maculata N. sp.
Ocelli 4 2 3 3
First gastric filament 3 1 2 2
Second gastric filament – – 8 13
Tentacle buds 7 3 3 2
Lappets, pigment spot – 2 2 –
Gonads 9 3 4 24
Open in a new tab

Systematics section

Class Scyphozoa Goette, 1887

Subclass Coronamedusae Calder, 2009

Order Coronatae Vanhöffen, 1892

Family Nausithoidae Haeckel, 1880

Genus Nausithoe Kölliker, 1853

Nausithoe

sp.

623C3844-D8A5-5D83-A52E-8C0B5B460D5D

Figs 1 , 3 , 4

Figure 3.

Figure 3.

Open in a new tab

SEM of cross-sections of the tube of the polyp of Nausithoe sp. AC02 at different heights. A more-basal series, with 16 cusps and additional cusps over 4 larger perradial cusps B and C two more-distal series (C being the highest along the tube), each with 8 cusps.

Figure 4.

Figure 4.

Open in a new tab

Adult medusae from polyps of Nausithoe sp. AC10 (A–C) and AC20 (D–H) A beginning of gonad (g) development B two gonads with gametic cells still differentiating C general view of a medusa that we managed to maintain until the gonads emerged (note degree of irregularities in this specimen, due to the long period in cultivation) D aboral view of 3-month-old medusa, showing the radial muscle (rm), marginal lappets (ml), rhopalium (r), and tentacles (t) E detail of 6-month-old medusa, showing gastric filaments (gf), rhopalium with ocelli (e), and statocyst (s), and coronal groove (cg); note, no trace of gonad development F, G and H Oral view of medusae, showing lips (l) and projection of the manubrium, from less projected (F) to more projected (H).

Metagenetic species.

Solitary polyp with typical periderm tube, dark to light brown (Fig. 1C, D), conical, with transverse rings on the surface with longitudinal striations (5 rings every 0.4 mm at 2 mm above base). Polyps 5.05–20.2 mm long; basal disk 0.63–0.66 mm in diameter; diameter just above the basal disk 0.14–0.4 mm; tube diameter at 2-mm height 0.09–0.45 mm, and at 5-mm height 0.35–0.45 mm; tube aperture diameter 1.28 mm. Tubes with 3–10 whorls of internal cusps (Fig. 1C); closer to base, number of internal cusps per whorl is 16: 4 large (perradius) with additional cusps on the surface, 4 intermediate (interradius), and 8 small (adradius) (Fig. 3A). Upper whorls with only 8 cusps: 4 large (perradius) with no additional cusps, and 4 intermediate (interradius) (Fig. 3B, C). Polyps with 26–37 filiform tentacles (Fig. 1D). Polydisc strobilation, with more than 100 ephyrae at a time. Medusa (Figs 2A, B, 4) entirely translucent, with slightly flattened smooth umbrella; 16 slightly elongated lappets with rounded margins; 8 rhopalia with statocyst and red ocelli. Live specimens measuring up to: 9.5 mm total diameter; 7.74 mm diameter between opposite rhopalia; 2.83 mm coronal groove diameter; gastric cirri approximately 0.9 mm in length; and tentacle length up to half the total diameter of the medusa. Stomach with 4 gastric septa, each with 2 gastric filaments (8 in total) (Figs 2A, 4D, E). Gonads, 8, but not fully developed (Fig. 4A–C); in fact, only a single individual had them and they were malformed (Fig. 4B, C), so complete data about their morphology are lacking. Cnidome composed of only two nematocyst types: holotrichous isorhiza and heterotrichous microbasic eurytele (Fig. 5; Table 6).

Figure 5.

Figure 5.

Open in a new tab

Photomicrographs of the two nematocyst types found in Nausithoe sp. A three heterotrichous microbasic euryteles discharged B holotrichous isorhiza capsules of two different sizes (large, grey arrow; small, black arrow) C a small discharged holotrichous isorhiza.

Table 6.

Cnidome of studied species of Nausithoe. The range was obtained from 60 nematocysts of each type at each stage. *Data from Silveira and Morandini (1997; from 20 nematocysts of each type at each stage).

Holotrichous isorhiza Heterotrichous microbasic eurytele
Width (µm) Length (µm) Width (µm) Length (µm)
Nausithoe sp. medusa (tentacle) 4.41–6.49 5.65–8.65 7.28–10.96 8.47–12.99
ephyra (whole) 4.11–7.33 5.29–8.98 7.1–12.59 8.19–14.27
polyp (tentacle) 5.86–7.58 8.24–9.67 9.58–11.54 11.28–13.53
medusa (tentacle) 3.0–4.2 4.2–6.0 5.4–7.2 6.6–9.0
N. maculata (= N. aurea)* ephyra (whole) 3.6–6.0 5.4–7.2 9.0–11.4 10.2–12.6
polyp (tentacle) 3.6–5.4 6.0–7.8 3.0–4.8 9.0–15.0
N. maculata medusa (tentacle) 3.52–5.08 4.5–5.83 6.49–8.17 7.49–9.21
N. werneri medusa (tentacle) 4.33–6.69 5.47–7.45 7.06–9.27 8.67–10.92
Open in a new tab
Nausithoe maculata

Jarms, 1990

558AC9DD-EC38-53AF-B23F-1E284E63406E

Fig. 6

Figure 6.

Figure 6.

Open in a new tab

Aboral view of Nausithoe maculata medusae from Cuba’s polyp culture. A four-month-old medusa with mature male gonads (g), long tentacles (t), and malformations in the lappets and central disc. B three-month-old medusa with mature female gonads (g), showing the rhopalium (r), coronal groove (cg), marginal lappets (ml) with pigment spot (ps), gastric cirri (gc), and tentacles (t).

  • Nausithoe maculata Jarms 1990: 21–24, figs 15–17, pl. V. Type locality: Puerto Rico. Holotype: ZMH C11534.

  • Nausithoe aurea Silveira and Morandini 1997: 236–239, figs 1–7, pls I, II. Type locality: Ilhabela (23°51'S, 45°25'W), Brazil. Holotype: MNRJ 2899. (syn. nov.)

Metagenetic species.

Solitary polyp with typical periderm tube, dark to light brown, conical, with transverse rings on the surface with longitudinal striations (3–5 rings every 0.4 mm at 2 mm above base). Polyps 3.79–18.64 mm long. Basal disk 0.17–0.6 mm in diameter. Diameter of aperture 0.39–1.58 mm. Diameter just above the basal disc 0.08–0.2 mm. Diameter at 2-mm height 0.09–0.16 mm, and at 5-mm height 0.14–0.21 mm. Three to 8 whorls of 16 internal smooth cusps: 4 large (perradius), 4 intermediate (interradius), and 8 small (adradius). Polydisc strobilation, with more than 100 ephyrae at a time. Medusa translucent, with yellow pigment spot in center of each lappet (Fig. 6A, B). Umbrella flattened, with 16 slightly elongated lappets with rounded margins and 8 rhopalia with statocyst and red ocelli. Live specimens measuring up to: 3.9 mm total diameter; 2.7 mm between opposite rhopalia; 1.5 mm coronal-groove diameter; gastric cirri approximately 0.5 mm in length; and tentacle length up to 1.5 mm. Stomach with 4 gastric septa, each with 3–7 gastric filaments.

Nausithoe werneri

Jarms, 1990

0F6367D3-3578-5575-BABB-F5919BDF0758

Fig. 7

Figure 7.

Figure 7.

Open in a new tab

Nausithoe werneri male medusae from Mediterranean’s polyp culture (A–C 5 months old D 3 months old) A aboral view of an adult medusa with mature gonads (g), contracted lappets, and extended tentacles (t) B detail of gastrovascular cavity, focusing on the gastric cirri (gc) C lateral view, focusing on the lips (l) and the extension of the manubrium D beginning of gonad (g) development (aboral view).

  • Nausithoe werneri Jarms 1990: 12–17, figs 1–7, pls I, III. Type locality: Morocco coast (25°20.4'N, 16°08.4'W, 415–420 m depth). Holotype: ZMH C11530.

Metagenetic species.

Solitary polyp with typical periderm tube, dark to light brown, conical, with transverse rings on surface with longitudinal striations (4–5 rings every 0.4 mm at 2 mm above the base). Polyps 2.56–31.46 mm long. Basal disk 0.24–0.53 mm in diameter. Diameter of aperture 0.33–1.29 mm. Diameter just above basal disc 0.07–0.23 mm. Diameter at 2-mm height 0.07–0.12 mm, and at 5-mm height 0.07–0.17 mm. Six to 14 whorls of 8 internal cusps: 4 large (perradius) and 4 intermediate (interradius), with additional cusps. Polyp with up to 40 filiform tentacles. Polydisc strobilation, with more than 100 ephyrae at a time. Medusa with smooth umbrella (Fig. 7) with high central dome; 16 slightly elongated lappets with rounded margins, and 8 rhopalia with statocyst and red ocelli. Live specimens measuring up to: 6.8 mm total diameter; 5 mm between opposite rhopalia; 2.5 mm coronal groove diameter; gastric cirri approximately 1.9 mm in length; and tentacle length up to 3 mm. Stomach with 4 gastric septa, each with 1 gastric filament (4 in total).

Sequences from all species studied are available on GenBank (Table 7). DNA comparisons of the sequenced markers of the species are summarized in Tables 8 and 9. We were not able to amplify the three proposed markers for all polyps. Therefore, Nausithoe sp. specimens AC01 (no 28S data), AC17 (no COI data), and AC18 (no COI data) were not included in the molecular analyses. Polyps with all three genes sequenced were compared with each other and with N. maculata (= N. aurea from Brazil), N. maculata (Cuba), and N. werneri. Using only the COI marker, Nausithoe sp. (specimens AC02, AC08, AC10, AC20) and N. werneri had less than 6% genetic difference from each other and almost 20% genetic difference from N. maculata (Cuba) and N. maculata (= N. aurea from Brazil). Nausithoe maculata from Cuba had less than 7% difference from N. maculata (= N. aurea) from Brazil. The remaining DNA extractions from cultures are also considered as vouchers (Table 7).

Table 7.

Sequence accession numbers in GenBank and their respective DNA extraction vouchers.

COI 18S 28S DNA Voucher
Nausithoe sp. AC02 MT603856 (717 bp) MT603629 (1765 bp) MT621557 (1304 bp) N02
Nausithoe sp. AC08 MT603855 (735 bp) MT603631 (1767 bp) MT621552 (1309 bp) N08
Nausithoe sp. AC10 MT603857 (708 bp) MT603630 (1765 bp) MT621553 (1319 bp) N10
Nausithoe sp. AC20 MT603854 (609 bp) MT603628 (1772 bp) MT621555 (1344 bp) N20
N. werneri (Mediterranean) MT603858 (610 bp) MT603627 (1767 bp) MT621554 (1337 bp) NW (Med)
N. maculata (= N. aurea) (Brazil) MT603859 (579 bp) MT603632 (1777 bp) MT621558 (1305 bp) NA
N. maculata (Cuba) MT603860 (591 bp) MT603633 (1780 bp) MT621559 (1310 bp) NM (Cuba)
Open in a new tab
Table 8.

Genetic similarity (percent) between each Nausithoe sp. polyp (AC02, AC08, AC10, AC20), Nausithoe maculata (= N. aurea from Brazil), Nausithoe maculata (from Cuba), and Nausithoe werneri. 18S in white and 28S in italic.

AC02 AC08 AC10 AC20 N. werneri N. maculata (Brazil) N. maculata (Cuba)
AC02 100 100 99.94 99.94 99.86 99.86
AC08 94.86 100 99.94 99.94 99.86 99.86
AC10 97.04 94.63 99.94 99.94 99.86 99.86
AC20 97.41 95 97.18 99.89 99.80 99.80
N. werneri 97.22 94.69 96.91 97.28 99.80 99.80
N. maculata (Brazil) 96.64 94.22 96.62 96.76 96.51 99.94
N. maculata (Cuba) 96.66 94.18 96.37 96.74 96.47 97.36
Open in a new tab
Table 9.

Genetic similarity (percent) between each Nausithoe sp. polyp (AC02, AC08, AC10, AC20), N. maculata (= N. aurea from Brazil), N. maculata (from Cuba), and N. werneri. COI in italic; all three markers combined in white. Boldface indicates higher similarity that we are considering to be the same species.

AC02 AC08 AC10 AC20 N. werneri N. maculata (Brazil) N. maculata (Cuba)
AC02 96.28 97.33 94.60 95.35 91.74 92.08
AC08 97.35 96.11 94.1 94.28 90.99 91.39
AC10 100 97.32 94.73 95.32 91.77 92.11
AC20 94.25 95.40 94.25 94.73 92.00 92.18
N. werneri 100 97.21 100 94.06 91.72 92.05
N. maculata Brazil) 80.83 80.83 80.83 81.35 80.83 94.06
N. maculata (Cuba) 81.89 82.40 81.89 82.29 81.89 93.06
Open in a new tab

Discussion

The objective of this study was to identify the polyps of Nausithoe sp. from deep waters off southeastern Brazil by comparing them with previous records along the Brazilian coast. We used two approaches: morphology combined with life-cycle observations, and molecular data. Also, we present previously unpublished data on nematocysts for N. werneri and N. maculata from Cuba.

So far, only three species of Nausithoe have been recorded from the Brazilian coast: N. aurea, N. atlantica, and N. punctata (Oliveira et al. 2016). Nausithoe aurea is endemic to the Brazilian coast and can be found in shallow waters (Silveira and Morandini 1997; Morandini and Silveira 2001). The polyps are solitary with 16 smooth cusps per series; and the medusae have a characteristic single yellow spot in the center of each marginal lappet (Silveira and Morandini 1997). These features show that this species is not identical to Nausithoe sp.

Nausithoe punctata is a cosmopolitan species that lives in shallow waters (Jarms and Morandini 2019); in Brazil it was reported by Goy (1979) and Neumann-Leitão et al. (2008). The polyp stage is colonial and inhabits sponges (Werner 1979; Uriz et al. 1992). Medusae are transparent with a pale-pink disc and yellowish lappets; the umbrella is flattened and reaches up to 15 mm in diameter (Kölliker 1853; Kramp 1961; Werner 1970). With these features, we can also discard this species as identical to Nausithoe sp. As pointed out by Jarms and Morandini (2019), there is extensive confusion in the taxonomy and identification of N. punctata, and many records around the world might be erroneous.

Nausithoe atlantica is known only from the medusa stage (Jarms and Morandini 2019). Although records from the Pacific Ocean exist (Oliveira et al. 2016), the only confirmed identifications are from the North Atlantic, near the type locality (Broch 1913; Russell 1956). The adult medusa is dark yellowish-brown, up to 35 mm in diameter, and has rhopalia without ocelli, oblong gonads, and more than 160 gastric filaments (Russell 1970). The Brazilian record provided by Oliveira et al. (2016) derives from a thesis in which the specimens were collected off Santa Catarina state. The description provided is identical to Russell (1970), and no voucher material is available for comparison. Considering the divergent features and doubtful record, we discard this species as identical to Nausithoe sp.

The two types of nematocysts found in Nausithoe sp. (heterotrichous microbasic euryteles and holotrichous isorhizas) are the same as in N. aurea (Silveira and Morandini 1997) and in N. planulophora (Werner 1971). These are the most common types in scyphozoans (Östman 2000), which indicate that this information might not be useful in differentiating species of the group. There is an overlap of the measurements obtained from Nausithoe sp. and N. werneri, and polyp nematocysts are slightly larger than ephyrae and medusae ones. For now, much more work on the scyphozoan cnidome is needed to improve understanding of the types of cnidae in the group’s evolutionary history.

As do most of the solitary Nausithoidae polyps, those of Nausithoe sp. and N. werneri resemble each other. As stated by several authors, the most useful features to distinguish Nausithoe polyps are the number and shape of the internal cusps of the tube (e.g., Jarms 1991; Morandini and Jarms 2012). Although these features are used widely in the systematics of the group, the variation among specimens has not been thoroughly studied, in part because of the relatively few samples that can be used for scanning electron microscopy. It is also unknown how laboratory conditions might affect the growth of the animals and the shape of the cusps. SEM observations of the cusps of Nausithoe sp. showed 16 internal cusps per whorl close to the base and eight cusps in the upper whorls of the tube (Fig. 3), whereas in N. werneri, only eight cusps are found per whorl, both in the literature (Jarms 1990) and in our observations.

Both the ephyrae and medusae of the Brazilian deep-sea Nausithoe sp. are morphologically similar to N. werneri: translucent body, rhopalium with statocyst and red ocelli, lappets slightly elongated with rounded margins, and total diameter (Table 4). The only differences we noted were the shape and size of the manubrium, the shape of the central disc, and the number of gastric cirri. In Nausithoe sp., the manubrium is wider (Fig. 4F–H) than in N. werneri (Fig. 6D). The elevated central dome of N. werneri is also not present in Nausithoe sp. Although Jarms (1990) described N. werneri with two or three gastric cirri per quadrant, our cultivated specimens (derived from Jarms’s culture) had only one gastric cirrus per quadrant (Fig. 6B); Nausithoe sp. has eight filaments in the stomach. These variations in morphological features might be related to plasticity in the response of the species under different environmental conditions and food supply. Certainly, the food provided in our laboratory differs from that used by Jarms (1990). Although our specimens were kept in the same conditions, there might be some individual variation. To ascertain the utility of these morphological features it would be necessary to examine many specimens from a broad population.

An interesting feature is the difference in the time taken to develop gonads between Nausithoe sp. and our specimens of N. werneri (Table 5). Nausithoe sp. took more than 20 weeks to begin the differentiation and development of the reproductive organs, while N. werneri required only nine weeks. These times are comparable because all species were kept in the same kind of container and temperature, with similar population densities, and fed equally.

Genetic divergence related to species delimitation is difficult to discern, especially for clades with limited molecular markers and specimens. For Discomedusae, the sister clade of Coronamedusae, Gómez Daglio and Dawson (2017) proposed that the mean intraspecific pairwise genetic distance (x ± s.d.) is 0.006 ± 0.005 and the mean interspecific distance between congeneric species (x ± s.d.) is 0.12 ± 0.04. Our molecular data showed that specimens of Nausithoe sp. and N. werneri had less than 6% of genetic difference for the COI gene (Table 8) and each of them differed by ~20% from N. maculata (from Cuba) and N. maculata (= N. aurea from Brazil). Together with the morphological similarities, we state they are the same species, according to the criteria of Gómez Daglio and Dawson (2017). Following the same rationale, we found less than 7% of genetic difference in the COI gene between N. maculata (from Cuba) and N. maculata (= N. aurea from Brazil). In these two species, the morphological resemblance is obvious, and the only difference is the formation of planuloids inside the periderm tube of N. aurea (Silveira and Morandini 1997), which was considered one of the distinguishing features of this species, not observed in N. maculata. Considering that coronamedusae species were mostly defined by a few specimens, we propose that this feature represents possible genetic plasticity not previously recorded for N. maculata.

Comparing the life cycle and morphology of scyphomedusae is extremely important to help in identifying and describing species. However, the simple structure of these animals, as evidenced by the traditional use of certain uninformative characters in the description of specimens (e.g., Kramp 1961; Russell 1970), can yield insufficient information for a precise analysis (Dawson 2005). Future approaches, including additional genetic data from other species of Coronatae, will add detail to the systematics of this clade. A broader sampling of molecular markers, individuals, populations, species, and clades in general will allow for novel insights to be applied to Coronamedusae, the proposal of a more refined “genetic gap” for the delimitation of species, and specific genetic diagnoses (DeSalle and Goldstein 2019). Nevertheless, the use of genetic data must be combined with information on morphology and life cycles to confirm or reject the validity of species and to identify new taxa.

To conclude, based on both the morphological and molecular data obtained, we identify the deep-sea Nausithoe sp. specimens from off the Brazilian coast as Nausithoe werneri, thus expanding the distribution of this species to the western South Atlantic. Additionally and also based on molecular and morphological data, we consider the species Nausithoe aurea as a junior synonym of Nausithoe maculata.

Supplementary Material

XML Treatment for Nausithoe
zookeys.984.56380-treatment1.xml (16.9KB, xml)
XML Treatment for Nausithoe maculata
zookeys.984.56380-treatment2.xml (8.8KB, xml)
XML Treatment for Nausithoe werneri
zookeys.984.56380-treatment3.xml (31KB, xml)

Acknowledgements

We thank Drs Sergio A. Vanin for collecting the specimens on shipboard and Fábio L. da Silveira for keeping them for so many years. We also thank Dr Alberto A. F. Ribeiro (IB–USP) for allowing the use of the scanning electron microscope, Enio Mattos and Phillip Lenktaitis for helping with SEM observations, and Beatriz Vieira Freire, Manuel Antunes Júnior, and Sabrina Baroni for assistance with molecular protocols. Resources used in this project were provided by FAPESP (2010/50174-7, 2015/21007-9). CGM received support from a FAPESP MSc scholarship (2017/04954-0, 2018/11523-8) and CAPES/PROEX; MMM was awarded a FAPESP post-doctoral grant (2016/04560-9); ACM received support from a CNPq grant (309440/2019-0). We thank Dr Janet Reid for correcting the English and Dr Allen Collins and an anonymous referee for comments and suggestions to improve the text. This is a contribution of NPBioMar, USP.

Citation

Molinari CG, Maronna MM, Morandini AC (2020) New record of Nausithoe werneri (Scyphozoa, Coronatae, Nausithoidae) from the Brazilian coast and a new synonymy for *Nausithoe maculata. ZooKeys 984: 1–21. https://doi.org/10.3897/zookeys.984.56380

References

  1. Allman GJ. (1874) Report on the Hydroida collected during the Expeditions of H.M.S. ‘Porcupine’. Transactions of the Zoological Society of London 8(8): 469–481. [pls 65–68] 10.1111/j.1096-3642.1874.tb00566.x [DOI] [Google Scholar]
  2. Broch H. (1913) Scyphomedusae from the “Michael Sars” North Atlantic Deep-Sea Expedition 1910. Report on the Scientific Results of the “Michael Sars” North Atlantic Deep-Sea Expedition 3(4): 1–20. [pl. I] [Google Scholar]
  3. Calder DR. (2009) Cubozoan and scyphozoan jellyfishes of the Carolinian biogeographic province, southeastern USA. Royal Ontario Museum Contributions in Science 3: 1–58. [Google Scholar]
  4. Collins AG. (2009) Recent insights into cnidarian phylogeny. Smithsonian Contributions to the Marine Sciences 38: 139–149. [Google Scholar]
  5. Dawson MN. (2005) Renaissance taxonomy: integrative evolutionary analyses in the classification of Scyphozoa. Journal of the Marine Biological Association of the UK 85(3): 733–739. 10.1017/S0025315405011641 [DOI] [Google Scholar]
  6. Dawson MN, Jacobs DK. (2001) Molecular evidence for cryptic species of Aurelia aurita (Cnidaria, Scyphozoa). The Biological Bulletin 200(1): 92–96. 10.2307/1543089 [DOI] [PubMed] [Google Scholar]
  7. DeSalle R, Paul Goldstein P. (2019) Review and interpretation of trends in DNA barcoding. Frontiers in Ecology and Evolution 7: 1–11. 10.3389/fevo.2019.00302 [DOI] [Google Scholar]
  8. Eschscholtz F. (1829) System der Acalephen. Eine ausführliche Beschreibung aller Medusenartigen Strahlthiere. Ferdinand Dümmler, Berlin, 190 pp [16 plates] 10.5962/bhl.title.10139 [DOI] [Google Scholar]
  9. Fetzner JW. (1999) Extracting high-quality DNA from shed reptile skins: a simplified method. Biotechniques 26(6): 1052–1054. 10.2144/99266bm09 [DOI] [PubMed] [Google Scholar]
  10. Goette A. (1886) Verzeichnis der Medusen, welche von Dr Sander, Stabsarzt auf S.M.S. “Prinz Adalbert” gesammelt wurden. Sitzungsberichte der Königlich Preussischen Akademie der Wissenschaften zu Berlin 39: 831–837. [Google Scholar]
  11. Gómez Daglio L, Dawson MN. (2017) Species richness of jellyfishes (Scyphozoa: Discomedusae) in the Tropical Eastern Pacific: missed taxa, molecules, and morphology match in a biodiversity hotspot. Invertebrate Systematics 31: 635–663. 10.1071/IS16055 [DOI] [Google Scholar]
  12. Goy J. (1979) Campagne de la Calypso au large des côtes atlantiques de l’Amérique du Sud (1961–1962) – 35. Méduses. Annales de l’Institut Océanographique, Paris 55 (Suppl.): 263–296.
  13. Haeckel E. (1880) Das System der Medusen. I, 2: System der Acraspeden. Gustav Fischer, Jena, 361–672.
  14. Holland BS, Dawson MN, Crow GL, Hofmann DK. (2004) Global phylogeography of Cassiopea (Scyphozoa: Rhizostomeae): molecular evidence for cryptic species and multiple invasions of the Hawaiian Islands. Marine Biology 145: 1119–1128. 10.1007/s00227-004-1409-4 [DOI] [Google Scholar]
  15. Holst S, Laakmann S. (2014) Morphological and molecular discrimination of two closely related jellyfish species, Cyanea capillata and C. lamarckii (Cnidaria, Scyphozoa), from the northeast Atlantic. Journal of Plankton Research 36(1): 48–63. 10.1093/plankt/fbt093 [DOI] [Google Scholar]
  16. Jarms G. (1990) Neubeschreibung dreier Arten der Gattung Nausithoe (Coronatae, Scyphozoa) sowie Wiederbeschreibung der Art Nausithoe marginata Kölliker, 1853. Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut 87: 7–39. [Google Scholar]
  17. Jarms G. (1991) Taxonomic characters from the polyp tubes of coronate medusae (Scyphozoa, Coronatae). Hydrobiologia 216: 463–470. 10.1007/BF00026500 [DOI] [Google Scholar]
  18. Jarms G. (2010) The early life history of Scyphozoa with emphasis on Coronatae. A review with a list of described life cycles. Verhandlungen des Naturwissenschaftlichen Vereins in Hamburg 45: 17–31. [Google Scholar]
  19. Jarms G, Morandini AC. (2019) Coronamedusae In: Jarms G, Morandini AC. (Eds) World Atlas of Jellyfish.Abhandlungen des Naturwissenschaftlichen Vereins, Hamburg, 112–259.
  20. Jarms G, Båmstedt U, Tiemann H, Martinussen MB, Fosså JH. (1999) The holopelagic life cycle of the deep-sea medusa Periphylla periphylla (Scyphozoa, Coronatae). Sarsia 84(1): 55–65. 10.1080/00364827.1999.10420451 [DOI] [Google Scholar]
  21. Jarms G, Morandini AC, Silveira FL. (2002) Cultivation of polyps and medusae of Coronatae (Cnidaria, Scyphozoa) with a brief review of important characters. Helgoland Marine Research 56(3): 203–210. 10.1007/s10152-002-0113-3 [DOI] [Google Scholar]
  22. Katoh K, Standley DM. (2013) MAFFT Multiple Sequence Alignment Software version 7: improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12): 1647–1649. 10.1093/bioinformatics/bts199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kölliker A. (1853) Bericht über einige im Herbst 1852 in Messina angestellte vergleichendanatomische Untersuchungen. 11. Zeitschrift für wissenschaftliche Zoologie 4: 299–370. [Google Scholar]
  25. Kramp PL. (1961) Synopsis of the Medusae of the world. Journal of the Marine Biological Association of the UK 40: 7–469. 10.1017/S0025315400007347 [DOI] [Google Scholar]
  26. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. (2018) MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Molecular Biology and Evolution 35(6): 1547–1549. 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Maas O. (1903) Die Scyphomedusen der Siboga-Expedition. Siboga-Expeditie 11. Buchhandlung und Druckerei vormals E. J. Brill, Leiden, 18–23.
  28. Mariscal RN. (1974) Nematocysts. In: Muscatine L, Lenhoff HM. (Eds) Coelenterate Biology: Reviews and New Perspectives.Academic Press, New York, 129–178. 10.1016/B978-0-12-512150-7.50008-6 [DOI]
  29. Molinari CG, Morandini AC. (2019) Update on benthic scyphozoans from the Brazilian coast (Cnidaria: Scyphozoa: Coronatae). Revista Brasileira de Zoociências 20(2): 1–14. 10.34019/2596-3325.2019.v20.27610 [DOI] [Google Scholar]
  30. Morandini AC, Jarms G. (2005) New combinations for two coronate polyp species (Atorellidae and Nausithoidae, Coronatae, Scyphozoa, Cnidaria). Contributions to Zoology 74(1–2): 117–123. 10.1163/18759866-0740102008 [DOI] [Google Scholar]
  31. Morandini AC, Jarms G. (2010) Identification of coronate polyps from the Arctic Ocean: Nausithoe werneri Jarms, 1990 (Cnidaria, Scyphozoa, Coronatae), with notes on its biology. Steenstrupia 32(1): 69–77. [Google Scholar]
  32. Morandini AC, Jarms G. (2012) Discovery and redescription of type material of Nausithoe simplex (Kirkpatrick, 1890), comb. nov. (Cnidaria: Scyphozoa: Coronatae: Nausithoidae) from the North Atlantic. Zootaxa 3320: 61–68. 10.11646/zootaxa.3320.1.5 [DOI] [Google Scholar]
  33. Morandini AC, Silveira FL. (2001a) New observations and new record of Nausithoe aurea (Scyphozoa, Coronatae). Papéis Avulsos de Zoologia 41(27): 519–527. [Google Scholar]
  34. Morandini AC, Silveira FL. (2001b) Sexual reproduction of Nausithoe aurea (Scyphozoa, Coronatae). Gametogenesis, egg release, embryonic development, and gastrulation. Scientia Marina 65(2): 139–149. 10.3989/scimar.2001.65n2139 [DOI] [Google Scholar]
  35. Müller F. (1861) Ueber die systematische Stellung der Charybdeiden. Archiv für Naturgeschichte 27(1): 302–311. [Google Scholar]
  36. Neumann-Leitão S, Sant’anna EME, Gusmão LMO, Do Nascimento-Vieira DA, Paranaguá MN, Schwamborn R. (2008) Diversity and distribution of the mesozooplankton in the tropical Southwestern Atlantic. Journal of Plankton Research 30(7): 795–805. 10.1093/plankt/fbn040 [DOI] [Google Scholar]
  37. Östman C. (2000) A guideline to nematocyst nomenclature and classification, and some notes on the systematic value of nematocysts. Scientia Marina 64(1): 31–46. 10.3989/scimar.2000.64s131 [DOI] [Google Scholar]
  38. Russell FS. (1956) On the Scyphomedusae Nausithoë atlantica Broch and Nausithoë globifera Broch. Journal of the Marine Biological Association of the UK 35(2): 363–370. 10.1017/S0025315400010195 [DOI] [Google Scholar]
  39. Russell FS. (1970) Nausithoeïdae. In: Russell FS. (Ed.) The Medusae of the British Isles II.Pelagic Scyphozoa with a Supplement to the First Volume on Hydromedusae. Cambridge University Press, London, 29–37.
  40. Silveira FL, Morandini AC. (1997) Nausithoe aurea n. sp. (Scyphozoa, Coronatae, Nausithoidae), a species with two pathways of reproduction after strobilation: sexual and asexual. Contributions to Zoology 66(4): 235–246. 10.1163/26660644-06604004 [DOI] [Google Scholar]
  41. Silveira FL, Jarms G, Morandini AC. (2003) Experiments in nature and laboratory observations with Nausithoe aurea (Scyphozoa: Coronatae) support the concept of perennation by tissue saving and confirm dormancy. Biota Neotropica 2(2): 1–25. 10.1590/S1676-06032002000200009 [DOI] [Google Scholar]
  42. Uriz MJ, Rosell D, Maldonado M. (1992) Parasitism, commensalism or mutualism? The case of Scyphozoa (Coronatae) and horny sponges. Marine Ecology Progress Series 81: 247–255. 10.3354/meps081247 [DOI] [Google Scholar]
  43. Vanhöffen E. (1892) Die Akalephen der Plankton-Expedition. Ergebnisse der Plankton-Expedition der Humboldt-Stiftung 2: 3–28. [Google Scholar]
  44. van Walraven L, van Bleijswijk J, van der Veer HW. (2020) . Here are the polyps: in situ observations of jellyfish polyps and podocysts on bivalve shells. PeerJ 8: e9260. 10.7717/peerj.9260 [DOI] [PMC free article] [PubMed]
  45. Werner B. (1970) Contribution to the evolution in the genus Stephanoscyphus (ScyphozoaCoronatae) and ecology and regeneration qualities of Stephanoscyphus racemosus Komai. Publications of the Seto Marine Biological Laboratory 18(1): 1–20. 10.5134/175623 [DOI] [Google Scholar]
  46. Werner B. (1971) Stephanoscyphus planulophorus n. spec., ein neuer Scyphopolyp mit einem neuen Entwicklungsmodus. Helgoländer wissenschaftliche Meeresuntersuchungen 22: 120–140. 10.1007/BF01611366 [DOI] [Google Scholar]
  47. Werner B. (1979) Coloniality in the Scyphozoa: Cnidaria. In: Larwood G, Rosen BR. (Eds) Biology and Systematics of Colonial Organisms.Academic Press, London, 81–103.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Nausithoe
zookeys.984.56380-treatment1.xml (16.9KB, xml)
XML Treatment for Nausithoe maculata
zookeys.984.56380-treatment2.xml (8.8KB, xml)
XML Treatment for Nausithoe werneri
zookeys.984.56380-treatment3.xml (31KB, xml)

Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES