Skip to main content
NCBI home page
MicrobiologyOpen logoLink to MicrobiologyOpen
. 2020 Oct 1;9(11):e1126. doi: 10.1002/mbo3.1126

Molecular characterization of clinical isolates from vascular access infection: A single‐institution study

Yuan‐Hsi Tseng 1,2, Min Yi Wong 1,3,4, Tsung‐Yu Huang 2,3,5, Bor‐Shyh Lin 4, Chun‐Wu Tung 2,6, Yao‐Kuang Huang 1,2,3,✉
PMCID: PMC7658447  PMID: 33006272

Abstract

Hemodialysis requires repeated, reliable access to the systemic circulation; therefore, a well‐functioning vascular access (VA) procedure is crucial for stable hemodialysis. VA infections (VAIs) constitute the most challenging complication and cause considerable morbidity, loss of access, and even death. In this study, we investigated the molecular profiles of different bacterial isolates retrieved from various types of VA grafts. We collected clinical isolates from hemodialysis patients with VAIs in our institution for the period between 2013 and 2018. We identified the bacterial isolates using standard biochemical procedures; we used a polymerase chain reaction for coagulase‐negative staphylococci (CoNS) and Burkholderia cepacia complex (BCC) species identification. The antibiotic resistance and molecular profile were analyzed using the disk diffusion method and multilocus sequence typing, respectively. We studied 150 isolates retrieved from patients with VAI and observed that Staphylococcus aureus was the predominant bacterial species, followed by S. argenteus, BCC, and CoNS. According to multilocus sequence typing data, we identified a wide variety of sequence types (STs) in S. aureus isolates, with ST59, ST45, and ST239 being the predominant types. Burkholderia cepacia with two new ST types, namely ST1723 and ST1724, accounted for most of the BCC infections, along with ST102 B. contaminans, which were mainly isolated from infected tunneled‐cuffed catheters. In summary, the increased incidence of S. argenteus and BCC infections provides insights into their potential clinical effects in VAIs. The various STs identified in different bacterial species indicate the high genetic diversity of bacterial species isolated from VAIs in our institution.

Keywords: Burkholderia cepacia complex, coagulase‐negative staphylococci, multilocus sequence typing, Staphylococcus aureus, vascular access infection

Staphylococcus aureus was the predominant pathogen in vascular access infections in our single‐institution study. Burkholderia cepacia complex was exclusively retrieved from tunneled‐cuffed catheter‐related infections. The increased incidence of Staphylococcus argenteus and Burkholderia cepacia complex infections provides insights into their potential clinical effects in vascular access infections.

graphic file with name MBO3-9-e1126-g002.jpg

1. BACKGROUND

The population of new patients with end‐stage renal disease (ESRD) receiving dialysis in Taiwan increased from 10,697 in 2013 to 11,596 in 2016. According to the 2018 Annual Report on Kidney Disease in Taiwan, the proportion of new patients with ESRD receiving hemodialysis was 88.9% in 2013, but it increased to 89.7% in 2016. The establishment of a well‐functioning vascular access (VA) procedure is fundamental to enabling patients to undergo an efficient hemodialysis procedure. Although infection related to VA is not common, it is a problematic complication that may lead to access loss, sepsis, and even death. The major types of VA conduits commonly used are native arteriovenous fistulas (AVFs), prosthetic arteriovenous grafts (AVGs), and central venous catheters (CVCs; both temporary and cuffed tunneled). AVFs and AVGs are preferred over CVCs for dialysis access because CVCs expose patients undergoing hemodialysis to an increased risk of healthcare‐associated infections (Lafrance et al., 2008). Pathogens primarily responsible for CVC‐related infections are Staphylococcus spp., Gram‐negative enteric bacilli, Pseudomonas aeruginosa, and Candida spp. These pathogens can form a biofilm on the CVC walls, rendering them strongly resistant to antibiotic action (Santoro et al., 2014). The mechanism underlying VA infections (VAIs) generally involves the migration of surface organisms along the external surface of the catheter from the exit‐site wound or through the lumen of the catheter. Staphylococcus aureus and coagulase‐negative staphylococci (CoNS) species are the most frequently isolated bacteria from VAIs.

S. aureus is among the most common causes of both endemic and epidemic infections acquired in hospitals. Patients undergoing hemodialysis are frequently exposed to S. aureus during their stay in dialysis centers, hospitals, or rest homes would have different implications, such as deficient hygiene measures. Previous studies indicated that a high proportion of hemodialysis patients occur nasal colonization of S. aureus (Boelaert et al., 1996; Sewell et al., 1982). The VA site for hemodialysis is a potential site of entry for the pathogen, and the risk of infection is particularly high when a CVC is used (Scheuch et al., 2019; Chu et al., 2019). Furthermore, recent research has reported that CoNS species as the most common etiology of nosocomial bloodstream infection (BSI), especially CVC‐related BSI (CRBSI), in hospitalized patients (Freixas et al., 2013; Hebeisen et al., 2019; Lebeaux et al., 2014).

P. aeruginosa is one of the major causes of nosocomial infection, particularly in immunocompromised patients. It has a predilection for moist environments that serve as its natural reservoirs; therefore, P. aeruginosa is a common pathogen in graft infection (Chen et al., 2004; Pham et al., 2019).

We conducted a 5‐year single‐institution study to (a) investigate the prevalence of bacterial species from VAI, (b) determine the molecular characteristics of different bacterial species isolated from various types of VAIs, and (c) establish the correlation between bacterial species, sequence types (STs), and VAI types.

2. MATERIALS AND METHODS

2.1. Study setting and bacterial isolate collection and identification

This single‐institution study was conducted between September 2013 and December 2018 at Chiayi Chang Gung Memorial Hospital, a territory referral hospital in Taiwan. We prospectively collected 150 bacterial isolates from blood and contaminated device samples of 78 patients with VAI who required removal of AVGs and tunneled‐cuffed catheters (TCCs). We explained the study procedures to each patient and obtained informed consent before performing the procedures. Patients with poor compliance and those who declined to be part of this study were excluded. Demographic characteristics, including age and sex, were collected in addition to the following baseline characteristics: underlying cause of the end‐stage renal disease (ESRD), type of VA, VAI site, and comorbidities. The bacterial isolates were cultured under laboratory standards. The samples were routinely cultured on blood agar at 37°C overnight. We performed strain identification through standard biochemical (phenotypic) procedures.

2.2. Antibiotic susceptibility testing

We subjected all clinical isolates to antimicrobial susceptibility testing against a panel of antimicrobial agents by using the Kirby–Bauer disk diffusion method following the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2013).

2.3. Genomic DNA extraction

A single colony from a clinical isolate was inoculated in tryptic soy broth (TSB) for 16 h, and 1 ml of the overnight culture was harvested using centrifugation at 16,500 × g for 5 min. Bacterial cells were suspended in 1 ml of ultrapure water and heated at 100°C for 15 min. The supernatant containing the DNA was stored at 4°C until further use.

2.4. Molecular characterization

2.4.1. CoNS species determination

To further determine the CoNS species, we performed a multiplex polymerase chain reaction (PCR) assay using previously described primer sets (Campos‐Pena et al., 2014; Kim et al., 2018). Ten CoNS species, namely S. epidermidis, S. haemolyticus, S. pasteuri, S. warneri, S. xylosus, S. capitis, S. caprae, S. saprophyticus, S. lugdunensis, and S. hominis, were determined by the presence and size of the PCR product.

2.4.2. Burkholderia cepacia complex species identification

We conducted recA sequencing to identify the Burkholderia cepacia complex (BCC) species. We performed PCR amplification using specific primers and conditions described by Fehlberg et al. (2013). Cycle sequencing was performed using a BigDye Terminator v3.1 cycle sequencing kit and an ABI 3730xl DNA analyzer. We further analyzed the recA sequences and aligned them to a database using NCBI BLASTn.

2.4.3. Detection of mecA and typing of SCCmec for S. aureus and S. epidermidis

To confirm methicillin‐resistant S. aureus and S. epidermidis, we performed mecA detection using PCR with the mecA‐specific primer pairs, as described previously (Pournajaf et al., 2014). We also performed a multiplex PCR assay using four primer pairs to identify SCCmec types I–V (Boye et al., 2007).

2.4.4. Multilocus sequence typing and phylogenetic analysis

For the S. aureus, S. epidermidis, P. aeruginosa, and BCC isolates, we conducted multilocus sequence typing (MLST) by amplifying seven housekeeping genes using previously described primer sets (Curran et al., 2004; Enright et al., 2000; Spilker et al., 2009; Thomas et al., 2007). When aroE of S. aureus was not detected, alternative primers were used: aroE745‐up, 5′‐TTATCACCGTCGATGCATAGTGCA‐3′; aroE255‐down, 5′‐CGGAGTAGTATTTATCACAATATC‐3′ (Ruimy et al., 2009). Furthermore, we used an alternative forward primer for undetected trpB of BCC: trpE‐F2, 5′‐AAGGACGCGCTGAACGAAGC‐3′. The alternative primers used for the undetected tpiA of S. epidermidis were as follows: tpi‐DF, 5′‐GCAAGTATTTGGATAAAAGC‐3′; tpi‐DR, 5′‐CCATCTAAGATGATTAAGGC‐3′. The allele numbers and STs of each isolate were assigned according to the MLST database (https://pubmlst.org/). We performed an advanced cluster analysis to define clonal complexes (CCs) by using BioNumerics software ver. 7.6 (Applied Maths).

2.4.5. Typing of spa for S. aureus isolates

For the S. aureus isolates, the polymorphic region of the staphylococcal protein A (spa) gene was amplified using previously described primer pairs and sequenced (Schuster et al., 2017; Strommenger et al., 2008). We determined spa types using BioNumerics software.

3. RESULTS

3.1. Descriptive characteristics of hemodialysis patients with VAIs

In total, 78 hemodialysis patients with VAI were enrolled in this 5‐year single‐institution study. Table 1 summarizes the descriptive characteristics of patients with VAI. Cases were more female than male, and the most prevalent age distribution was between 50 to 79 years old, with the median age of 65.95 years. All patients suffered from ESRD, and most of them were hypertensive, anemic, and diabetic. Over 50% of patients were more likely to have TCCs as their hemodialysis access, and about 53% of patients with VAI were involved in S. aureus infections.

Table 1.

Clinical characteristics of hemodialysis patients with vascular access infection (VAI).

Variable No. of patients Proportion (%)
Sex
Male 29 37%
Female 49 63%
Age (year)
30–39 2 3%
40–49 6 8%
50–59 19 24%
60–69 22 28%
70–79 17 22%
80–89 9 12%
90–99 3 4%
Type of vascular access (VA)
AVG 43 55%
TCC 35 45%
Types of bacterial infection
Multispecies infection w/S. aureus 9 12%
Multispecies infection w/o S. aureus 10 13%
S. aureus only 32 41%
Others 27 35%
Site of bacterial isolation
Blood 8 10%
Contaminated device 49 63%
Blood + Contaminated device 21 27%
Comorbidity
ESRD 78 100%
HTN 71 91%
DM 52 67%
Normocytic anemia 56 72%
CHB 11 14%
CHC 29 37%
CAD 11 14%
CHF 13 17%
PAOD 8 10%
Dyslipidemia 14 18%
Carcinoma/Cancer 10 13%
Open in a new tab

Abbreviations: AVG, arteriovenous graft; CAD, coronary artery disease; CHB, chronic hepatitis B; CHC, chronic hepatitis C; CHF, congestive heart failure; DM, diabetes mellitus; ESRD, end‐stage renal disease; HTN, hypertension; PAOD, peripheral artery occlusive disease; TCCs: tunneled‐cuffed catheters.

3.2. Analysis of clinical isolates collected from patients with VAIs

From 2013 to 2018, we collected 150 clinical isolates from patients with VAIs—including AVG‐ and TCC‐related infections—undergoing hemodialysis in our institution (Figure 1). To investigate the prevalence of different species of bacterial infections across time, we divided the study period into two intervals: (Lafrance et al., 2008) from 2013 to 2014 and (Santoro et al., 2014) from 2015 to 2018. The total number of collected isolates decreased in the second interval; however, the prevalence of S. aureus and S. argenteus infection increased by approximately 20% in total (Table 2). Moreover, the patients undergoing hemodialysis were mainly infected by Gram‐positive bacteria, particularly S. aureus, S. argenteus, and CoNS. P. aeruginosa and BCC species were the main Gram‐negative bacteria causing VAIs in our institution.

Figure 1.

Figure 1

Open in a new tab

Distribution of isolates from vascular access infections in hemodialysis patients

Table 2.

Prevalence (%) of 150 isolated vascular access infection (VAI) pathogens among hemodialysis patients in Chang Gung Memorial Hospital in Chiayi

Bacterial isolates (Total n = 150) Total
S. aureus S. argenteus CoNS P. aeruginosa BCC Others
G (+) a G (‒) b
No. 59 (39.33%) 11 (7.33%) 18 (12%) 10 (6.67%) 13 (8.67%) 17 (11.33%) 22 (14.67%) 150
Year
2013‐2014 32 (35.16%) 3 (3.30%) 12 (13.19%) 8 (8.79%) 5 (5.49%) 14 (15.38%) 17 (18.68%) 91
2015‐2018 27 (45.76%) 8 (13.56%) 6 (10.17%) 2 (3.39%) 8 (13.56%) 3 (5.08%) 5 (8.47%) 59
Origin
AVG 37 8 10 4 0 9 11 79
TCC 22 3 8 6 13 8 11 71
Isolation
Blood 14 3 6 2 4 3 3 35
Others c 45 8 12 8 9 14 19 115
Open in a new tab
a

Others G (+) included Corynebacterium spp., Corynebacterium jeikeium, Clostridium perfringens, Enterococcus faecalis, Enterococcus faecium, Group D Streptococcus (GDS), Streptococcus agalactiae, and Viridans streptococcus

b

Others G (−) included Acinetobacter baumannii, Bacteroides fragilis, Bacteroides thetaiotaomicron, Citrobacter koseri, Escherichia coli, Escherichia spp., Enterobacter cloacae, Klebsiella oxytoca, Klebsiella pneumoniae, Morganella morganii, Proteus mirabilis, Proteus vulgaris, and Stenotrophomonas maltophilia

c

Others included abscess, AV‐shunt, body fluid, CVP, graft, Hickman, pus, tissue, and wound.

Regarding species isolation according to VAI types, Staphylococcus spp. were mostly isolated from AVG‐related infections, whereas BCC species were mainly isolated from TCC‐related infections.

3.3. Molecular characterization of S. aureus isolates

We observed that of 70 S. aureus isolates, 11 were of S. argenteus, which is a novel staphylococcal species that is closely related to S. aureus genetically and has recently been defined as a part of the S. aureus complex (SAC) (Aung et al., 2019; Jiang et al., 2018). In this study, we identified S. argenteus using MLST analysis because the species cannot be distinguished from S. aureus through conventional microbiological identification methods. All S. argenteus isolates belonged to ST2250 with non‐typeable spa type, were methicillin‐susceptible, were mecA negative; however, one isolate carried the SCCmec type I structure.

Among 59 S. aureus isolates, we identified 15 STs (Table 3). Specifically, ST239, ST45, and ST59 were predominant in methicillin‐resistant S. aureus (MRSA) isolates, and ST15 and ST7 were predominant in methicillin‐sensitive S. aureus (MSSA); ST45, ST59, and ST15 were dominant in blood culture. Also, ST59, along with ST30 and ST239, was frequently isolated from contaminated implant devices. Besides, isolates with ST239 were multidrug‐resistant (≥3 antimicrobial classes) and showing resistance toward at least three types of non‐β‐lactam antibiotics (Table A1). ST8, ST15, ST30, and ST45 were more prevalent in AVG isolates than in TCC isolates. Furthermore, we assigned 25 spa types to the isolates, with t437, t4864, t1081, and t091 being the predominant spa types. We observed ST8‐t008 and ST239‐t4864 in both MRSA and MSSA. Moreover, we analyzed the distribution of diverse STs and spa types among various SCCmec types. ST5‐SCCmecIV‐t437 (abbreviated as ST5‐IV‐t437), ST59‐V‐t437, ST45‐V‐t081, and ST7‐MSSA‐t091 were the most prevalent clones in this study.

Table 3.

Distribution of MLST, spa types, and SCCmec types in different isolates of MRSA and MSSA clones according to MLST clone complex (CC)

CC ST type spa type SCCmec Case Isolation

MRSA

n = 37

 CC5 5 t002(2) II (2) AVG (1), TCC (1) Blood (1), Others (1)
CC8 8 t008(1) IV (1) AVG (1) Others (1)
239 t4864(2), t3528(1), t037(2), t748(1) II (2), III (4) AVG (2), TCC (4) Blood (1), Others (5)
4798 t037(1) III (1) TCC (1) Others (1)
CC30 30 t019(4), t1836(1) IV (5) AVG (3), TCC (2) Others (5)
CC45 45 t002(1), t026(3), t1081(4), t2383(1) II (1), IV (4), V (4) AVG (6), TCC (3) Blood (4), Others (5)
508 t026(1) NT (1) AVG (1) Others (1)
Other 59 t437(7), t3513(3), t3527(2) IV (7), V (5) AVG (6), TCC (6) Blood (3), Others (9)

MSSA

n = 22

 CC1 1 t2457(1) NA (1) TCC (1) Others (1)
188 t2769(1), t189(1) I (1), NA (1) AVG (1), TCC (1) Others (2)
CC8 8 t008(2) NA (2) AVG (2) Others (2)
239 t4864(2) NA (2) AVG (2) Others (2)
CC15 15 t803(2), t279(2), t547(1), t084(1) NA (6) AVG (5), TCC (1) Blood (3), Others (3)
CC30 30 t3732(1) NA (1) AVG (1) Others (1)
CC97 97 t224(1) NA (1) AVG (1) Others (1)
Other 7 t091(4) NA (4) AVG (2), TCC (2) Blood (1), Others (3)
398 t571(1) NA (1) AVG (1) Others (1)
845 t084(2) NA (2) AVG (2) Blood (1), Others (1)
Open in a new tab

Abbreviations: AVG, arteriovenous graft; CC, clonal complex; NA, not applicable; NT, non‐typeable, no corresponding band was found in multiplex PCR for SCCmec typing; TCC, tunneled‐cuffed catheter.

3.4. Molecular characterization of CoNS isolates

Four staphylococcal species were successfully identified among the 18 CoNS isolates, namely S. epidermidis (n = 9), S. haemolyticus (n = 2), S. hominis (n = 1), and S. lugdunensis (n = 1), and five isolates were unclassified; 16 isolates were methicillin‐resistant (Table 4). Besides, approximately 78% of them were multidrug‐resistant (Table A2). Methicillin‐resistant S. epidermidis (MRSE) was the predominant species that belonged to seven distinct STs: ST2, ST22, ST57, ST173, ST226, ST490, and ST810. Of the nine MRSE isolates, two carried multiple SCCmec types, and the predominant SCCmec type was type IV. For the S. haemolyticus isolates, the oxacillin‐susceptible isolate carried mecA and SCCmec type V. Moreover, the identified S. hominis and S. lugdunensis isolates carried SCCmec type II from AVG‐ and TCC‐related infections, respectively, and were methicillin‐resistant. Among the five unidentified CoNS isolates, two were methicillin‐resistant CoNS (MR‐CoNS) that did not carry mecA. Moreover, of the CoNS isolates, approximately 66.67% and 33.33% were isolated from contaminated implant devices and blood culture, respectively. Nevertheless, this study revealed no correlation between ST and origin of isolation.

Table 4.

Molecular characterization of methicillin‐resistant and methicillin‐susceptible coagulase‐negative staphylococci (CoNS) isolates from vascular access infections

Species ST type Case Isolation SCCmec No.

S. epidermidis

n = 9

 MRSE 2 TCC Others IV 1
22 AVG Others I 1
TCC Blood 1
57 TCC Others IV 1
173 AVG Others IV + V 1
226 AVG Others IV 1
490 AVG Others I + III 2
810 AVG Blood IV 1

S. haemolyticus

n = 2

 MRSH 1 TCC Blood V 1
MSSH 9 AVG Others V 1

S. hominis

n = 1

 MRSHo ND AVG Blood NT 1

S. lugdunensis

n = 1

 MRSL ND TCC Others II 1

Coag(‐) Staphylococcus

n = 5

 MR‐CoNS ND TCC Blood NT 2
ND TCC Others NA 1
ND AVG Others NA 1
MS‐CoNS ND AVG Others NA 1
Open in a new tab

Abbreviations: AVG, arteriovenous graft; NA, not applicable; ND, not determined; NT, non‐typeable, no corresponding band was found in multiplex PCR for SCCmec typing; TCC, tunneled‐cuffed catheter.

3.5. Molecular characterization of P. aeruginosa isolates

Of nine P. aeruginosa isolates, we identified six STs, one of which was a new ST (ST3373). Among the six STs, five were singletons, signifying that they represented only one strain (Table 5). Among the P. aeruginosa isolates, nearly 77.8% were from contaminated implant devices and nearly 22.2% were from blood culture. We identified a high antibiotic susceptibility rate (77.78%; 7/9) for the VAIs, with only two of the nine strains being resistant to antibiotics. ST235, the most prevalent Pseudomonas spp. to have multiple‐drug resistance, was resistant to aminoglycoside and fluoroquinolones in this study.

Table 5.

Distribution of MLST and antibiotic resistance of P. aeruginosa isolated from different types of access

ST type Case Isolation Antibiotic resistance profile No.
235 TCC Blood CIP, GEN, LVX 1
244 AVG Blood NONE 1
TCC Others 1
303 AVG Others CAZ, PIP, TZP 1
381 TCC Others NONE 1
2682 AVG Others 1
3373 TCC Others 2
ND TCC Others 1
Total 9
Open in a new tab

Abbreviations: AVG, arteriovenous graft; CAZ, ceftazidime; CIP, ciprofloxacin; GEN, gentamicin; LVX, levofloxacin; PIP, piperacillin; TCC, tunneled‐cuffed catheter.

3.6. Molecular characterization of BCC isolates

We identified a total of 13 BCC isolates from TCC‐related VAIs; these isolates involved two species, namely B. contaminans and B. cepacia, of which B. cepacia was the predominant species (Table 6). MLST typing revealed that B. cepacia strains possessed new MLST types: ST1723 (n = 5) and ST1724 (n = 5). Most of the isolates that belonged to ST1723 were resistant to imipenem, whereas ST1724 isolates were resistant to gentamicin. Among the BCC isolates, approximately 70% were from contaminated implant devices and 30% were from blood culture. However, the study revealed no correlation between the origin of isolation and ST.

Table 6.

Distribution of MLST and antibiotic resistance of B. cepacia complex (BCC) isolated from different types of vascular access

Species ST type Case Isolation Antibiotic resistance profile No.

B. contaminans

n = 3

 102 TCC Others CST 2
Blood CST 1

B. cepacia

n = 10

 1723 TCC Others CST, GEN, IPM 2
CST, IPM 1
IPM, DOR 1
Blood ND 1
1724 Blood CST, GEN, IPM 1
Others CST, GEN, IPM 1
Blood GEN 1
Others GEN 1
Others No 1
Total 13
Open in a new tab

Abbreviations: CST, colistin; DOR, doripenem; GEN, gentamicin; IPM, imipenem; TCC, tunneled‐cuffed catheter.

4. DISCUSSION

VAIs constitute a risk factor for infection in patients undergoing hemodialysis. The pattern of microbes responsible for infection varies substantially among different types of access (Tokars et al., 2002). Pooled data show that S. epidermidis accounts for most CVC‐related infections, whereas S. aureus is more common in AVF‐ and AVG‐related infections. In our study, staphylococcal species accounted for 58.67% of VAIs, with S. aureus being the most commonly implicated species, followed by CoNS and S. argenteus. In the 150 isolates collected from patients with VAIs, S. aureus was the predominant pathogen in AVG‐ and TCC‐related infections, with a rate of 37/79 (46.84%) and 22/71 (30.99%), respectively. S. argenteus, another in SAC species, was also more predominant in AVG‐related infections than in TCC‐related infections. Notably, the nine S. epidermidis isolates were mainly collected from AVG‐related infections (6/9); this finding is not consistent with those reported by a previous study (Saeed Abdulrahman et al., 2002), which indicated that improving sterilization management procedures during hemodialysis may reduce the number of skin clones such as S.epidermidis on TCCs. Regarding representative Gram‐negative bacteria in VAIs, P. aeruginosa and BCC predominantly caused TCC infections; in particular, BCC caused only TCC infections.

The type of VA is the most significant predictor of the infection risk, with AVGs and TCCs having higher infection risk than nature fistulas (Taylor et al., 2004). In patients undergoing hemodialysis who are particularly vulnerable to S. aureus infections, VA is the major entry for this golden germ. Previous studies indicated that a total of 19 to 26% of all S. aureus bacteremia occur in patients with ESRD (Chan et al., 2012; Fowler et al., 2003; Mylotte & Tayara, 2000; Vandecasteele et al., 2009). The incidence of which S. aureus infection, especially MRSA infection, was reported to be higher than that observed in the general population by 100‐fold (Control CfD, Prevention, 2005). In our study, MRSA and MSSA infections accounted for 62.71% and 37.29% of S. aureus VAIs, respectively, with ST45, ST59, and ST239 being the predominant clones. Compared with our previous study (Chu et al., 2019), ST45, ST59, and ST239 were also common in other diseases or surgical infections, indicating that these are major clones in our institution and warrant more attention. According to the previous study in two regional hospitals in Taiwan, ST59, ST45, and ST239 were also the predominant nasal MRSA of patients visiting the emergency department (Wu et al., 2019). In addition to being the dominant lineage in Taiwan, ST59 is also endemic in China, Japan, Vietnam, Singapore, and Hong Kong (Chen & Huang, 2014). Notably, we also found the S. aureus ST239—an emerging multidrug‐resistant MRSA clone worldwide that generally carries an SCCmec type III element—in methicillin‐sensitive strains without mecA. Furthermore, a novel nonpigmented staphylococcal lineage that cannot be distinguished from S. aureus using routine microbiological identification methods is now formally classified as S. argenteus; it was initially described as part of the distinct S. aureus CC (CC75) that is prevalent in aboriginal communities in the Northern Territory of Australia (Ng et al., 2009). S. argenteus comprising several CCs with many STs, especially ST2250, is the most commonly reported lineage with extensive geographic distribution, including France, Belgium, Thailand, Taiwan, Japan, and China, indicating a global spread (Argudin et al., 2016; Chantratita et al., 2016; Dupieux et al., 2015; Moradigaravand et al., 2017; Chen et al., 2018; Ohnishi et al., 2018; Li et al., 2019). The widespread S. argenteus has been isolated from both humans and animals. In our institution, ST2250 was the primary and only methicillin‐sensitive ST revealed in VAIs, a finding that is consistent with those for previously reported S. argenteus‐infected bacteremia cases in Taiwan (Chen et al., 2018).

The BCC is a group of opportunistic pathogens comprising at least 20 different species that commonly cause infections in immunocompromised patients, particularly those with cystic fibrosis (CF). B. contaminans was first identified from a contaminated Sargasso Sea DNA sample (Mahenthiralingam et al., 2006) and is increasingly associated with CF. However, other hospitalized non‐CF patients have been reported to be affected by B. contaminans and B. cepacia infections. Nevertheless, B. contaminans is a contaminant in manufactured products, including pharmaceuticals and disinfectants (Martin et al., 2011; Moehring et al., 2014). In our institution, we obtained all BCC isolates from infected TCCs in hemodialysis patients with VAI; this suggests that the repeated use of mechanical device detergent and hemodialyzer reprocessing may cause contamination and that BCC species can survive in a harsh environment.

In this 5‐year study, we collected 150 isolates from hemodialysis patients with VAIs and analyzed the isolates based on the year of isolation (i.e., study period interval). Although the number of isolates from infected accesses was relatively low in the interval 2015–2018, the incidence of S. aureus, S. argenteus, and BCC infections increased by approximately 10% (i.e., 45.76%, 13.56%, and 13.56%, respectively). By contrast, CoNS and P. aeruginosa infections decreased by nearly 3%–5%. Previous studies have not addressed the spread or transmission of S. argenteus in the hospital environment (Becker et al., 2019). Nevertheless, the growing trend of S. argenteus in VAIs indicates the potential and importance of this novel species in healthcare‐associated infections. Since the therapeutic and clinical implications of S. argenteus are similar to those of S. aureus; therefore, infection prevention and control measures for S. aureus should be adopted for S. argenteus.

4.1. Study limitations

The major limitation of this study is that the examined VAIs were mainly responsible for the removal of access. By contrast, we did not include infections managed through early intervention with conservative antibiotic treatment after identification. Therefore, we could not provide an overview of VAIs in this study.

5. CONCLUSIONS

In this study, we examined 150 clinical isolates retrieved from infected VA grafts, including AVGs and TCCs, in hemodialysis patients by conducting 5‐year epidemiological surveillance at a single institution in Taiwan. The three major STs (i.e., ST239, ST59, and ST45) of MRSA with various spa types showed high genetic diversity in S. aureus VAIs. Moreover, the ST102 B. contaminans isolate and two newly identified STs, namely ST1723 and ST1724 B. cepacia isolates, were exclusively retrieved from TCC‐related infections. The increased incidence of infections engendered by S. argenteus and BCC provides insight into the potential clinical effects of S. argenteus and BCC species in VAIs.

CONFLICT OF INTERESTS

None declared.

AUTHOR CONTRIBUTION

Yuan‐Hsi Tseng: Conceptualization (lead); Funding acquisition (lead); Methodology (lead); Writing‐original draft (lead); Writing‐review & editing (equal). Min Yi Wong: Conceptualization (lead); Formal analysis (lead); Investigation (lead); Writing‐original draft (lead); Writing‐review & editing (equal). Tsung‐Yu Huang: Formal analysis (supporting); Investigation (supporting); Writing‐original draft (supporting); Writing‐review & editing (equal). Bor‐Shyh Lin: Formal analysis (supporting); Investigation (supporting); Writing‐original draft (supporting); Writing‐review & editing (equal). Chun‐Wu Tung: Formal analysis (supporting); Investigation (supporting); Writing‐original draft (supporting); Writing‐review & editing (equal). Yao‐Kuang Huang: Conceptualization (supporting); Funding acquisition (lead); Writing‐original draft (supporting); Writing‐review & editing (equal).

ETHICS STATEMENT

This study was approved by the Institutional Review Board (IRB) of Chang Gung Memorial Hospital (IRB Nos: IRB201204188B0 and IRB201508482B0). Written consent was obtained from patients, and the study was performed following approved guidelines.

ACKNOWLEDGEMENTS

This study was supported by grants from Chang Gung Memorial Hospital, Chiayi, Taiwan (Grant numbers: CMRPG6J0401, CMRPG6J0402, CMRPG6J0403, CMRPG6H0292, and CMRPG6H0293).

APPENDIX 1.

Table A1.

Distribution of antibiotic resistance profile in different S. aureus isolates according to ST type

S. aureus CC ST type spa Antibiotic profile mecA gene SCCmec No.
MRSA

CC30

n = 5

 30 t019 ERY, OXA, PEN + IV 1
CLI, ERY, OXA, PEN IV 3
t1836 OXA, PEN IV 1

CC45

n = 10

 45 t002 CLI, ERY, FUS, OXA, PEN + II 1
t026 OXA, PEN IV 2
CLI, ERY, OXA, PEN IV 1
t1081 CLI, ERY, FUS, OXA, PEN V 4
t2383 CLI, ERY, OXA, PEN IV 1
508 t026 OXA, PEN − ‐ 1

CC5

n = 2

 5 t002 CLI, ERY, OXA, PEN + II 1
CLI, ERY, FUS, OXA, PEN II 1

CC8

n = 8

 8 t008 ERY, OXA, PEN + IV 1
239 t4864 CLI, ERY, OXA, PEN, SXT II 2
t3528 CLI, ERY, OXA, PEN, SXT, TGC III 1
t037 CLI, ERY, OXA, PEN, SXT III 1
CLI, ERY, FUS, OXA, PEN, SXT III 1
t748 CLI, ERY, FUS, OXA, PEN, SXT III 1
4798 t037 CLI, ERY, FUS, OXA, PEN, SXT III 1

Other

n = 12

 59 t437 CLI, ERY, OXA, PEN + IV 4
CLI, ERY, OXA, PEN V 3
t3513 CLI, ERY, OXA, PEN IV 3
t3527 CLI, ERY, OXA, PEN V 2
MSSA

CC1

n = 3

 1 t2457 PEN − ‐ 1
188 t2769 PEN ‐ 1
t189 PEN I 1

CC8

n = 4

 8 t008 PEN ‐ 2
239 t4864 CLI, ERY, PEN, SXT ‐ 2

CC15

n = 6

 15 t803 PEN − ‐ 2
t279 PEN ‐ 2
t547 PEN ‐ 1
t084 ERY, PEN ‐ 1
CC30 30 t3732 CLI, ERY, PEN − ‐ 1
CC97 97 t224 PEN − ‐ 1

Other

n = 7

 7 t091 PEN − ‐ 3
ERY, PEN ‐ 1
398 t571 CLI, ERY ‐ 1
845 t084 PEN ‐ 2
Open in a new tab

Table A2.

Distribution of antibiotic resistance profile in different coagulase‐negative staphylococci (CoNS) isolates according to ST type

Species ST type Antibiotic resistance profile SCCmec No.
S. epidermidis 2 CLI, ERY, OXA, PEN, SXT IV 1
22 CLI, ERY, OXA, PEN, SXT I 2
57 OXA, PEN IV 1
173 ERY, OXA, PEN, SXT IV + V 1
226 ERY, OXA, PEN, SXT IV 1
490 CLI, ERY, OXA, PEN, SXT I + III 2
810 OXA, PEN, SXT IV 1
S. haemolyticus 1 CLI, ERY, OXA, PEN, SXT V 1
9 PEN V 1
S. hominis ND ERY, OXA, PEN, SXT NT 1
S. lugdunensis ND CLI, ERY, OXA, PEN II 1
Coag(‐) Staphylococcus ND CLI, ERY, OXA, PEN, SXT NT 1
ND CLI, ERY, OXA, PEN NT 1
ND CLI, ERY, OXA, PEN, SXT NT 1
ND CLI, ERY, OXA, PEN, SXT NT 1
ND PEN NT 1
Open in a new tab

Tseng Y‐H, Wong MY, Huang T‐Y, Lin B‐S, Tung C‐W, Huang Y‐K. Molecular characterization of clinical isolates from vascular access infection: A singleinstitution study. MicrobiologyOpen. 2020;9:e1126. 10.1002/mbo3.1126

Yuan‐Hsi Tseng and Min Yi Wong contributed equally to this manuscript.

DATA AVAILABILITY STATEMENT

All data generated or analyzed during this study are included in this published article.

REFERENCES

  1. Control CfD, Prevention (2007). Invasive methicillin‐resistant Staphylococcus aureus infections among dialysis patients–United States, 2005. MMWR Morbidity and Mortality Weekly Report, 56(9), 197. [PubMed] [Google Scholar]
  2. Argudin, M. A. , Dodemont, M. , Vandendriessche, S. , Rottiers, S. , Tribes, C. , Roisin, S. , de Mendonça, R. , Nonhoff, C. , Deplano, A. , & Denis, O. (2016). Low occurrence of the new species Staphylococcus argenteus in a Staphylococcus aureus collection of human isolates from Belgium. European Journal of Clinical Microbiology and Infectious Diseases, 35(6), 1017–1022. [DOI] [PubMed] [Google Scholar]
  3. Aung, M. S. , San, T. , San, N. , Oo, W. M. , Ko, P. M. , Thet, K. T. , Urushibara, N. , Kawaguchiya, M. , Sumi, A. , & Kobayashi, N. (2019). Molecular characterization of Staphylococcus argenteus in Myanmar: identification of novel genotypes/clusters in staphylocoagulase, protein A, alpha‐haemolysin and other virulence factors. Journal of Medical Microbiology, 68(1), 95–104. [DOI] [PubMed] [Google Scholar]
  4. Becker, K. , Schaumburg, F. , Kearns, A. , Larsen, A. R. , Lindsay, J. A. , Skov, R. L. , & Westh H. (2019). Implications of identifying the recently defined members of the Staphylococcus aureus complex S. argenteus and S. schweitzeri: a position paper of members of the ESCMID Study Group for Staphylococci and Staphylococcal Diseases (ESGS). Clinical Microbiology & Infection, 25(9), 1064–1070. [DOI] [PubMed] [Google Scholar]
  5. Boelaert, J. R. , Van Landuyt, H. W. , Gordts, B. Z. , De Baere, Y. A. , Messer, S. A. , & Herwaldt, L. A. (1996). Nasal and cutaneous carriage of Staphylococcus aureus in hemodialysis patients: the effect of nasal mupirocin. Infection Control and Hospital Epidemiology, 17(12), 809–811. [DOI] [PubMed] [Google Scholar]
  6. Boye, K. , Bartels, M. D. , Andersen, I. S. , Moller, J. A. , & Westh, H. (2007). A new multiplex PCR for easy screening of methicillin‐resistant Staphylococcus aureus SCCmec types I‐V. Clinical Microbiology & Infection, 13(7), 725–727. [DOI] [PubMed] [Google Scholar]
  7. Campos‐Pena, E. , Martin‐Nunez, E. , Pulido‐Reyes, G. , Martin‐Padron, J. , Caro‐Carrillo, E. , Donate‐Correa, J. , Lorenzo‐Castrillejo, I. , Alcoba‐Florez, J. , Machin, F. , & Mendez‐Alvarez, S. (2014). Multiplex PCR assay for identification of six different Staphylococcus spp. and simultaneous detection of methicillin and mupirocin resistance. Journal of Clinical Microbiology, 52(7), 2698–2701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chan, K. E. , Warren, H. S. , Thadhani, R. I. , Steele, D. J. , Hymes, J. L. , Maddux, F. W. , & Hakim R. M. (2012). Prevalence and outcomes of antimicrobial treatment for Staphylococcus aureus bacteremia in outpatients with ESRD. Journal of the American Society of Nephrology, 23(9), 1551–1559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chantratita, N. , Wikraiphat, C. , Tandhavanant, S. , Wongsuvan, G. , Ariyaprasert, P. , Suntornsut, P. , Thaipadungpanit, J. , Teerawattanasook, N. , Jutrakul, Y. , Srisurat, N. , Chaimanee, P. , Anukunananchai, J. , Phiphitaporn, S. , Srisamang, P. , Chetchotisakd, P. , West, T. E. , & Peacock, S. J. (2016). Comparison of community‐onset Staphylococcus argenteus and Staphylococcus aureus sepsis in Thailand: a prospective multicentre observational study. Clinical Microbiology & Infection, 22(5), 458.e11–458.e19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen, C. J. , & Huang, Y. C. (2014). New epidemiology of Staphylococcus aureus infection in Asia. Clinical Microbiology & Infection, 20(7), 605–623. [DOI] [PubMed] [Google Scholar]
  11. Chen, S. Y. , Lee, H. , Wang, X. M. , Lee, T. F. , Liao, C. H. , Teng, L. J. , & Hsueh, P.‐R. (2018). High mortality impact of Staphylococcus argenteus on patients with community‐onset staphylococcal bacteraemia. International Journal of Antimicrobial Agents, 52(6), 747–753. [DOI] [PubMed] [Google Scholar]
  12. Chen, Y. K. , Fang, H. C. , Chou, K. J. , Lee, P. T. , & Chung, H. M. (2004). A puzzling cause of persistent Pseudomonas aeruginosa septicaemia in a patient on maintenance haemodialysis. Nephrology, Dialysis, Transplantation, 19(9), 2400–2402. [DOI] [PubMed] [Google Scholar]
  13. Chu, C. , Wong, M. Y. , Tseng, Y. H. , Lin, C. L. , Tung, C. W. , Kao, C. C. , & Huang Y.‐K. (2019). Vascular access infection by Staphylococcus aureus from removed dialysis accesses. Microbiologyopen, 8(8), e800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. CLSI (2013). Performance standards for antimicrobial susceptibility testing; Twenty‐third international supplement. CLSI document M100–S23. CLSI. [Google Scholar]
  15. Curran, B. , Jonas, D. , Grundmann, H. , Pitt, T. , & Dowson, C. G. (2004). Development of a multilocus sequence typing scheme for the opportunistic pathogen Pseudomonas aeruginosa . Journal of Clinical Microbiology, 42(12), 5644–5649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Dupieux, C. , Blonde, R. , Bouchiat, C. , Meugnier, H. , Bes, M. , Laurent, S. , Vandenesch, F. , Laurent, F. , & Tristan, A. (2015). Community‐acquired infections due to Staphylococcus argenteus lineage isolates harbouring the Panton‐Valentine leucocidin, France, 2014. Eurosurveillance, 20(23), 21154. [DOI] [PubMed] [Google Scholar]
  17. Enright, M. C. , Day, N. P. , Davies, C. E. , Peacock, S. J. , & Spratt, B. G. (2000). Multilocus sequence typing for characterization of methicillin‐resistant and methicillin‐susceptible clones of Staphylococcus aureus . Journal of Clinical Microbiology, 38(3), 1008–1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Fehlberg, L. C. , Andrade, L. H. , Assis, D. M. , Pereira, R. H. , Gales, A. C. , & Marques, E. A. (2013). Performance of MALDI‐ToF MS for species identification of Burkholderia cepacia complex clinical isolates. Diagnostic Microbiology and Infectious Disease, 77(2), 126–128. [DOI] [PubMed] [Google Scholar]
  19. Fowler, V. G. Jr , Olsen, M. K. , Corey, G. R. , Woods, C. W. , Cabell, C. H. , Reller, L. B. , Cheng, A. C. , Dudley, T. , & Oddone, E. Z. (2003). Clinical identifiers of complicated Staphylococcus aureus Bacteremia. Archives of Internal Medicine, 163(17), 2066–2072. [DOI] [PubMed] [Google Scholar]
  20. Freixas, N. , Bella, F. , Limon, E. , Pujol, M. , Almirante, B. , & Gudiol, F. (2013). Impact of a multimodal intervention to reduce bloodstream infections related to vascular catheters in non‐ICU wards: a multicentre study. Clinical Microbiology & Infection, 19(9), 838–844. [DOI] [PubMed] [Google Scholar]
  21. Hebeisen, U. P. , Atkinson, A. , Marschall, J. , & Buetti, N. (2019). Catheter‐related bloodstream infections with coagulase‐negative staphylococci: are antibiotics necessary if the catheter is removed? Antimicrobial Resistance & Infection Control, 8, 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jiang, B. , You, B. , Tan, L. , Yu, S. , Li, H. , Bai, G. , Li, S. , Rao, X. , Xie, Z. , Shi, X. , Peng, Y. , & Hu, X. (2018). Clinical Staphylococcus argenteus develops to small colony variants to promote persistent infection. Frontiers in Microbiology, 9, 1347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kim, J. , Hong, J. , Lim, J. A. , Heu, S. , & Roh, E. (2018). Improved multiplex PCR primers for rapid identification of coagulase‐negative staphylococci. Archives of Microbiology, 200(1), 73–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lafrance, J. P. , Rahme, E. , Lelorier, J. , & Iqbal, S. (2008). Vascular access‐related infections: definitions, incidence rates, and risk factors. American Journal of Kidney Diseases, 52(5), 982–993. [DOI] [PubMed] [Google Scholar]
  25. Lebeaux, D. , Fernández‐Hidalgo, N. , Chauhan, A. , Lee, S. , Ghigo, J.‐M. , Almirante, B. , & Beloin, C. (2014). Management of infections related to totally implantable venous‐access ports: challenges and perspectives. The Lancet Infectious Diseases, 14(2), 146–159. [DOI] [PubMed] [Google Scholar]
  26. Li, Q. , Li, Y. , Tang, Y. , Meng, C. , Ingmer, H. , & Jiao, X. (2019). Prevalence and characterization of Staphylococcus aureus and Staphylococcus argenteus in chicken from retail markets in China. Food Control, 96, 158–164. [Google Scholar]
  27. Mahenthiralingam, E. , Baldwin, A. , Drevinek, P. , Vanlaere, E. , Vandamme, P. , LiPuma, J. J. , & Dowson, C. G. (2006). Multilocus sequence typing breathes life into a microbial metagenome. PLoS One, 1, e17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Martin, M. , Christiansen, B. , Caspari, G. , Hogardt, M. , von Thomsen, A. J. , Ott, E. , & Mattner, F. (2011). Hospital‐wide outbreak of Burkholderia contaminans caused by prefabricated moist washcloths. Journal of Hospital Infection, 77(3), 267–270. [DOI] [PubMed] [Google Scholar]
  29. Moehring, R. W. , Lewis, S. S. , Isaacs, P. J. , Schell, W. A. , Thomann, W. R. , Althaus, M. M. , Hazen K. C., Dicks K. V., Lipuma J. J., Chen L. F., & Sexton D. J. (2014). Outbreak of bacteremia due to Burkholderia contaminans linked to intravenous fentanyl from an institutional compounding pharmacy. JAMA Internal Medicine, 174(4), 606–612. [DOI] [PubMed] [Google Scholar]
  30. Moradigaravand, D. , Jamrozy, D. , Mostowy, R. , Anderson, A. , Nickerson, E. K. , Thaipadungpanit, J. , Wuthiekanun, V. , Limmathurotsakul, D. , Tandhavanant, S. , Wikraiphat, C. , Wongsuvan, G. , Teerawattanasook, N. , Jutrakul, Y. , Srisurat, N. , Chaimanee, P. , Eoin West, T. , Blane, B. , Parkhill, J. , Chantratita, N. , & Peacock, S. J. (2017). Evolution of the Staphylococcus argenteus ST2250 clone in Northeastern Thailand Is linked with the acquisition of livestock‐associated staphylococcal genes. Mbio, 8(4), e00802–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Mylotte, J. M. , & Tayara, A. (2000). Staphylococcus aureus bacteremia: predictors of 30‐day mortality in a large cohort. Clinical Infectious Diseases, 31(5), 1170–1174. [DOI] [PubMed] [Google Scholar]
  32. Ng, J. W. , Holt, D. C. , Lilliebridge, R. A. , Stephens, A. J. , Huygens, F. , Tong, S. Y. Currie, B. J. , & Giffard, P. M. (2009). Phylogenetically distinct Staphylococcus aureus lineage prevalent among indigenous communities in northern Australia. Journal of Clinical Microbiology, 47(7), 2295–2300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Ohnishi, T. , Shinjoh, M. , Ohara, H. , Kawai, T. , Kamimaki, I. , Mizushima, R. , Kamada, K. , Itakura, Y. , Iguchi, S. , Uzawa, Y. , Yoshida, A. , & Kikuchi, K. (2018). Purulent lymphadenitis caused by Staphylococcus argenteus, representing the first Japanese case of Staphylococcus argenteus (multilocus sequence type 2250) infection in a 12‐year‐old boy. Journal of Infection and Chemotherapy: Official Journal of the Japan Society of Chemotherapy, 24(11), 925–927. [DOI] [PubMed] [Google Scholar]
  34. Pham, T. M. , Kretzschmar, M. , Bertrand, X. , & Bootsma, M. , Consortium C‐M (2019). Tracking Pseudomonas aeruginosa transmissions due to environmental contamination after discharge in ICUs using mathematical models. PLoS Computational Biology, 15(8), e1006697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Pournajaf, A. , Ardebili, A. , Goudarzi, L. , Khodabandeh, M. , Narimani, T. , & Abbaszadeh, H. (2014). PCR‐based identification of methicillin‐resistant Staphylococcus aureus strains and their antibiotic resistance profiles. Asian Pacific Journal of Tropical Biomedicine, 4(Suppl 1), S293–S297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ruimy, R. , Armand‐Lefevre, L. , Barbier, F. , Ruppe, E. , Cocojaru, R. , Mesli, Y. , Maiga, A. , Benkalfat, M. , Benchouk, S. , Hassaine, H. , Dufourcq, J. –B. , Nareth, C. , Sarthou, J. ‐L. , Andremont, A. , & Feil, E. J. (2009). Comparisons between geographically diverse samples of carried Staphylococcus aureus . Journal of Bacteriology, 191(18), 5577–5583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Saeed Abdulrahman, I. , Al‐Mueilo, S. H. , Bokhary, H. A. , Ladipo, G. O. , & Al‐Rubaish, A. (2002). A prospective study of hemodialysis access‐related bacterial infections. Journal of Infection and Chemotherapy: Official Journal of the Japan Society of Chemotherapy, 8(3), 242–246. [DOI] [PubMed] [Google Scholar]
  38. Santoro, D. , Benedetto, F. , Mondello, P. , Pipito, N. , Barilla, D. , Spinelli, F. , Ricciardi, C. A. , Cernaro, V. , Buemi, M. , Pipito’, N., & Barilla’, D. (2014). Vascular access for hemodialysis: Current perspectives. International Journal of Nephrology and Renovascular Disease, 7, 281–294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Scheuch, M. , Freiin von Rheinbaben, S. , Kabisch, A. , Engesser, J. , Ahrendt, S. , Dabers, T. , Kohler C., Holtfreter S., Bröker B. M., & Stracke S. (2019). Staphylococcus aureus colonization in hemodialysis patients: a prospective 25 months observational study. BMC Nephrology, 20(1), 153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Schuster, D. , Rickmeyer, J. , Gajdiss, M. , Thye, T. , Lorenzen, S. , Reif, M. , Josten, M. , Szekat, C. , Melo, L. D. R. , Schmithausen, R. M. , Liégeois, F. , Sahl, H. ‐G. , Gonzalez, J. ‐P. J. , Nagel, M. , & Bierbaum, G. (2017). Differentiation of Staphylococcus argenteus (formerly: Staphylococcus aureus clonal complex 75) by mass spectrometry from S. aureus using the first strain isolated from a wild African great ape. International Journal of Medical Microbiology, 307(1), 57–63. [DOI] [PubMed] [Google Scholar]
  41. Sewell, C. M. , Clarridge, J. , Lacke, C. , Weinman, E. J. , & Young, E. J. (1982). Staphylococcal nasal carriage and subsequent infection in peritoneal dialysis patients. JAMA, 248(12), 1493–1495. [PubMed] [Google Scholar]
  42. Spilker, T. , Baldwin, A. , Bumford, A. , Dowson, C. G. , Mahenthiralingam, E. , & LiPuma, J. J. (2009). Expanded multilocus sequence typing for Burkholderia species. Journal of Clinical Microbiology, 47(8), 2607–2610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Strommenger, B. , Braulke, C. , Heuck, D. , Schmidt, C. , Pasemann, B. , Nubel, U. , & Witte, W. (2008). spa Typing of Staphylococcus aureus as a frontline tool in epidemiological typing. Journal of Clinical Microbiology, 46(2), 574–581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Taylor, G. , Gravel, D. , Johnston, L. , Embil, J. , Holton, D. , Paton, S. (2004). Incidence of bloodstream infection in multicenter inception cohorts of hemodialysis patients. American Journal of Infection Control, 32(3), 155–160. [DOI] [PubMed] [Google Scholar]
  45. Thomas, J. C. , Vargas, M. R. , Miragaia, M. , Peacock, S. J. , Archer, G. L. , & Enright, M. C. (2007). Improved multilocus sequence typing scheme for Staphylococcus epidermidis . Journal of Clinical Microbiology, 45(2), 616–619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tokars, J. I. , Miller, E. R. , & Stein, G. (2002). New national surveillance system for hemodialysis‐associated infections: initial results. American Journal of Infection Control, 30(5), 288–295. [DOI] [PubMed] [Google Scholar]
  47. Vandecasteele, S. J. , Boelaert, J. R. , & De Vriese, A. S. (2009). Staphylococcus aureus infections in hemodialysis: what a nephrologist should know. Clinical Journal of the American Society of Nephrology, 4(8), 1388–1400. [DOI] [PubMed] [Google Scholar]
  48. Wu, T. H. , Lee, C. Y. , Yang, H. J. , Fang, Y. P. , Chang, Y. F. , Tzeng, S. L. , & Lu, M. ‐C. (2019). Prevalence and molecular characteristics of methicillin‐resistant Staphylococcus aureus among nasal carriage strains isolated from emergency department patients and healthcare workers in central Taiwan. Journal of Microbiology, Immunology, and Infection, 52(2), 248–254. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this published article.

Articles from MicrobiologyOpen are provided here courtesy of Wiley

RESOURCES