Skip to main content
Cancer Science logoLink to Cancer Science
. 2012 Oct 30;103(12):2082–2091. doi: 10.1111/cas.12018

REG4 contributes to the invasiveness of pancreatic cancer by upregulating MMP‐7 and MMP‐9

Xu‐Jun He 1,, Xiao‐Ting Jiang 2,, Ying‐Yu Ma 1,, Ying‐Jie Xia 1, Hui‐Ju Wang 1, Tian‐Pei Guan 3, Qin‐Shu Shao 4, Hou‐Quan Tao 1,4,
PMCID: PMC7659226  PMID: 22957785

Abstract

Recent studies have shown that overexpression of regenerating gene family member 4 (REG4) is associated with the initiation and progression of pancreatic cancer. In our study, we explored the role of REG4 in the invasion of pancreatic cancer. Real‐time PCR and Western blot analysis were used to determine REG4 expression in pancreatic cancer cell lines. An MTT assay was carried out to test the effect of REG4 on the growth of pancreatic cancer cells. The involvement of REG4 in cancer cell invasion was examined by Transwell invasion assay. Two MMPs, MMP‐7 and MMP‐9, were identified from a pool of candidate genes as being related to REG4‐induced cell invasion by PCR and Western blotting. Immunohistochemistry was used to confirm the correlation between REG4 and the two MMPs. High expression of REG4 was found in BXPC‐3 cells and its culture media. But in PANC‐1 and ASPC‐1 cell lines, REG4 expression levels were very low, and no detectable protein was found in the culture medium. The MTT and Transwell invasion assays showed that recombinant REG4 protein and BXPC‐3 conditioned media significantly promoted the proliferation and invasiveness of pancreatic cancer cells. It was also shown that MMP‐7 and MMP‐9 are upregulated by REG4 induction using real‐time PCR and Western blotting analysis. Immunohistochemical study further verified this result. In conclusion, REG4 promotes not only growth but also in vitro invasiveness of pancreatic cancer cells by upregulating MMP‐7 and MMP‐9.


Pancreatic cancer remains one of the most difficult malignancies to diagnose and treat. It is estimated to be the fourth most common cancer in men and fifth in women worldwide. Despite the development of surgical resection, radiotherapy, and chemotherapy, the majority of patients are diagnosed when the disease has reached an advanced stage. The prognosis of pancreatic cancer remains miserable as the 5‐year survival rate is still less than 5%.1, 2 The salient features of pancreatic cancer are extensive local invasion, early systemic dissemination, and poor prognosis. These characteristics are mainly attributed to the malignant behavior of pancreatic cancer cells which have highly invasive and metastatic potential. Therefore, the study of the molecular mechanisms behind the invasion and metastasis of pancreatic cancer is urgently needed.

Regenerating gene family member 4 (REG4) was originally identified by sequencing of a cDNA library derived from patients with inflammatory bowel disease. It is located on chromosome 1, encoding 158 amino acids, including a signal peptide of 22 amino acids and a conserved calcium‐dependent carbohydrate‐recognition domain.3 Although REG4 is expressed in various normal tissues, the expression levels are much lower than in cancerous tissues. REG4 was found to be markedly upregulated in pancreatic, colorectal, gastric, gall bladder, and prostate cancer tissues compared to paired normal mucosa.4, 5, 6, 7, 8, 9 Several studies have shown that serum REG4 level can serve as a diagnostic and prognostic marker in colorectal, gastric, and pancreatic cancer.7, 10, 11 Our previous study on pancreatic cancer suggested that the serum REG4 level is higher in pancreatic cancer patients than in patients with benign pancreatic disease and healthy controls, and concurrent testing of REG4 and CA19‐9 can increase the diagnostic sensitivity to 90.5%.12 Studies on colorectal cancer reported that upregulation of REG4 is associated with tumor differentiation, stage, and lymph node metastasis and may act as a pro‐invasive factor.13, 14 Cell treatment in vitro indicated that REG4 can regulate normal intestinal and colorectal cancer cell susceptibility to radiation‐induced apoptosis by increasing the expression of anti‐apoptotic genes Bcl‐2, Bcl‐XL, and survivin.15 Hu et al.16 reported that recombinant human REG4 protein (rREG4) can protect against arginine‐induced necrosis of pancreatic acinar cells both in vivo and in vitro by upregulating Bcl‐2 and Bcl‐xL expression and activating the epidermal growth factor receptor/protein kinase B (EGFR/Akt) pathway. In hormone‐resistant prostate cancer, overexpression of REG4 is associated with cancer progression and metastasis.17 Our previous study on gastric cancer also revealed that REG4 expression correlates with Lauren classification, differentiation, lymph node metastasis, distant metastasis, and TNM stage, and patients with high REG4 expression had short survival time and poor outcome.18 Other studies showed that stable expression of REG4 significantly enhances peritoneal metastasis in gastric cancer, indicating that REG4 may serve as a novel marker for detecting peritoneal dissemination.19, 20 In summary, REG4 appears to play an important role in cancer development by enhancing proliferation, inhibiting apoptosis, and promoting metastasis and peritoneal dissemination, but the detailed mechanism remains poorly understood.

In this study, rREG4, REG4 antibody, and REG4 siRNA were used to investigate the functions of REG4 on pancreatic cancer cell proliferation, migration, and invasion with the help of MTT and Transwell assays. To complement this in vitro data, a pool of candidate genes were examined for their involvement in REG4‐induced cell invasion using real‐time RT‐PCR and Western blot analysis. Immunohistochemical staining was also used to further validate the correlation between REG4 and the expression levels of the two MMPs, MMP‐7 and MMP‐9.

Materials and Methods

Cell culture

Three pancreatic cancer cell lines with different levels of differentiation including PANC‐1 (poorly differentiated), ASPC‐1 (moderately to well differentiated), BXPC‐3 (well differentiated), and mice NIH 3T3 fibroblast cells were kindly provided by the Digestive Surgery Institution, Ruijin Hospital of Shanghai (Shanghai, China).

They were cultured in DMEM (HyClone, Logan, UT, USA) supplemented with 10% FBS and antibiotics (100 U/mL streptomycin and 100 U/mL penicillin) and maintained at 37°C in 5% CO2. Cells were passaged at 80% confluency using 1 mmol/L EDTA–0.025% trypsin for 3–5 min.

Clinical samples

This study enrolled 40 patients with pancreatic cancer who underwent pancreatectomy without preoperative radiotherapy or chemotherapy at Zhejiang Provincial Peoples' Hospital (Hangzhou, China) between 2009 to 2011. Specimens were fixed in formalin and embedded in paraffin. Before the study, written informed consent was obtained from all the patients and the project was approved by the ethics committee of Zhejiang Provincial People's Hospital.

Cell transfection

REG4 siRNA (sc‐61448; Santa Cruz Biotechnology, Santa Cruz, CA, USA) mixed with siRNA transfection reagent (sc‐29528; Santa Cruz Biotechnology) was used for transfection according to the manufacturer's instructions. In 6‐well plates, 2 × 105 BXPC‐3 cells were transfected with REG4 siRNA or control siRNA (sc‐37007, Santa Cruz Biotechnology Inc., USA). After 24 h, cells were collected for subsequent experiments.

REG4 conditioned media

BXPC‐3 cells transfected with REG4 siRNA and the controls were seeded into 75‐cm2 cell culture bottles. When the cell growth reached 80% confluence, the culture medium was replaced by serum‐free DMEM. After 24 h of incubation at 37°C with 5% CO2, the supernatants were collected and stored at 4°C. The BXPC‐3 conditioned media with REG4 siRNA was named CMsiREG4, and the conditioned media with control siRNA was named CM.

A sample of the CM was then incubated with 1 μg/mL REG4 mAb (Mab1379; R&D Systems, Minneapolis, MN, USA) for 2 h, and was named CMAb.

Cell proliferation assay

Cells were seeded in 96‐well plates at a density of 5 × 103 cells/well for PANC‐1 and 1.0 × 104 cells/well for ASPC‐1. After 24 h, cells were divided into eight groups. Group 1 was used as control, and groups 2–5 were treated with four different concentrations (0.25, 0.5, 1, 2 μg/mL) of rREG4 (1379‐RG; R&D Systems). Group 6 was treated with CM, group 7 treated with CMsiREG4, and group 8 treated with CMAb. The MTT method21 was used to detect the effect on cell proliferation at different time intervals (24, 48, and 72 h). The relative cell proliferation (%) was obtained by the following equation, where A represents absorbance:

Relative proliferation rate(%)=(A570nm)(A630nm)of study group(A570nmA630nm)of control group×100%.

Transwell assay

Five groups of BXPC‐3 cells were taken. Two groups were transfected with REG4 siRNA (3 μL and 6 μL), another was incubated with 1 μg/mL REG4 mAb, and two were used as the blank control and siRNA control. Then BXPC‐3 cells were collected and suspended in serum‐free DMEM at a density of 2.0 × 106 cells/mL. Five samples of PANC‐1 cells were taken. One was suspended in serum‐free DMEM containing 2 μg/mL rREG4, the second suspended in CM, the third suspended in CMAb, the fourth suspended in serum‐free DMEM containing 2 μg/mL rREG4 after being pre‐incubated with 1 μg/mL REG4 mAb, and the fifth was used as control. All of these PANC‐1 cells were suspended at a density of 2.0 × 106 cells/mL. The same procedure was applied for ASPC‐1 cells.

Transwell migration assays were carried out using 24‐well Millicell Hanging Cell Culture inserts with 8 μm PET (Millipore, Boston, MA, USA). The invasion assay was carried out using QCM 24‐well cell invasion assay kit (ECM554; Millipore) pre‐coated with ECMatrix, a reconstituted basement membrane matrix of proteins derived from the Engelbreth–Holm–Swarm mouse tumor. After the RT‐PCR qualification, which suggested a possible correlation between REG4 and MMP‐7, MMP‐9, a Transwell invasion assay was carried out to test the effect of MMP inhibitor on REG4‐induced enhanced invasion. After pre‐incubation with rREG4, PANC‐1 cells were treated with MMP antibody or siRNA, then collected for subsequent Transwell invasion assay.

Cells (2.0 × 105) were seeded in the upper chamber. NIH 3T3‐fibroblast conditioned medium was added to the lower chamber. After 48 h of incubation at 37°C in 5% CO2, cells on the upper surface of the inner chamber were removed. Migrating or invading cells that adhered to the lower surface of the membrane were fixed and stained with H&E. The migrating or invading cells were counted at ×400 magnification in 10 different fields for each insert.

Real‐time RT‐PCR quantification

Five samples of PANC‐1 cells were taken. One of them was treated with rREG4, another treated with REG4 antibody, the third treated with CM, the fourth treated with CMAb, and the last was used as control. The same procedure was applied to ASPC‐1 cells. Five samples of BXPC‐3 cells were taken. One of them was treated with REG4 antibody, another transfected with REG4 siRNA (3 μL), the third transfected with REG4 siRNA (6 μL), and the last two samples were used as blank control and siRNA control. Total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) and reverse‐transcribed using PrimeScript 1st Strand cDNA Synthesis kit (DRR047A; Takara, Osaka, Japan) according to the manufacturer's instructions. The RT‐PCR was carried out using the MX3000P system (Stratagene, Santa Clara, CA, USA), using gene‐specific primers with SYBR Premix ExTaq Kit (Takara). GAPDH was used as an internal control. The primers are shown in Table 1. After 5 min initial denaturation at 95°C, 40 cycles of amplification were carried out at 95°C for 10 s, annealing time (shown in Table 1) for 20 s, and 72°C for 20 s. At the end of the PCR cycles, melting curve analysis was carried out. The relative expression levels were calculated using the 2−∆Ct method.

Table 1.

Primers used for PCR analysis of candidate genes examined for their involvement in REG4‐induced cell invasion

Invasion candidate genes Sequence Fragment size Annealing time
MMP1 (NM_002421.3) F: GTCAAGTTTGTGGCTTATGGATT 220 bp 55°C
R: GAAGAGTTATCCCTTGCCTATCC
MMP9 (NM_004994.2) F: TAGGGCTCCCGTCCTGCTT 125 bp 58°C
R: CCACCTCCACTCCTCCCTTTC
MMP2 (NM_004530.4) F: TTGACGGTAAGGACGGACTC 126 bp 55°C
R: CATACTTCACACGGACCACTTG
MMP3 (NM_002422.3) F: ACAAGGAGGCAGGCAAGAC 100 bp 58°C
R: CCACGCACAGCAACAGTAG
MMP7 (NM_002423.3) F: GAAACTTCAGGCAGAACATCC 90 bp 55°C
R: GAGTGGAGGAACAGTGCTTATC
TIMP2 (NM_003255.4) F: TGTTCGCTTCCTGTATGGTGAT 200 bp 55°C
R: TTCCACTCTGGGTCAAATGC
PLAU (NM_002658.3) F: CACACACTGCTTCATTGATTACC 169 bp 55°C
R: CAAGGCAATGTCGTTGTGGT
Cyclin E1 (NM_001238.1) F: CAGGGTATCAGTGGTGCGACAT 177 bp 55°C
R: TTGCTCGGGCTTTGTCCAG
Cyclin D1 (NM_053056.2) F: TGAAGGGAGGTGGCAAGAGT 215 bp 55°C
R: ATAGCAGCAAACAATGTGAAAGA
MMP10 (NM_002425.2) F: CCCACTGGAACCCTGAACC 180 bp 55°C
R: TATGGATGCCTCTTGGATAACCT
MMP11(NM_005940.3) F: CCTAAAGGTATGGAGCGATGTG 207 bp 55°C
R:CCGATAGTCCAGGTCTCATCATAG
MMP13 (NM_002427.3) F: GTCTTTCTTCGGCTTAGAGGTG 272 bp 60°C
R: TGTCAGCAATGCCATCGTG
TIMP3 (NM_000362.4) F: CTCTGCTCTGTCCAGGGTAGG 262 bp 55°C
R: CTTAGGTAGCCAGAAGCCAAAC
TIMP4 (NM_003256.2) F: GACTATTCCCTTTCCTCCCCA 85 bp 55°C
R: TGTGTATGACATTCGCCATTTCT
GAPDH (NM_002046.3) F: TGAAGGTCGGAGTCAACGG 223 bp 56°C
R: CTGGAAGATGGTGATGGGATT

F, forward; PLAU, plasminogen activator urokinase; R, reverse; TIMP, tissue inhibitor of metalloproteinase.

Western blot verification

REG4 protein in the pancreatic cancer cells conditioned medium was concentrated using Amicon Ultra Centrifugal Filter NMWL 3000 (Millipore) according to the manufacturer's instructions. Total protein of cells was extracted using RIPA lysis buffer and fractionated by SDS‐PAGE. The proteins were electrotransferred onto PVDF membranes and incubated with primary antibodies at 4°C overnight. The primary antibodies included anti‐REG4 (1:500; R&D Systems), anti‐MMP‐7 (1:2000; Epitomics, Burlingame, CA, USA), anti‐MMP‐9 (1:2000; Epitomics), and anti‐β‐tubulin (1:10 000; Epitomics). After incubating with secondary antibody (1:5000; Huaan Biotech, Hangzhou, China) for 2 h, the membranes were treated with electrochemiluminescence reagent (Generay, Shanghai, China) and exposed to autoradiographic films.

Gelatin and casein substrate zymography

Conditioned media from PANC‐1 and ASPC‐1 cells was concentrated using an Amicon Ultra Centrifugal Filter NMWL 3000 (Millipore). All specimens (cellular protein quantity, 20 μg) were treated with sample loading buffer (1.5% SDS, 15% glycerol, and 0.005% bromphenol blue) and loaded onto the gels. Gelatin and casein zymography were carried out to detect MMP‐9 and MMP‐7, respectively, using an MMP Gelatin Zymography assay kit (GMS30071.1; GenMed, Shanghai, China) and an MMP Casein Zymography assay kit (GMS30071.2; GenMed).

Immunohistochemical staining

The sections were deparaffinized and rehydrated using graded ethanol. Antigen retrieval was carried out by autoclaving for 3 min in 0.01 M citrate buffer (pH 6.0). The sections was blocked with 3% (v/v) H2O2 for 10 min followed by 10% (v/v) normal goat serum for 15 min at room temperature. Then the sections were incubated at 4°C overnight with primary antibody including anti‐REG4 (1:100; R&D Systems), anti‐MMP‐7 (1:250; Epitomics), and anti‐MMP‐9 (1:200; Epitomics). The sections were then incubated with HRP‐conjugated secondary antibody (Zhongshan Biotech, Beijing, China) for 30 min at room temperature. We used DABto visualize the signal development. Finally, the sections were counterstained with hematoxylin.

Immunohistochemical evaluation

The immunohistochemical (IHC) evaluation was independently done by two pathologists without knowledge of the clinical data. The immunoreactivity levels of each case were estimated under light microscope by assessing the average signal intensity (on a scale of 0 to 3) and the proportion of cells showing a positive cytoplasm stain (0, <5%; 1, 5–25%; 2, 26–50%; 1, 51–75%; 4, 76–100%). The intensity and proportion scores were then multiplied to obtain a composite score. A score of 0–3 was defined as negative and a score of 4–12 was categorized as positive.

Statistical analysis

Statistical analyses of the data were carried out using spss version 13.0 software. Normally distributed continuous variables were expressed as the mean ± SD; means were compared by either a paired sample t‐test or one‐way anova, as appropriate. Categorical variables were presented as percentages and were analyzed by Fisher's exact test. The relationship between REG4 expression and MMP‐7 and MMP‐9 was assessed by Spearman's correlation coefficients. All P‐values were obtained from two‐tailed statistical tests. Differences were considered significant when < 0.05.

Results

REG4 expression in pancreatic cancer cell lines

The REG4 mRNA expression levels in three pancreatic cancer cell lines are shown in Figure 1(A). To confirm these results, cell lysates and cell culture medium were analyzed by Western blotting with anti‐REG4 antibody (Fig. 1B). Consistent with the RT‐PCR results, high levels of REG4 expression were found in BXPC‐3 cells and its culture media. In contrast, PANC‐1 and ASPC‐1 cells had very low level of REG4 expression, and no protein signals were detected in the culture medium.

Figure 1.

Figure 1

REG4 expression in three pancreatic cancer cell lines was analyzed and compared by real‐time PCR and Western blotting. (A) Real‐time PCR: BXPC‐3 cells showed a high REG4 expression level but ASPC‐1 and PANC‐1 cells showed a low level of REG4 expression. (B) Western blotting: BXPC‐3 cells and its culture medium showed high levels of REG4 expression; PANC‐1 and ASPC‐1 cells had a very low level of REG4 expression, and no detectable proteins were found in the culture media. β‐tubulin was used as an internal control.

Effect of REG4 on cell proliferation

The overall results suggest that REG4 can act as a cell proliferation promoter in pancreatic cancer. After 24 h of treatment, rREG4 and CM were found to significantly promote the proliferation of both PANC‐1 and ASPC‐1 cells (Fig. 2). After 48 and 72 h of treatment, no further increase in cell number was observed across all groups (Fig. 2, 48 h vs 24 h, 72 h vs 48 h). Therefore, we propose that the effect of REG4 on cell proliferation is limited to 72 h or even less. Furthermore, no significant dose‐dependent effect of rREG4 on cell growth was observed. The effect of REG4 on cell proliferation was significantly lower in CMsiREG4 and CMAb treated groups compared with CM treated groups, but was significantly higher compared with the control groups. This result shows that the proliferation effect induced by REG4 can be reduced by suppressing the expression of REG4 with REG4 antibody or REG4 siRNA, but cannot be blocked completely, and the detailed mechanism should be further investigated.

Figure 2.

Figure 2

Effect of REG4 on cell growth was tested by MTT proliferation assay. *Proliferation rates of (A) ASPC‐1 and (B) PANC‐1 pancreatic cancer cells treated with conditioned media (CM) and various concentrations of recombinant human REG4 protein were significantly increased compared with the negative control (< 0.05). #Proliferation rates of ASPC‐1 and PANC‐1 cells treated with CM incubated with REG4 mAb (CMAb) and CM with REG4 siRNA (CMsiREG4) were significantly decreased compared with the CM treated group (< 0.05).

Involvement of REG4 in pancreatic cancer cell invasion and migration

We further examined the effect of REG4 on invasion of pancreatic cancer cells using a Transwell invasion assay model. We found that rREG4 and CM significantly promoted the invasion of PANC‐1 and ASPC‐1 cell lines, but REG4 antibody and CMAb significantly reduced this potential (Fig. 3). In contrast, the invasive potential of BXPC‐3 cells was significantly reduced by REG4 antibody and REG4 siRNA compared with negative control (Fig. 4). The above evidence illustrates that REG4 may enhance the invasion ability of pancreatic cancer cells; meanwhile, this invasion potential can be inhibited using REG4 siRNA or REG4 antibody to downregulate or block REG4 expressions. A similar effect of REG4 on cancer cell migration was also observed (Fig. 5).

Figure 3.

Figure 3

Invasion ability of ASPC‐1 and PANC‐1 pancreatic cancer cells was analyzed in a Transwell invasion assay. *Cells treated with recombinant human REG4 protein (rREG4) and conditioned media (CM) showed significantly higher invasive properties compared with control cells (< 0.05). #Cells treated with rREG4 followed by REG4 antibody (REG4Ab) compared with the rREG4 treated group (< 0.05). ##Cells treated with CM incubated with REG4 mAb (CMAb) compared with the CM treated group (< 0.05).

Figure 4.

Figure 4

Transwell invasion assay of BXPC‐3 pancreatic cancer cells. REG4 antibody (REG4Ab) and REG4 siRNA (siREG4) treated cells showed lower invasive properties compared with control cells (*P < 0.05). (A) Data are expressed as the mean number of invading cells per field (average of 10 fields per filter). (B) Micrographs showing cells invading through 8‐μm pores on the lower side of the filters.

Figure 5.

Figure 5

Transwell migration assay of ASPC‐1 and PANC‐1 pancreatic cancer cells. Cells treated with recombinant human REG4 protein (rREG4) and conditioned media (CM) showed significantly higher migration properties compared with control cells. Cells treated with rREG4 followed by REG4 antibody (REG4Ab) showed reduced mobility compared with the rREG4 treated group. Cells treated with CM incubated with REG4 mAb (CMAb) showed reduced mobility compared with the CM treated group. Cells treated with REG4Ab and REG4 siRNA (siREG4) showed lower migration properties compared with control cells in BXPC‐3 cells.

Examination of candidate genes related to REG4‐induced cell invasion

In order to identify genes related to REG4‐induced cell invasion in pancreatic cancer, RT‐PCR analysis was carried out. Among the candidate genes, expression levels of MMP‐7 and MMP‐9 were remarkably elevated in ASPC‐1 and PANC‐1 cells treated with rREG4 and CM (Fig. 6). To further verify the relationship between REG4 expression and invasion‐related candidate genes, samples from BXPC‐3, a cell line with elevated REG4 expression, were selected. Some of the samples were incubated with REG4 antibody while the rest were transfected with REG4 siRNA. The mRNA and protein levels of MMP‐7 and MMP‐9 were found to be significantly reduced compared with those of the control cells (Fig. 7). However, there were no differences in the expression of MMP‐1, MMP‐2, MMP‐3, MMP‐10, MMP‐11, MMP‐13, TIMP‐2, TIMP‐3, TIMP‐4 or PLAU (data not shown). We further tested the involvement of MMP‐7 and MMP‐9 in REG4‐induced enhanced invasion of human pancreatic cancer cells using MMP antibody or siRNA, and we found that ASPC‐1 and PANC‐1 cells treated with MMP‐7 or MMP‐9 antobody or siRNA after pre‐incubateion with rREG4 significantly reduced the invasive potential of cancer cells (Fig. 8). Taken together, these results suggest that the promotional effect of REG4 on pancreatic cancer cell invasion may be associated with the expression level of MMP‐7 and MMP‐9.

Figure 6.

Figure 6

Expression levels of MMP‐7 and MMP‐9 induced by REG4 were analyzed in ASPC‐1 and PANC‐1 pancreatic cancer cells. *MMP‐7 and MMP‐9 expression was upregulated when treated with recombinant human REG4 protein (rREG4) and conditioned media (CM) (< 0.05). #REG4 antibody (REG4Ab) treated cells compared with rREG4 treated groups (< 0.05). ##Cells treated with CM incubated with REG4 mAb (CMAb) compared with CM treated groups (< 0.05). (A) ASPC‐1 cells; (B) PANC‐1 cells.

Figure 7.

Figure 7

REG4 induced MMP‐7 and MMP‐9 expression in BXPC‐3 pancreatic cancer cells. MMP‐7 and MMP‐9 were found to be significantly reduced at both the mRNA and protein level when incubated with REG4 antibody (REG4Ab) or transfected with REG4 siRNA (siRGE4) in BXPC‐3 cells. (A) Real‐time PCR; (B) Western blotting.

Figure 8.

Figure 8

Effect of MMP‐7 and MMP‐9 inhibitor or siRNA on REG4‐induced enhanced invasion. The MMP‐7 or MMP‐9 inhibitor or siRNA significantly reduced REG4‐induced invasive potential. (A) ASPC‐1; (B) PANC‐1.

Detection of metalloproteinase activity

Using gelatin zymography, PANC‐1 and ASPC‐1 cells treated with rREG4 showed far higher levels of the active form of MMP‐9 compared to the control groups. Similarly, casein zymography revealed a far higher level of the active form of MMP‐7 in PANC‐1 and ASPC‐1 cells treated with rREG4, compared to the control groups (Fig. 9).

Figure 9.

Figure 9

Zymography analysis of MMP activity. The group treated with recombinant human REG4 protein (rREG4) showed higher levels of active MMP‐7 and MMP‐9 compared to the control groups.

Correlation between REG4 and MMP‐7 and MMP‐9 expression in pancreatic cancer

To confirm the correlation between REG4 and MMP‐7 and MMP‐9 expression, IHC was used in 40 pancreatic cancer tissues. Immunohistochemical staining showed the brown signal of REG4 expression in the tumor cells. Clinicopathological analyses also showed that REG4 expression is associated with lymph node metastasis and vascular invasion (Table 2).

Table 2.

REG4 expression in 40 pancreatic cancers and its clinicopathological significance

Parameters Total REG4 expression P‐value
Negative Positive Expression ratio (%)
Gender
Female 18 4 14 77.78 1.0000
Male 22 6 16 72.73
Differentiation
Well 24 6 18 75.00 1.0000
Poorly 16 4 12 75.00
Lymph node metastasis
Yes 18 0 18 100.00 0.0010
No 22 10 12 54.55
T factor
T1 8 3 5 62.50 0.7000
T2 22 5 17 77.30
T3 10 2 8 80.00
TNM stage
I + II 23 7 16 69.60 0.4710
III + IV 17 3 14 82.40
Distant metastasis
Yes 16 1 15 93.80 0.0320
No 24 9 15 62.50
Vascular invasion
Yes 20 0 20 100.00 0.0004
No 20 10 10 50.00

We also tested MMP‐7 and MMP‐9 expression in the 40 pancreatic cancer tissues. There was a positive correlation between the levels of REG4 and MMP‐7 (R = 0.545, P = 0.001, Spearman's ρ‐test). Similarly, a positive correlation was found between the levels of REG4 and MMP‐9 (R = 0.471, P = 0.007, Spearman's ρ‐test) (Table 3, Fig. 10). In order to further clarify the role of REG4 in pancreatic cancer, we also examined REG4 levels in the peritumoral pancreatic tissues and found that REG4 showed very weak expression (Fig. 11A). Hematoxylin–eosin staining was used for pathological diagnosis of tumor (Fig. 11B); negative control was also used to test for the specificity of the antibody involved (Fig. 11C). The production of REG4, MMP‐9, and MMP‐7 were also detected in the liver metastatic foci of pancreatic cancer, where they showed strong positive expression (Fig. 11D–F).

Table 3.

Correlation between REG4 and MMP‐7 and MMP‐9 in pancreatic cancer

REG4 R P‐value
Positive Negative
MMP‐7
Positive 24 2 0.545 0.001
Negative 6 8
MMP‐9
Positive 16 0 0.471 0.007
Negative 14 10

Figure 10.

Figure 10

Immunohistochemical analysis of REG4, MMP‐7, and MMP‐9 in pancreatic cancer. Positive immunohistochemical staining of REG4, MMP‐7, and MMP‐9 was mainly in the cytoplasm. (A) Original magnification, ×100. (B) Original magnification, ×400.

Figure 11.

Figure 11

Immunohistochemical analysis of REG4 in peritumoral pancreatic tissues. The insert panes show the section indicated by the arrows at a magnification of × 400. (A) REG4 showed weak expression (↑) in the peritumoral pancreatic tissues; original magnification, ×200. (B) H&E staining of liver metastatic foci of pancreatic cancer; original magnification, ×100. (C) Negative control of immunohistochemistry of liver metastatic foci of pancreatic cancer; original magnification, ×100. (D) REG4 showed strong positive expression (↑) in liver metastatic foci of pancreatic cancer. (E) MMP‐7 showed strong positive expression (↑) in liver metastatic foci of pancreatic cancer. (F) MMP‐9 showed strong positive expression (↑) in liver metastatic foci of pancreatic cancer.

Discussion

Recent studies have shown that REG4 is involved in digestive tract malignancies including gastric,5 colorectal,9, 14 and pancreatic cancer,7, 22 and its overexpression is associated with the initiation and progression of pancreatic cancer.7, 23 Our previous research on pancreatic cancer also suggested that the serum level of REG4 is higher in pancreatic cancer patients than in patients with benign pancreatic disease and healthy controls, and concurrent testing of REG4 and CA199 can increase the diagnostic sensitivity to 90.5%.12 In this study, we confirmed that both pancreatic cancer cell BXPC‐3 and its culture media had high levels of REG4 expression, indicating that pancreatic cancer cell may produce and secrete REG4 to influence tumor initiation and development. We also examined REG4 protein levels in the peritumoral pancreatic tissues and found that the tissues showed very weak expression of REG4. So we proposed that REG4 might act in a paracrine manner to influence inflammation and tumor initiation. Our results support the opinion that REG4 can be used as a tumor‐specific serum marker. Takayama et al.7 also revealed that serum REG4 has potential as a screening serum marker for pancreatic cancer diagnosis, including early stage disease. However, in pancreatic cancer cell lines PANC‐1 and ASPC‐1, REG4 expression was very low, and no detectable protein was found in the culture medium. Hence, we propose that REG4 expression may be related to cell properties. Tamura et al.8 also found that REG4 expression is more frequently observed in well to moderately differentiated gall bladder carcinomas than in poorly differentiated ones.

In order to clarify the role of REG4 on the growth of pancreatic cancer cells, we chose PANC‐1 and ASPC‐1 cells, which had very low REG4 expression levels, to test the effect of REG4 on cell proliferation. We found that rREG4 and BXPC‐3 CM significantly stimulated the proliferation of both PANC‐1 and ASPC‐1 cells. Compared with the CM treatment group, the proliferation effect was significantly lower in CMsiREG4 and CMAb treatment groups. These results suggest that REG4 may promote cell proliferation in pancreatic cancer. A study on adenoid cystic carcinoma also suggested that REG4 might accelerate cell growth.24 In our present study, no significant dose‐dependent effect of REG4 on pancreatic cancer cell growth was observed. Rafa et al.13 also found that REG4 had a similar effect on colon cancer cells. As REG4 might act in an autocrine or paracrine manner to stimulate the growth of cells, depending on the target cell, we propose that the regulatory mechanisms that interact with REG4 intracellularly or extracellularly might restrict the stimulation of growth induced by REG4.

Cell migration and invasion abilities are important indicators for malignancy and metastasis of tumor cells. REG4, an oncogene, may be potentially involved in invasion, metastasis, and carcinogenesis.5 In this study, we examined the effect of REG4 on the invasion and migration of pancreatic cancer cells using a Transwell assay. We found that rREG4 and BXPC‐3 CM significantly promoted migration and invasion of pancreatic cancer cells, whereas CMsiREG4 and CMAb significantly reduced this potential. The result indicates that REG4 may promote migration and invasion of pancreatic cancer cells.

The MMP family, which causes tumor invasion and formation of distant metastases, is known to play a key role in various human cancers including pancreatic cancer.25 Crawford et al.26 have shown that MMP‐7 is expressed in the majority of human pancreatic adenocarcinomas, but is never detected in the normal pancreas. Other studies have indicated that expression of MMP‐7 correlates significantly with infiltra;?>tive growth pattern, and lymph node and liver metastasis of pancreatic carcinoma,27, 28 and also markedly increases invasion of pancreatic cancer cells in vitro.29 Matsuyama et al.30 reported that pancreatic ductal carcinomas with metastases show much higher MMP‐9 expression than metastasis‐free carcinomas. Similarly, Nagakawa et al.31 found a major role of MMP‐9 in cancer cell infiltration of blood vessels. In the present study, we have attempted to identify genes that are induced by the expression of REG4 and are thus related to invasion. Real‐time RT‐PCR and Western blot analysis of several candidate genes was carried out using rREG4, as well as CM‐treated ASPC‐1 and PANC‐1 cells. In candidate genes related to cancer invasion, we found that the invasion‐related candidate genes MMP‐7 and MMP‐9 were remarkably elevated in ASPC‐1 and PANC‐1 cells treated with rREG4 and BXPC‐3 CM, respectively; in contrast, MMP‐7 and MMP‐9 were significantly reduced at both the mRNA and protein level when treated with REG4 antibody or transfected with REG4 siRNA. Furthermore, MMP‐7 and MMP‐9 antibody and siRNA reduced REG4‐induced enhanced invasive potential. Analysis using IHC in pancreatic cancer tissues further confirmed that REG4 expression correlates with MMP‐7 and MMP‐9. Strong positive expression of REG4, MMP‐9, and MMP‐7 in liver metastatic foci of pancreatic cancer also confirmed the above results.

These results suggest that REG4 may promote pancreatic cancer cell invasion through MMP‐7 and MMP‐9. REG4 overexpression in tumor cells has been associated with cell growth and adhesion.4, 19, 24 Bishnupuri et al. also found that the expression of REG4 may be a potent activator of the EGFR/Akt/AP‐1 signaling pathway in colon cancer cells.32 Based on the above results, we propose that MMP‐7 and MMP‐9 upregulation may be induced by REG4 through a growth factor such as vascular endothelial growth factor and cell adhesion molecules, and additional studies are required to determine the molecular mechanisms underlying REG4‐induced MMP‐7 and MMP‐9 upregulation.

In conclusion, our results show that overexpression of REG4 not only stimulates cell growth, but also promotes in vitro invasiveness of pancreatic cancer cells. Both MMP‐7 and MMP‐9 are closely involved in the invasion induced by REG4 in pancreatic cancer. Our results also support the opinion that REG4 can be used as a tumor‐specific serum marker for invasion and metastasis. Identification of these signaling pathways will further improve our understanding of the molecular mechanism of REG4‐induced invasion in pancreatic cancer, and help devise novel techniques to diagnose and treat pancreatic cancer.

Disclosure Statement

The authors have no conflict of interest.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Grant No. 81071991), the Zhejiang Provincial Program for the Cultivation of High‐level Innovative Health Talents (Grant No. 2007A011), and the Medicine and Health Research Foundation of Zhejiang Province (Grant No. 2009B019).

(Cancer Sci 2012; 103: 2082–2091)

References

  • 1. Hidalgo M. Pancreatic cancer. N Engl J Med 2010; 362: 1605–17. [DOI] [PubMed] [Google Scholar]
  • 2. Jemal A, Siegel R, Xu J, Ward E. Cancer statistics, 2010. CA Cancer J Clin 2010; 60: 277–300. [DOI] [PubMed] [Google Scholar]
  • 3. Hartupee JC, Zhang H, Bonaldo MF, Soares MB, Dieckgraefe BK. Isolation and characterization of a cDNA encoding a novel member of the human regenerating protein family: Reg IV. Biochim Biophys Acta 2001; 1518: 287–93. [DOI] [PubMed] [Google Scholar]
  • 4. Hayashi T, Matsubara A, Ohara S et al Immunohistochemical analysis of Reg IV in urogenital organs: Frequent expression of Reg IV in prostate cancer and potential utility as serum tumor marker. Oncol Rep 2009; 21: 95–100. [PubMed] [Google Scholar]
  • 5. Oue N, Hamai Y, Mitani Y et al Gene expression profile of gastric carcinoma: identification of genes and tags potentially involved in invasion, metastasis, and carcinogenesis by serial analysis of gene expression. Cancer Res 2004; 64: 2397–405. [DOI] [PubMed] [Google Scholar]
  • 6. Oue N, Mitani Y, Aung PP et al Expression and localization of Reg IV in human neoplastic and non‐neoplastic tissues: Reg IV expression is associated with intestinal and neuroendocrine differentiation in gastric adenocarcinoma. J Pathol 2005; 207: 185–98. [DOI] [PubMed] [Google Scholar]
  • 7. Takayama R, Nakagawa H, Sawaki A et al Serum tumor antigen REG4 as a diagnostic biomarker in pancreatic ductal adenocarcinoma. J Gastroenterol 45:52–9. [DOI] [PubMed] [Google Scholar]
  • 8. Tamura H, Ohtsuka M, Washiro M et al Reg IV expression and clinicopathologic features of gallbladder carcinoma. Hum Pathol 2009; 40: 1686–92. [DOI] [PubMed] [Google Scholar]
  • 9. Violette S, Festor E, Pandrea‐Vasile I et al Reg IV, a new member of the regenerating gene family, is overexpressed in colorectal carcinomas. Int J Cancer 2003; 103: 185–93. [DOI] [PubMed] [Google Scholar]
  • 10. Oue N, Kuniyasu H, Noguchi T et al Serum concentration of Reg IV in patients with colorectal cancer: overexpression and high serum levels of Reg IV are associated with liver metastasis. Oncology 2007; 72: 371–80. [DOI] [PubMed] [Google Scholar]
  • 11. Oue N, Sentani K, Noguchi T et al Serum olfactomedin 4 (GW112, hGC‐1) in combination with Reg IV is a highly sensitive biomarker for gastric cancer patients. Int J Cancer 2009; 125: 2383–92. [DOI] [PubMed] [Google Scholar]
  • 12. Tao HQ, He XJ, Jiang XT, Ma YY, Wang HJ, Xia YJ. Significance of serum REG4 upregulation in the diagnosis and treatment of pancreatic adenocarinoma. J Surg Concepts Pract 2010;15: 522–5. [Google Scholar]
  • 13. Rafa L, Dessein AF, Devisme L et al REG4 acts as a mitogenic, motility and pro‐invasive factor for colon cancer cells. Int J Oncol 2010; 36: 689–98. [DOI] [PubMed] [Google Scholar]
  • 14. Zhang Y, Lai M, Lv B et al Overexpression of Reg IV in colorectal adenoma. Cancer Lett 2003; 200: 69–76. [DOI] [PubMed] [Google Scholar]
  • 15. Bishnupuri KS, Luo Q, Sainathan SK et al Reg IV regulates normal intestinal and colorectal cancer cell susceptibility to radiation‐induced apoptosis. Gastroenterology 2010; 138: 616–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Hu G, Shen J, Cheng L et al Reg4 protects against acinar cell necrosis in experimental pancreatitis. Gut 2011; 60: 820–8. [DOI] [PubMed] [Google Scholar]
  • 17. Gu Z, Rubin MA, Yang Y et al Reg IV: a promising marker of hormone refractory metastatic prostate cancer. Clin Cancer Res 2005; 11: 2237–43. [DOI] [PubMed] [Google Scholar]
  • 18. Tao HQ, He XJ, Ma YY et al Evaluation of REG4 for early diagnosis and prognosis of gastric cancer. Hum Pathol 2011; 42: 1401–9. [DOI] [PubMed] [Google Scholar]
  • 19. Kuniyasu H, Oue N, Sasahira T et al Reg IV enhances peritoneal metastasis in gastric carcinomas. Cell Prolif 2009; 42: 110–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Miyagawa K, Sakakura C, Nakashima S et al Overexpression of RegIV in peritoneal dissemination of gastric cancer and its potential as A novel marker for the detection of peritoneal micrometastasis. Anticancer Res 2008; 28: 1169–79. [PubMed] [Google Scholar]
  • 21. Wang HJ, Ruan HJ, He XJ et al MicroRNA‐101 is down‐regulated in gastric cancer and involved in cell migration and invasion. Eur J Cancer 2010; 46: 2295–303. [DOI] [PubMed] [Google Scholar]
  • 22. Takehara A, Eguchi H, Ohigashi H et al Novel tumor marker REG4 detected in serum of patients with resectable pancreatic cancer and feasibility for antibody therapy targeting REG4. Cancer Sci 2006; 97: 1191–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Legoffic A, Calvo E, Cano C et al The reg4 gene, amplified in the early stages of pancreatic cancer development, is a promising therapeutic target. PLoS ONE 2009; 4: e7495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Sasahira T, Oue N, Kirita T et al Reg IV expression is associated with cell growth and prognosis of adenoid cystic carcinoma in the salivary gland. Histopathology 2008; 53: 667–75. [DOI] [PubMed] [Google Scholar]
  • 25. Pryczynicz A, Guzinska‐Ustymowicz K, Dymicka‐Piekarska V, Czyzewska J, Kemona A. Expression of matrix metalloproteinase 9 in pancreatic ductal carcinoma is associated with tumor metastasis formation. Folia Histochem Cytobiol 2007; 45: 37–40. [PubMed] [Google Scholar]
  • 26. Crawford HC, Scoggins CR, Washington MK, Matrisian LM, Leach SD. Matrix metalloproteinase‐7 is expressed by pancreatic cancer precursors and regulates acinar‐to‐ductal metaplasia in exocrine pancreas. J Clin Invest 2002; 109: 1437–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Nakamura H, Horita S, Senmaru N et al Association of matrilysin expression with progression and poor prognosis in human pancreatic adenocarcinoma. Oncol Rep 2002; 9: 751–5. [PubMed] [Google Scholar]
  • 28. Yamamoto H, Itoh F, Iku S et al Expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in human pancreatic adenocarcinomas: clinicopathologic and prognostic significance of matrilysin expression. J Clin Oncol 2001; 19: 1118–27. [DOI] [PubMed] [Google Scholar]
  • 29. Tan X, Egami H, Ishikawa S et al Involvement of matrix metalloproteinase‐7 in invasion‐metastasis through induction of cell dissociation in pancreatic cancer. Int J Oncol 2005; 26: 1283–9. [PubMed] [Google Scholar]
  • 30. Matsuyama Y, Takao S, Aikou T. Comparison of matrix metalloproteinase expression between primary tumors with or without liver metastasis in pancreatic and colorectal carcinomas. J Surg Oncol 2002; 80: 105–10. [DOI] [PubMed] [Google Scholar]
  • 31. Nagakawa Y, Aoki T, Kasuya K, Tsuchida A, Koyanagi Y. Histologic features of venous invasion, expression of vascular endothelial growth factor and matrix metalloproteinase‐2 and matrix metalloproteinase‐9, and the relation with liver metastasis in pancreatic cancer. Pancreas 2002; 24: 169–78. [DOI] [PubMed] [Google Scholar]
  • 32. Bishnupuri KS, Luo Q, Murmu N, Houchen CW, Anant S, Dieckgraefe BK. Reg IV activates the epidermal growth factor receptor/Akt/AP‐1 signaling pathway in colon adenocarcinomas. Gastroenterology 2006; 130: 137–49. [DOI] [PubMed] [Google Scholar]

Articles from Cancer Science are provided here courtesy of Wiley

RESOURCES