Abstract
Tumor recurrence is the most common cause of disease failure after surgical resection in early‐stage lung adenocarcinoma. Identification of clinically relevant prognostic markers could help to predict patients with high risk of disease recurrence. A meta‐analysis of available lung adenocarcinoma microarray datasets revealed that T‐LAK cell‐originated protein kinase (TOPK), a serine/threonine protein kinase, is overexpressed in lung cancer. Using stable cell lines with overexpression or knockdown of TOPK, we have shown that TOPK can promote cell migration, invasion, and clonogenic activity in lung cancer cells, suggesting its crucial role in lung tumorigenesis. To evaluate the prognostic value of TOPK expression in resected stage I lung adenocarcinoma, a retrospective analysis of 203 patients diagnosed with pathological stage I lung adenocarcinoma was carried out to examine the expression of TOPK by immunohistochemistry (IHC). The prognostic significance of TOPK overexpression was examined. Overexpression of TOPK (IHC score >3) was detected in 67.0% of patients, and these patients were more frequently characterized with disease recurrence and angiolymphatic invasion. Using multivariate analysis, patient age (>65 years old; P = 0.002) and TOPK overexpression (IHC score >3; P < 0.001) significantly predicted a shortened overall survival. Moreover, TOPK overexpression (IHC score >3; P = 0.005) also significantly predicted a reduced time to recurrence in the patients. Our results indicate that overexpression of TOPK could predetermine the metastatic capability of tumors and could serve as a significant prognostic predictor of shortened overall survival and time to recurrence. (Cancer Sci 2012; 103: 731–738)
Lung cancer is the leading cause of cancer‐related death worldwide. The incidence of adenocarcinoma, the most common histological subtype of non‐small‐cell lung carcinoma (NSCLC) in most countries, has increased in both sexes during the past several decades, whereas squamous cell carcinoma has decreased.1, 2 Surgical resection is the main treatment of choice for early‐stage NSCLC.3 Although patient survival after stage I NSCLC resection is good, postoperative recurrence has been reported to occur in 22–38% of patients.4, 5, 6, 7 The survival rate is poor in patients with recurrence following resection of stage I NSCLC.6, 8 Many randomized clinical trials have evaluated the role of adjuvant chemotherapy in patients with resected stage I NSCLC and have tried to identify patients with a higher risk of recurrence or poor prognosis after surgical resection.9, 10, 11 Investigation of biomarkers of early‐stage NSCLC may be helpful in designing clinical trials for adjuvant chemotherapy in the future.
T‐LAK cell‐originated protein kinase (TOPK), also known as PDZ‐binding kinase (PBK), is a MAPKK‐like serine/threonine protein kinase that was identified as an interleukin‐2‐induced gene in T‐LAK cells and as an interaction partner with the human tumor suppressor hDlg, identified by yeast two‐hybrid screening.12, 13 TOPK is barely detected in normal tissue, with the exception of germ cells in the testis and several fetal tissues. TOPK has been shown to be upregulated in various types of cancer.14, 15, 16, 17 The oncogenic role of TOPK has been reported in a panel of cancers. For example, the knockdown of TOPK expression by siRNA inhibits the growth and clonogenicity of breast cancer cells. TOPK has been shown to mediate UVB‐induced JNK activation and enhance H‐Ras‐induced cell transformation.18 In addition, TOPK serves as an oncogenic MEK that exerts positive feedback on ERK2 to promote colorectal cancer formation in vitro and in vivo.19 TOPK has also been identified as a downstream target of the EWS‐FLI chimeric fusion protein, which plays a significant role in Ewing sarcoma tumorigenesis.20 Furthermore, TOPK physically interacts with the DBD domain of p53, which might contribute to tumorigenesis by affecting the tumor suppressor function of p53.21 We have also recently shown that TOPK can stimulate AKT‐dependent cell migration/invasion by relieving the PTEN‐dependent suppressive effect, indicating its crucial role in facilitating cancer metastasis.22
Although accumulating reports have indicated the crucial roles of TOPK in tumorigenesis, its role in lung tumorigenesis and its prognostic value in lung cancer, especially stage I lung adenocarcinoma, have not been investigated. In this report, we analyzed publicly available microarray datasets and found that TOPK was overexpressed in lung adenocarcinoma. By establishing stable cell lines with overexpression or knockdown of TOPK, we have determined the crucial role of TOPK in cell migration, invasion, and clonogenic activity in lung cancer cells. Increased TOPK expression was observed in a significant percentage of patients with stage I lung adenocarcinoma by immunohistochemistry (IHC). Ultimately, overexpression of TOPK was a significant prognostic factor of shortened overall survival and time to recurrence.
Materials and Methods
Microarray data source and analysis
In this study, we used a total of 196 samples from three cohorts of patients with lung adenocarcinoma for microarray and box plot analyses. Microarray dataset 1 (GSE7670) was obtained online from NCBI Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) and originated from Su et al.23 This dataset included 16 stage IA/IB (eight patients) and 22 stage III/IV (11 patients) lung adenocarcinoma pairwise samples and was subjected to microarray analysis on the Affymetrix HG‐U133A chip (Affymetrix, Santa Clara, CA, USA).23 Microarray dataset 2 (GSE10072) was obtained online from GEO and originated from Landi et al.24 This dataset included 30 stage IA/IB (15 patients) and 18 stage III/IV (nine patients) lung adenocarcinoma pairwise samples and was obtained using the Affymetrix HG‐U133A chip. Microarray dataset 3 (GSE19804) was published by Lu et al.25 and included 62 stage IA/IB (31 patients), 24 stage IIA/IIB (12 patients), and 24 stage III/IV (12 patients) lung adenocarcinoma pairwise samples and was obtained using the Affymetrix HG‐U133 plus 2.0 chip. The lung cancer microarray data were analyzed by preprocessing the raw fluorescence intensity data within CEL files. The data were normalized using the Bioconductor Affy package (Bioconductor), which is based on the Robust Multichip Average (RMA) algorithm with R language (http://www.bioconductor.org).
Clinicopathological data and tissue microarray construction
From 1995 to 2007, 203 patients with stage I lung adenocarcinoma were enrolled in the study. Samples were collected and deposited into the surgical pathology archives at the Taipei Veterans General Hospital (Taipei, Taiwan). All patients underwent curative surgical resection, accompanied by complete hilar and mediastinal lymph nodes dissection. No patient received adjuvant chemotherapy or radiotherapy after surgical resection. Determination of disease stage was based on the seventh edition of the TNM classification of the American Joint Committee on Cancer.26 The pathological slides were reviewed by two pathologists (T.‐Y.C. and Y.‐C.Y.). Representative parts of the tumor tissue were selected for tissue microarray construction. The protocol regarding tissue microarray was approved by the hospital's institutional review board. The tissue samples and data were anonymized and unlinked to an identifiable person. Waiver of informed consent was also approved by the institutional review board. The tumor tissue retrieved from the paraffin blocks contained at least two 3‐mm cores. The patient overall survival rate was calculated from the date of operation to the date of death and was considered censored for patients who were alive at last follow‐up. Time to recurrence was measured from the date of the operation to the date of recurrence and was considered censored for patients who were disease‐free at the last follow‐up or were deceased without evidence of disease recurrence. Relapse‐free survival was measured from the date of the operation to the date of recurrence or death from any cause.27
Immunohistochemistry staining and scoring
The specimen processing and IHC procedures were carried out as previously described.28 For TOPK staining, a mAb to TOPK (Cell Signaling Technology, Danvers, MA, USA) was used at the dilution of 1:100 and incubated at 4°C overnight. The sections were then incubated with a biotinylated secondary antibody for 10 min. Streptavidin–HRP conjugate with 3‐amino‐9‐ethylcarbazole (Dako, Carpinteria, CA, USA) was used as the chromogen. All slides were counterstained with hematoxylin.
The intensity of immunoreactivity was graded according to the following scale: 0, negative; 1, weakly positive; 2, moderately positive; and 3, strongly positive. The percentage score was semiquantitatively assessed by the percentage of positive‐stained cells: 0, 0%; 1, ≤10%; 2, 11–50%; and 3, 51–100%. The IHC score of each specimen was represented by the value of the intensity score multiplied by the percentage score, which ranged from 0 to 9, according to the method described in a previous report.29
Statistical analysis
Three microarray datasets were analyzed by two‐tailed t‐test and TOPK/PBK was selected to compare the expression in stage I versus stage III/IV, and stage II versus stage III/IV lung adenocarcinoma. The chi‐squared‐test was used to assess the association between clinicopathological parameters and the TOPK IHC score. Survival curves were plotted using the Kaplan–Meier method and were compared using the log–rank test. Multivariate analyses were carried out by means of the Cox proportional hazards model using spss software (version 18.0; SPSS, Chicago, IL, USA). P‐values <0.05 were considered to be significant.
Transfection
For transfection, 50% confluent cells were incubated with 1 μg DNA and lipofetamine reagent (1:6) and mixed according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). Twenty‐four hours post‐transfection, cells were harvested for detection of the exogenously expressed TOPK or seeded onto Transwell inserts for examining migration/invasion ability. For establishing stable cell lines with overexpression or knockdown of TOPK, 5 × 104 cells were seeded into 6‐cm tissue culture plates containing complete growth medium supplemented with G418 (500 μg/mL) at 48 h post‐transfection and selected for approximately 3 weeks. SureSilencing shRNA plasmids specific for TOPK (TGACCCTGAGGCTTGTTACAT or TGTGGGAAATGATGACTTTAT) or negative control (GGAATCTCATTCGATGCATAC) were purchased from SABiosciences (Frederick, MD, USA). The expression of TOPK and β‐tubulin was determined by Western blot analysis using anti‐TOPK antibodies (1:1000; BD Biosciences, Bedford, MA, USA) and anti‐β‐tubulin antibodies (1:3000; Santa Cruz Biotechnology, Santa Cruz, CA, USA). Cell viability was determined using an MTT assay.
Migration/invasion and clonogenic assay
Cells (1 × 104) were seeded onto Matrigel‐coated or uncoated Transwell inserts, and the same medium was added to the lower chamber. The cells were allowed to migrate/invade for 24 h, then fixed in pre‐cold methanol and stained with Giemsa (Sigma‐Aldrich, St Louis, MO, USA). Cells that remained adherent to the underside of the membrane were counted. The diagrams show the mean values from at least three independent experiments and represented as relative cell migration/invasion fold compared to vehicle cells. For clonogenic assay, cells were seeded in six‐well plates with 500 cells/well and cultured for 10 days. Cells were then washed with PBS and the colonies were fixed (acetic acid : methanol, 1:3) and stained with 0.5% crystal violet in methanol.
Results
To systematically investigate the gene expression pattern of TOPK/PBK in NSCLC, we used microarray datasets from three cohorts of patients with NSCLC obtained online from GEO. Figure S1 shows the box plot analysis of TOPK/PBK (Affymetrix probe set ID: 219148_at) gene expression in different stages of lung cancer from various studies. In general, TOPK/PBK is overexpressed in most of the lung cancer tissue samples, as illustrated by the dark gray dashed line in Figure S1, which indicates a twofold change. In addition, higher expression of TOPK/PBK was found to correlate with late‐stage lung adenocarcinoma in microarray dataset 3 (stage III/IV vs. stage I, P = 0.013; stage III/IV vs. stage II, P = 0.037) (Fig. 1). Consistent with its increased expression in late‐stage lung adenocarcinoma, we recently found TOPK/PBK was also significantly upregulated in 225 secondary metastatic tumors as compared with its expression in 30 benign tumors, indicating it is a potential metastatic biomarker.22
Figure 1.
T‐LAK cell‐originated protein kinase/PDZ‐binding kinase (TOPK / PBK) is overexpressed in lung cancer from microarray studies. Box plots show the fold change (tumor/adjacent normal) of TOPK / PBK. Gene expression data were obtained from published lung cancer microarray studies. The x axis denotes dataset source; the y axis denotes the fold change of TOPK / PBK (Affymetrix probe set ID: 219148_at). The dark gray dashed line shows a twofold change in TOPK / PBK expression for each box plot.
In order to gain the mechanistic insights regarding the role of TOPK in cell migration and invasion, we transiently overexpressed TOPK‐WT or TOPK‐T9E, which is the phosphorylation‐mimic form of TOPK and serves as an active form of TOPK in mitosis, in H1299 cells. The result showed that TOPK could promote cell migration/invasion rather than cell proliferation (Fig. 2A). Next, we established stable cell clones with overexpression or knockdown of TOPK to further elucidate the role of TOPK in cell migration/invasion. The results showed TOPK‐overexpressed CL1‐0 cells displayed a similar ability to enhance cell migration/invasion compared with that in mock‐transfected cells (Fig. 2B). Inverse effects were also found in TOPK‐knockdown A549 cells (Fig. 2C). Moreover, knockdown of TOPK significantly affected colony formation (Fig. 2D). Taken together, these results showed the role of TOPK in promoting cell migration, invasion, and colony formation in lung cancer cells.
Figure 2.
T‐LAK cell‐originated protein kinase (TOPK) can promote cell migration, invasion, and clonogenic activity in lung cancer cells. (A) H1299 cells were transiently transfected with vehicle (Veh.) or TOPK expression plasmids as indicated. WT, wild type. (B) Stable clones overexpressing TOPK were established. Cells from (A) and (B) were subjected to detection of TOPK and β‐tubulin by immunoblotting or seeded onto Matrigel‐coated or uncoated Transwell inserts and 96‐well plates to examine migration/invasion and cell growth abilities, respectively. After 24 h, the numbers of migrated (middle panels) and invaded (lower panels) cells were counted and expressed (n = 3) and the growth of cells was quantified by MTT assay. Stable A549 clones with knockdown of TOPK were established and subjected to immunoblotting and migration assay as described above (C). The clonogenic activity of these clones was also determined (D). *P < 0.05; **P < 0.01; ***P < 0.001.
To evaluate the prognostic value of TOPK expression in resected stage I lung adenocarcinoma, a retrospective analysis of 203 patients diagnosed with pathological stage I lung adenocarcinoma was carried out to examine the expression of TOPK by IHC. The demographics of the 203 stage I lung adenocarcinoma patients are summarized in Table 1. The mean follow‐up time was 62.5 months. During the follow‐up period, 60 (29.6%) patients developed tumor recurrence (local recurrence in 20 patients, distant metastasis in 50 patients).
Table 1.
Association of T‐LAK cell‐originated protein kinase (TOPK) immunohistochemistry (IHC) score and clinicopathological characteristics in 203 patients diagnosed with pathological stage I lung adenocarcinoma
| Parameters | TOPK IHC score | P‐value | |
|---|---|---|---|
| ≤3 (n = 67) | >3 (n = 136) | ||
| Age, years | |||
| Mean (±SD) | 65.5 (±10.7) | 65.2 (±11.1) | NS (0.872) |
| Range | 29–87 | 34–88 | |
| Sex | |||
| Male | 43 (64.2%) | 79 (58.1%) | NS (0.405) |
| Female | 24 (35.8%) | 57 (41.9%) | |
| Smoking status | |||
| Non‐smoker | 30 (50.8%) | 63 (51.6%) | NS (0.920) |
| Smoker | 29 (49.2%) | 59 (48.4%) | |
| Follow‐up time, months | |||
| Mean (±SD) | 78.8 (±28.1) | 54.4 (±29.9) | <0.001 |
| Range | 0.37–126.00 | 0.23–125.47 | |
| Recurrence status | |||
| No recurrence | 54 (80.6%) | 89 (65.4%) | 0.026 |
| Recurrence | 13 (19.4%) | 47 (34.6%) | |
| Tumor size, cm | |||
| Mean (±SD) | 3.09 (±1.18) | 3.00 (±1.03) | NS (0.581) |
| Range | 1–5 | 1–5 | |
| Tumor differentiation | |||
| Well to moderate | 47 (70.1%) | 92 (67.6%) | NS (0.718) |
| Poor | 20 (29.9%) | 44 (32.4%) | |
| Tumor necrosis | |||
| No | 41 (61.2%) | 68 (50.0%) | NS (0.133) |
| Yes | 26 (38.8%) | 68 (50.0%) | |
| Angiolymphatic invasion | |||
| No | 54 (80.6%) | 86 (63.2%) | 0.012 |
| Yes | 13 (19.4%) | 50 (36.8%) | |
P‐value for age, follow‐up time, and tumor size were derived from a two‐tailed Student's t‐test; other P‐values were derived from a two‐tailed Pearson's chi‐squared‐test. NS, not significant.
T‐LAK cell‐originated protein kinase was detected in the cytoplasm of tumor cells by IHC. The intensity of immunoreactivity ranged from 0 to 3 (Fig. 3) and the IHC score ranged from 0 to 9, based on the scoring method described in a previous report.29 Among the 203 patients, the TOPK IHC score was distributed as follows: 0, 30 patients; 1, 14 patients; 2, 15 patients; 3, 8 patients; 4, 14 patients; 6, 69 patients; and 9, 53 patients. Sixty‐seven patients (33.0%) had a TOPK IHC score of less than or equal to 3, and the remaining 136 patients (67.0%) had a TOPK IHC score greater than 3. A TOPK IHC score >3 was considered as TOPK overexpression.
Figure 3.
T‐LAK cell‐originated protein kinase expression in stage I lung adenocarcinoma. The intensity of immunoreactivity was recorded as: 0, negative (A); 1, weakly positive (B); 2, moderately positive (C); or 3, strongly positive (D).
We investigated the association of various clinicopathological parameters with samples having either a TOPK IHC score ≤3 or a TOPK IHC score >3. The mean follow‐up time was significantly shorter in patients with a TOPK IHC score >3 (P < 0.001). Disease recurrence and angiolymphatic invasion were more frequent in patients with a TOPK IHC score >3 (P = 0.026 and 0.012, respectively). There were no significant associations of TOPK expression with any of the other clinicopathological parameters (Table 1).
We further analyzed the prognostic values of age, sex, smoking status, tumor size, pathological tumor differentiation, tumor necrosis, angiolymphatic invasion, and TOPK IHC score on the overall survival rate of the patients. The overall survival rate was significantly worse in patients older than 65 years (P = 0.002), with a tumor size >3 cm (P = 0.032), with the presence of tumor necrosis (P = 0.005), with the presence of angiolymphatic invasion (P = 0.003), and with a TOPK IHC score >3 (P < 0.001) (Table 2). The Kaplan–Meier curves for patients with TOPK IHC scores ≤3 and >3 are shown in Figure 4. Multivariate Cox regression analysis revealed that age (>65 years old) (hazard ratio [HR] = 2.13; 95% confidence interval [CI], 1.31~3.47, P = 0.002), and TOPK IHC score (>3) (HR = 4.05; 95% CI, 2.24~7.03; P < 0.001) were independent predictors of overall survival (Table 3).
Table 2.
Five‐year overall survival rates stratified by various clinicopathologic parameters in 203 patients diagnosed with pathological stage I lung adenocarcinoma
| Clinicopathologic parameters | 5‐year survival rate ± SE (%) | Log–rank P‐value |
|---|---|---|
| Age, years | ||
| ≤65 | 74.2 ± 4.9 | 0.002 |
| >65 | 55.0 ± 4.6 | |
| Sex | ||
| Male | 59.8 ± 4.4 | NS (0.404) |
| Female | 67.3 ± 5.4 | |
| Smoking status | ||
| Non‐smoker | 66.3 ± 4.9 | NS (0.300) |
| Smoker | 56.8 ± 5.3 | |
| Tumor size, cm | ||
| ≤3 | 67.4 ± 4.3 | 0.032 |
| >3 | 55.0 ± 5.8 | |
| Tumor differentiation | ||
| Well to moderate | 66.0 ± 4.1 | NS (0.189) |
| Poor | 55.3 ± 6.3 | |
| Tumor necrosis | ||
| Yes | 53.3 ± 5.2 | 0.005 |
| No | 70.7 ± 4.4 | |
| Angiolymphatic invasion | ||
| Yes | 47.1 ± 6.3 | 0.003 |
| No | 69.9 ± 4.0 | |
| TOPK IHC score | ||
| ≤3 | 85.0 ± 4.4 | <0.001 |
| >3 | 51.4 ± 4.4 | |
IHC, immunohistochemistry; NS, not significant; TOPK, T‐LAK cell‐originated protein kinase.
Figure 4.
Overall patient survival rate based on T‐LAK cell‐originated protein kinase (TOPK) immunohistochemistry (IHC) scores. Patients with high TOPK IHC scores (>3) had worse survival rates compared to those with low TOPK IHC scores (≤3) (P < 0.001).
Table 3.
Multivariate analysis for overall survival in 203 patients diagnosed with pathological stage I lung adenocarcinoma
| Clinicopathologic parameters | Hazard ratio | 95% confidence interval | P‐value |
|---|---|---|---|
| Age >65 years | 2.13 | 1.31–3.47 | 0.002 |
| Female | 0.92 | 0.51–1.66 | NS (0.793) |
| Smoking history | 0.98 | 0.55–1.77 | NS (0.965) |
| Tumor size >3 cm | 1.36 | 0.87–2.12 | NS (0.167) |
| Poor differentiation | 1.20 | 0.73–1.96 | NS (0.453) |
| Necrosis | 1.05 | 0.63–1.77 | NS (0.833) |
| Angiolymphatic invasion | 1.50 | 0.95–2.39 | NS (0.080) |
| TOPK IHC score >3 | 4.05 | 2.24–7.03 | <0.001 |
IHC, immunohistochemistry; NS, not significant; TOPK, T‐LAK cell‐originated protein kinase.
We further analyzed the prognostic factors correlated with time to recurrence. Tumor size (>3 cm) (P = 0.016), the presence of tumor necrosis (P = 0.004), and TOPK IHC score (>3) (P = 0.010) were associated with shortened time to recurrence (Table 4). The Kaplan–Meier curves for time to recurrence in patients with TOPK IHC scores ≤3 and >3 are shown in Figure 5. A TOPK IHC score >3 (HR = 2.85, 95% CI, 1.36~5.96, P = 0.005) remained an independent predictor of shortened time to recurrence after analyses by multivariate Cox regression (Table 5). In addition, we also analyzed the prognostic impact of TOPK expression on relapse‐free survival. TOPK IHC score >3 was also strongly associated with poor relapse‐free survival (Fig. S2). To strengthen the clinical impact of TOPK, we managed to obtain an additional 21 stage 1 lung adenocarcinoma patient specimens from Kaohsiung Medical University Chung‐Ho Memorial Hospital (Kaohsiung, Taiwan) as an independent cohort. The Kaplan–Meier survival curves showed that TOPK expression was correlated with poor outcome. Even though the difference did not reach statistical significance, possibly due to the limited sample size, the expression of TOPK was clearly associated with reduced time to recurrence in the patients. We believe that TOPK can serve as a significant prognostic predictor of shortened overall survival and time to recurrence (Fig. S3).
Table 4.
Five‐year recurrence‐free rates stratified by various clinicopathologic parameters in 203 patients diagnosed with pathological stage I lung adenocarcinoma
| Clinicopathologic parameters | 5‐year recurrence‐free rate ± SE (%) | Log–rank P‐value |
|---|---|---|
| Age, years | ||
| ≤65 | 74.7 ± 4.8 | NS (0.142) |
| >65 | 63.6 ± 4.7 | |
| Sex | ||
| Male | 69.1 ± 4.4 | NS (0.854) |
| Female | 67.2 ± 5.4 | |
| Smoking status | ||
| Non‐smoker | 68.3 ± 5.0 | NS (0.894) |
| Smoker | 69.3 ± 5.1 | |
| Tumor size, cm | ||
| ≤3 | 74.5 ± 4.0 | 0.016 |
| >3 | 58.5 ± 5.9 | |
| Tumor differentiation | ||
| Well to moderate | 71.6 ± 4.0 | NS (0.076) |
| Poor | 61.4 ± 6.3 | |
| Tumor necrosis | ||
| Yes | 58.9 ± 5.3 | 0.004 |
| No | 76.5 ± 4.2 | |
| Angiolymphatic invasion | ||
| Yes | 59.6 ± 6.4 | NS (0.065) |
| No | 72.4 ± 3.9 | |
| TOPK IHC score | ||
| ≤3 | 80.2 ± 4.9 | 0.010 |
| >3 | 62.3 ± 4.4 | |
IHC, immunohistochemistry; NS, not significant; TOPK, T‐LAK cell‐originated protein kinase.
Figure 5.
Time to recurrence based on T‐LAK cell‐originated protein kinase (TOPK) immunohistochemistry (IHC) scores. Patients with high TOPK IHC scores (>3) have shortened time to recurrence compared with those with low TOPK IHC scores (≤3) (P = 0.010).
Table 5.
Multivariate analysis for time to recurrence in 203 patients diagnosed with pathological stage I lung adenocarcinoma
| Clinicopathologic parameters | Hazard ratio | 95% confidence interval | P‐value |
|---|---|---|---|
| Age >65 years | 1.63 | 0.88–3.02 | NS (0.116) |
| Female | 1.14 | 0.56–2.32 | NS (0.710) |
| Smoking history | 0.83 | 0.40–1.74 | NS (0.639) |
| Tumor size >3 cm | 1.46 | 0.82–2.58 | NS (0.189) |
| Poor differentiation | 1.38 | 0.75–2.56 | NS (0.298) |
| Necrosis | 1.23 | 0.64–2.37 | NS (0.528) |
| Angiolymphatic invasion | 1.29 | 0.72–2.29 | NS (0.380) |
| TOPK IHC score >3 | 2.85 | 1.36–5.96 | 0.005 |
IHC, immunohistochemistry; NS, not significant; TOPK, T‐LAK cell‐originated protein kinase.
Discussion
Patients with stage I NSCLC have significant recurrence rates and lower than expected survival rates after surgical resection, indicating that our current staging methods do not adequately predict outcome. Although adjuvant chemotherapy after surgical resection has been shown to improve survival in stage II or IIIA patients, disagreement prevails over whether the benefit is recognized in stage I patients. Thus, it is important to identify new molecular factors for the prediction of prognosis to help select patients who may have subclinical micrometastatic disease and who might benefit from adjuvant treatment. In this cohort, we investigated the prognostic value of TOPK expression in patients with resected stage I lung adenocarcinoma. Older age and TOPK overexpression were significant independent prognostic indicators for overall survival rates by multivariate analysis. Overexpression of TOPK was also a significant prognostic factor for shortened time to recurrence by multivariate analysis, and was associated with significantly worse overall survival and shortened time to recurrence in our study.
A substantial number of studies have tried to identify poor prognostic factors in patients with stage I NSCLC for adjuvant therapy.9, 10, 11 In addition, several clinical trials recently discovered that histological subgroups had different outcomes as a result of targeted therapy and newer chemotherapy regimens.30, 31, 32, 33 Therefore, it is important to identify higher risk early‐stage lung adenocarcinoma patients who may benefit from histology‐based treatment.
Based on many microarray studies in NSCLC, gene expression profiles have been used to predict patient survival rates in early‐stage NSCLC. For example, Beer et al.34 reported a combination of 50 genes as a risk index for prediction of overall survival rates in stage I adenocarcinoma. Lu et al.35 reported a combination of 64 genes for prediction of overall survival rates in stage I NSCLC. Chen et al.36 reported that a combination of DUSP6, MMD, STAT1, ERBB3, and LCK as a five‐gene signature was closely associated with improved overall and relapse‐free survival in patients with stage I and II NSCLC. Lau et al.37 identified a three‐gene classifier (STX1A, HIF1a, and CCR7) that predicted different prognoses for early‐stage I NSCLC. Bianchi et al.38 proposed a 10‐gene model (E2F1, E2F4, HOXB7, HSPG2, MCM6, NUDCD1, RRM2, SERPINB5, SF3B1, and SCGB3A1) for predicting overall survival rates in stage I adenocarcinoma.
In addition to gene expression signatures, various biomarkers of protein expression in lung adenocarcinoma have also been proposed in published reports. In a report by Kojima et al.,39 vascular endothelial growth factor‐C and vascular endothelial growth factor receptor 3 were poor prognostic factors in patients with T1 lung adenocarcinoma. Chen et al.40 showed that trophinin, which could enhance cell invasion, was a poor prognostic factor for stage I lung adenocarcinoma. Hung et al.28 proposed a model using a combination of HIF‐1α, Twist1, and Snail to predict poor overall survival rates in early‐stage lung adenocarcinoma. Seki et al.41 reported that high eIF4E and low 4E‐BP1 were unfavorable prognostic factors in patients with pathological stage I lung adenocarcinoma. Thyroid transcription factor‐1 expression was a predictor of better overall survival in patients with lung adenocarcinoma.42 High expression of ribonucleotide reductase regulatory subunit M1 (RRM1) protein was associated with increased disease‐free and overall survival in patients with early‐stage NSCLC.43 However, high RRM1 protein expression correlated with reduced response rates in patients receiving gemcitabine‐based regimens.44, 45 Recently, Liu et al. identified annexin A1 as a pro‐invasive and prognostic factor for lung adenocarcinoma.46 Recently, we identified TOPK as a metastasis‐associated protein kinase by its upregulation in secondary metastatic tumors and in brain metastasis from lung tumor.22 The findings of the present study further establish TOPK as a new prognostic marker for stage I lung adenocarcinoma.
Lung adenocarcinoma patients in Asia often have the epidermal growth factor receptor (EGFR) mutation, therefore, we sequenced 67 lung adenocarcinoma samples in this study to explore the correlation between TOPK expression and EGFR mutation status. Among these 67 patients, 27 patients had the EGFR mutation, including 18 cases with the L858R mutation, eight cases with exon 19 deletion, and one case with the G719S mutation (Table S1). There was no difference in overall survival between the patients with and without EGFR mutation (5‐year overall survival rate, 63% vs. 55%; P = 0.628) (Fig. S4). In addition, there was no difference in time to recurrence between the patients with and without the EGFR mutation (5‐year recurrence‐free rate, 57.4% vs. 71.0%; P = 0.192) (Fig. S5). Finally, TOPK expression was not correlated with positive EGFR mutation status (P = 0.564, chi‐squared‐test).
In conclusion, our results indicate that overexpression of TOPK is a potential prognostic predictor in stage I lung adenocarcinoma. The expression of TOPK in resected adenocarcinoma of lung could help to identify stage I patients who are at risk for recurrent disease, and may provide a valuable tool in selecting patients for adjuvant treatment. Nevertheless, our finding needs to be validated in a prospective study.
Disclosure Statement
The authors have no conflicts of interest.
Supporting information
Fig. S1. T‐LAK cell‐originated protein kinase/PDZ‐binding kinase (TOPK / PBK) is overexpressed in lung cancer from microarray studies.
Fig. S2. Relapse‐free survival based on T‐LAK cell‐originated protein kinase (TOPK) immunohistochemistry (IHC) score.
Fig. S3. Time to recurrence analysis of 21 cases of stage I lung carcinoma from Kaohsing Medical University Hospital based on T‐LAK cell‐originated protein kinase (TOPK) immunohistochemistry (IHC) score.
Fig. S4. Overall patient survival rate based on epidermal growth factor receptor (EGFR) mutation status.
Fig. S5. Time to recurrence based on epidermal growth factor receptor (EGFR) mutation status.
Table S1. Epidermal growth factor receptor (EGFR) mutation status of 67 lung adenocarcinoma samples.
Acknowledgments
We thank Dr. Chi‐Ying F. Huang (Yang‐Ming University, Taipei, Taiwan) for providing lung cancer microarray data and critical reading of this manuscript. This work was supported by grants from the National Science Council (Taiwan) (NSC95‐2311‐B‐030‐002‐MY3, NSC99‐2627‐B‐030‐001 and NSC100‐2627‐B‐030‐001) awarded to J.M. Lai, and from the Center of Excellence for Cancer Research at Taipei Veterans General Hospital (DOH100‐TD‐C‐111‐007) awarded to T.Y. Chou and Y.C. Wu.
References
- 1. Devesa SS, Bray F, Vizcaino AP, Parkin DM. International lung cancer trends by histologic type: male:female differences diminishing and adenocarcinoma rates rising. Int J Cancer 2005; 117: 294–9. [DOI] [PubMed] [Google Scholar]
- 2. Youlden DR, Cramb SM, Baade PD. The International Epidemiology of Lung Cancer: geographical distribution and secular trends. J Thorac Oncol. 2008; 3: 819–31. [DOI] [PubMed] [Google Scholar]
- 3. Scott WJ, Howington J, Feigenberg S, Movsas B, Pisters K. Treatment of non‐small cell lung cancer stage I and stage II: ACCP evidence‐based clinical practice guidelines (2nd edition). Chest 2007; 3 Suppl: 234S–42S. [DOI] [PubMed] [Google Scholar]
- 4. Mountain CF. Revisions in the International System for Staging Lung Cancer. Chest 1997; 111: 1710–7. [DOI] [PubMed] [Google Scholar]
- 5. Martini N, Bains MS, Burt ME et al Incidence of local recurrence and second primary tumors in resected stage I lung cancer. J Thorac Cardiovasc Surg 1995; 109: 120–9. [DOI] [PubMed] [Google Scholar]
- 6. Hung JJ, Hsu WH, Hsieh CC et al Post‐recurrence survival in completely resected stage I non‐small cell lung cancer with local recurrence. Thorax 2009; 64: 192–6. [DOI] [PubMed] [Google Scholar]
- 7. Hung JJ, Jeng WJ, Hsu WH et al Prognostic factors of postrecurrence survival in completely resected stage I non‐small cell lung cancer with distant metastasis. Thorax 2010; 65: 241–5. [DOI] [PubMed] [Google Scholar]
- 8. Sugimura H, Nichols FC, Yang P et al Survival after recurrent nonsmall‐cell lung cancer after complete pulmonary resection. Ann Thorac Surg 2007; 83: 409–17; discussion 17–8. [DOI] [PubMed] [Google Scholar]
- 9. Strauss GM, Herndon JE 2nd, Maddaus MA et al Adjuvant paclitaxel plus carboplatin compared with observation in stage IB non‐small‐cell lung cancer: CALGB 9633 with the Cancer and Leukemia Group B, Radiation Therapy Oncology Group, and North Central Cancer Treatment Group Study Groups. J Clin Oncol 2008; 26: 5043–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Pignon JP, Tribodet H, Scagliotti GV et al Lung adjuvant cisplatin evaluation: a pooled analysis by the LACE Collaborative Group. J Clin Oncol 2008; 26: 3552–9. [DOI] [PubMed] [Google Scholar]
- 11. Butts CA, Ding K, Seymour L et al Randomized phase III trial of vinorelbine plus cisplatin compared with observation in completely resected stage IB and II non‐small‐cell lung cancer: updated survival analysis of JBR‐10. J Clin Oncol 2010; 28: 29–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Abe Y, Matsumoto S, Kito K, Ueda N. Cloning and expression of a novel MAPKK‐like protein kinase, lymphokine‐activated killer T‐cell‐originated protein kinase, specifically expressed in the testis and activated lymphoid cells. J Biol Chem 2000; 275: 21525–31. [DOI] [PubMed] [Google Scholar]
- 13. Gaudet S, Branton D, Lue RA. Characterization of PDZ‐binding kinase, a mitotic kinase. Proc Natl Acad Sci USA 2000; 97: 5167–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Simons‐Evelyn M, Bailey‐Dell K, Toretsky JA et al PBK/TOPK is a novel mitotic kinase which is upregulated in Burkitt's lymphoma and other highly proliferative malignant cells. Blood Cells Mol Dis 2001; 27: 825–9. [DOI] [PubMed] [Google Scholar]
- 15. Nandi A, Tidwell M, Karp J, Rapoport AP. Protein expression of PDZ‐binding kinase is up‐regulated in hematologic malignancies and strongly down‐regulated during terminal differentiation of HL‐60 leukemic cells. Blood Cells Mol Dis 2004; 32: 240–5. [DOI] [PubMed] [Google Scholar]
- 16. Park JH, Lin ML, Nishidate T, Nakamura Y, Katagiri T. PDZ‐binding kinase/T‐LAK cell‐originated protein kinase, a putative cancer/testis antigen with an oncogenic activity in breast cancer. Cancer Res 2006; 66: 9186–95. [DOI] [PubMed] [Google Scholar]
- 17. Ayllon V, O'Connor R. PBK/TOPK promotes tumour cell proliferation through p38 MAPK activity and regulation of the DNA damage response. Oncogene 2007; 26: 3451–61. [DOI] [PubMed] [Google Scholar]
- 18. Oh SM, Zhu F, Cho YY et al T‐lymphokine‐activated killer cell‐originated protein kinase functions as a positive regulator of c‐Jun‐NH2‐kinase 1 signaling and H‐Ras‐induced cell transformation. Cancer Res 2007; 67: 5186–94. [DOI] [PubMed] [Google Scholar]
- 19. Zhu F, Zykova TA, Kang BS et al Bidirectional signals transduced by TOPK‐ERK interaction increase tumorigenesis of HCT116 colorectal cancer cells. Gastroenterology 2007; 133: 219–31. [DOI] [PubMed] [Google Scholar]
- 20. Herrero‐Martin D, Osuna D, Ordonez JL et al Stable interference of EWS‐FLI1 in an Ewing sarcoma cell line impairs IGF‐1/IGF‐1R signalling and reveals TOPK as a new target. Br J Cancer 2009; 101: 80–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Hu F, Gartenhaus RB, Eichberg D, Liu Z, Fang HB, Rapoport AP. PBK/TOPK interacts with the DBD domain of tumor suppressor p53 and modulates expression of transcriptional targets including p21. Oncogene 2010; 29: 5464–74. [DOI] [PubMed] [Google Scholar]
- 22. Shih MC, Chen JY, Wu YC et al TOPK/PBK promotes cell migration via modulation of the PI3K/PTEN/AKT pathway and is associated with poor prognosis in lung cancer. Oncogene 2011; DOI: 10.1038/onc.2011.419. [Epub ahead of print]. [DOI] [PubMed] [Google Scholar]
- 23. Su LJ, Chang CW, Wu YC et al Selection of DDX5 as a novel internal control for Q‐RT‐PCR from microarray data using a block bootstrap re‐sampling scheme. BMC Genomics 2007; 8: 140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Landi MT, Dracheva T, Rotunno M et al Gene expression signature of cigarette smoking and its role in lung adenocarcinoma development and survival. PLoS ONE 2008; 3: e1651. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Lu TP, Tsai MH, Lee JM et al Identification of a novel biomarker, SEMA5A, for non‐small cell lung carcinoma in nonsmoking women. Cancer Epidemiol Biomarkers Prev 2010; 19: 2590–7. [DOI] [PubMed] [Google Scholar]
- 26. Edge SB, Byrd DR, Compton CC, Fritz AG, Greene FL, Trotti A. AJCC Cancer Staging Manual, 7th edn New York, NY: Springer, 2009; 253–70. [Google Scholar]
- 27. Punt CJA, Buyse M, Köhne C‐H et al Endpoints in adjuvant treatment trials: a systematic review of the literature in colon cancer and proposed definitions for future trials. J Natl Cancer Inst, 2007; 99: 998–1003. [DOI] [PubMed] [Google Scholar]
- 28. Hung JJ, Yang MH, Hsu HS, Hsu WH, Liu JS, Wu KJ. Prognostic significance of hypoxia‐inducible factor‐1alpha, TWIST1 and Snail expression in resectable non‐small cell lung cancer. Thorax 2009; 64: 1082–9. [DOI] [PubMed] [Google Scholar]
- 29. Arnes JB, Collett K, Akslen LA. Independent prognostic value of the basal‐like phenotype of breast cancer and associations with EGFR and candidate stem cell marker BMI‐1. Histopathology 2008; 52: 370–80. [DOI] [PubMed] [Google Scholar]
- 30. Langer CJ, Besse B, Gualberto A, Brambilla E, Soria JC. The evolving role of histology in the management of advanced non‐small‐cell lung cancer. J Clin Oncol 2010; 28: 5311–20. [DOI] [PubMed] [Google Scholar]
- 31. Hirsch FR, Spreafico A, Novello S, Wood MD, Simms L, Papotti M. The prognostic and predictive role of histology in advanced non‐small cell lung cancer: a literature review. J Thorac Oncol 2008; 3: 1468–81. [DOI] [PubMed] [Google Scholar]
- 32. Johnson DH, Fehrenbacher L, Novotny WF et al Randomized phase II trial comparing bevacizumab plus carboplatin and paclitaxel with carboplatin and paclitaxel alone in previously untreated locally advanced or metastatic non‐small‐cell lung cancer. J Clin Oncol 2004; 22: 2184–91. [DOI] [PubMed] [Google Scholar]
- 33. Scagliotti G, Hanna N, Fossella F et al The differential efficacy of pemetrexed according to NSCLC histology: a review of two Phase III studies. Oncologist 2009; 14: 253–63. [DOI] [PubMed] [Google Scholar]
- 34. Beer DG, Kardia SL, Huang CC et al Gene‐expression profiles predict survival of patients with lung adenocarcinoma. Nat Med 2002; 8: 816–24. [DOI] [PubMed] [Google Scholar]
- 35. Lu Y, Lemon W, Liu PY et al A gene expression signature predicts survival of patients with stage I non‐small cell lung cancer. PLoS Med 2006; 3: e467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Chen HY, Yu SL, Chen CH et al A five‐gene signature and clinical outcome in non‐small‐cell lung cancer. N Engl J Med 2007; 356: 11–20. [DOI] [PubMed] [Google Scholar]
- 37. Lau SK, Boutros PC, Pintilie M et al Three‐gene prognostic classifier for early‐stage non small‐cell lung cancer. J Clin Oncol 2007; 25: 5562–9. [DOI] [PubMed] [Google Scholar]
- 38. Bianchi F, Nuciforo P, Vecchi M et al Survival prediction of stage I lung adenocarcinomas by expression of 10 genes. J Clin Invest 2007; 117: 3436–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Kojima H, Shijubo N, Yamada G et al Clinical significance of vascular endothelial growth factor‐C and vascular endothelial growth factor receptor 3 in patients with T1 lung adenocarcinoma. Cancer 2005; 8: 1668–77. [DOI] [PubMed] [Google Scholar]
- 40. Chen KY, Lee YC, Lai JM et al Identification of trophinin as an enhancer for cell invasion and a prognostic factor for early stage lung cancer. Eur J Cancer 2007; 43: 782–90. [DOI] [PubMed] [Google Scholar]
- 41. Seki N, Takasu T, Sawada S et al Prognostic significance of expression of eukaryotic initiation factor 4E and 4E binding protein 1 in patients with pathological stage I invasive lung adenocarcinoma. Lung Cancer 2010; 70: 329–34. [DOI] [PubMed] [Google Scholar]
- 42. Barletta JA, Perner S, Iafrate AJ et al Clinical significance of TTF‐1 protein expression and TTF‐1 gene amplification in lung adenocarcinoma. J Cell Mol Med 2009; 13: 1977–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Zheng Z, Chen T, Li X, Haura E, Sharma A, Bepler G. DNA synthesis and repair genes RRM1 and ERCC1 in lung cancer. N Engl J Med 2007; 8: 800–8. [DOI] [PubMed] [Google Scholar]
- 44. Reynolds C, Obasaju C, Schell MJ et al Randomized phase III trial of gemcitabine‐based chemotherapy with in situ RRM1 and ERCC1 protein levels for response prediction in non‐small‐cell lung cancer. J Clin Oncol 2009; 27: 5808–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Lee JJ, Maeng CH, Baek SK et al The immunohistochemical overexpression of ribonucleotide reductase regulatory subunit M1 (RRM1) protein is a predictor of shorter survival to gemcitabine‐based chemotherapy in advanced non‐small cell lung cancer (NSCLC). Lung Cancer 2010; 70: 205–10. [DOI] [PubMed] [Google Scholar]
- 46. Liu YF, Zhang PF, Li MY, Li QQ, Chen ZC. Identification of annexin A1 as a proinvasive and prognostic factor for lung adenocarcinoma. Clin Exp Metastasis 2011; 28: 413–25. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1. T‐LAK cell‐originated protein kinase/PDZ‐binding kinase (TOPK / PBK) is overexpressed in lung cancer from microarray studies.
Fig. S2. Relapse‐free survival based on T‐LAK cell‐originated protein kinase (TOPK) immunohistochemistry (IHC) score.
Fig. S3. Time to recurrence analysis of 21 cases of stage I lung carcinoma from Kaohsing Medical University Hospital based on T‐LAK cell‐originated protein kinase (TOPK) immunohistochemistry (IHC) score.
Fig. S4. Overall patient survival rate based on epidermal growth factor receptor (EGFR) mutation status.
Fig. S5. Time to recurrence based on epidermal growth factor receptor (EGFR) mutation status.
Table S1. Epidermal growth factor receptor (EGFR) mutation status of 67 lung adenocarcinoma samples.