Skip to main content
Cancer Science logoLink to Cancer Science
. 2012 Aug 10;103(10):1880–1888. doi: 10.1111/j.1349-7006.2012.02380.x

Effects of G250 promoter controlled conditionally replicative adenovirus expressing Ki67‐siRNA on renal cancer cell

Junjie Liu 1,2,, Lin Fang 2,, Qian Cheng 2, Liantao Li 2, Changqing Su 3, Baofu Zhang 2, Dongsheng Pei 2, Jie Yang 2, Wang Li 1, Junnian Zheng 1,2,
PMCID: PMC7659360  PMID: 22775978

Abstract

Replication‐competent adenovirus (RCAd) has been used extensively in cancer gene therapy, and tumor‐selection is critical for the use of replication‐competent adenovirus. Here we investigated the anti‐tumor characterization of oncolytic virus, whose E1A gene is under the control of a renal cell carcinoma specific promoter – the G250 promoter. The constructed oncolytic virus G250‐Ki67 is armed with transgene of Ki67‐siRNA, and G250‐ZD55‐Ki67 also with E1B‐55 KD deleted. The tumor‐specific expression of E1A and Ki67 was demonstrated by Western blot and immunohistochemistry staining, and the tumor‐specific cytotoxicity was assessed by crystal violet staining and cell viability assays. The G250‐Ki67 and G250‐ZD55‐Ki67 adenoviruses could express E1A protein in 786‐O and OSRC cell lines but not in ACHN and HK‐2 cell lines. The expression of Ki67 gene in 786‐O and OSRC cell lines were suppressed by these adenoviruses. The cytotoxic effects induced by G250‐ZD55‐Ki67 and G250‐Ki67 were more obvious on the 786‐O cell lines than on the OSRC cell lines. Each group of adenoviruses could inhibit the proliferation of the 786‐O cells and OSRC cells. However, the effects induced by G250‐ZD55‐Ki67 and G250‐Ki67 on 786‐O cells were stronger than on OSRC cells. Moreover, G250‐ZD55‐Ki67 had enhanced antitumor activities in these renal cancer cells compared with G250‐Ki67. G250 promoter‐derived CRAds carrying Ki67‐siRNA could highly amplify and express Ki67‐siRNA in renal cancer cells with expression of G250 antigen, inhibit renal cancer cells proliferation and induce apoptosis. These results demonstrated that the G250‐specific oncolytic adenovirus expressing Ki67‐siRNA is applicable for human renal clear cell cancer therapy.


Tumor‐selective replicating viruses offer appealing advantages over conventional cancer therapy and are a promising new approach for the treatment of human cancer.1 One strategy to achieve the desired tumor selectivity is the use of tumor‐specific transcriptional response elements (promoters) to control the expression of essential early virus genes for replication, such as E1A, which are required to transactivate the other adenoviral genes.2, 3, 4, 5, 6 Tumor‐selective promoters control the expression of viral genes mainly in tumor cells but not in normal cells, so the adenovirus can selectively replicate in the tumor cells and kill those cells. The utility of a highly promising tumor‐selective promoter will restrict the sites of viral replication and expression of therapeutic transgenes.7 It is important to choose the specific promoters for the selectivity and tightness of regulation.2

G250 is a cell‐surface antigen, expressed on 90% of primary renal cancer cell (RCC) and 82% of metastatic RCC lesions but not on normal kidney cells. Immunohistochemistry studies have manifested that G250 mAb can specifically combine with and localizes to G250 Ag‐positive RCC, and that uptake in the tumors is very high.8 G250 is thought to play a role in the regulation of cell proliferation in response to hypoxic conditions and may be involved in oncogenesis and tumor progression.9 G250 is selected as an attractive target for tumor gene therapy, because of its nearly exclusive expression in renal carcinoma cell.10 G250‐specific recombinant adenovirus and gene vector modified with G250 monoclonal antibody have shown the feasibility of immunologic retargeting of adenovirus to RCC cells.11, 12

Ki‐67 is an established proliferation maker, which is used extensively to estimate the proliferation fraction of tumors.13 Cells express Ki67 during G1, S, G2, and M phases, but not during the resting phase G0.14 Ki67 labeling index is an independent predictor of disease progression and recurrence in carcinomas including renal cell carcinoma,15, 16, 17 and also used as grade index and prognostic marker.18, 19 Ki67 is selected as a potent target of cancer gene therapy, for it is present in most malignant cells but scarcely detected in most normal cells and has relativity to cell proliferation. The effect of inhibiting cancer cell proliferation and inducing apoptosis when Ki‐67 is blocked by small‐interfering RNAs (siRNAs) against Ki67 mRNA has been demonstrated.20, 21

To increase the safety and efficiency of adenovirus, some modifications have been introduced to restrict adenovirus replication to tumor cells.22 One of these modifications is to replace promoters for essential viral genes with promoters that are active only in tumor cells.23 We have previously constructed a novel oncolytic adenoviral with E1A gene controlled by hTERT promoter, targeting Ki67 gene with small‐interfering RNAs. The hTERT promoter is a potent controlling element of E1A; however, it is less specific than the G250 promoter in renal carcinoma cells according to our previous study (data not show). Here we inspected the specific anti‐tumor effects of G250 promoter controlled oncolytic adenovirus expressing Ki67 siRNA on human renal carcinoma cells.

Materials and Methods

Cells cultures

Human Renal cancer cell line 786‐O (G250 expressed highly), OSRC (G250 expressed moderately), ACHN (G250 expressed lowly) and normal renal tubular epithelial cell line HK‐2 (no G250 expression) were purchased from the Chinese Academy of Sciences (Shanghai, China). 786‐O and OSRC cells were cultured in RPMI‐1640 with 10% FBS, ACHN were cultured in DMEM with 10% FBS, HK‐2 were cultured in DMEM‐F12 with 10% FBS, at 37°C in a 5% CO2 humidified incubator.

G250 expression

786‐O, OSRC, ACHN and HK‐2 were cultured routinely and total RNA were extracted by Trizol (Invitrogen, Eugene, OR, USA). Expression of G250 mRNA was analyzed by semiquantitative RT‐PCR according to the manufacturer's protocol. The 200‐bp fragment of the G250 gene was amplified with the specific primers: sense: 5′‐GTCTCGCTTGGAAGAAATCG‐3′, anti‐sense: 5′‐AGAGGGTGTGGAGCTGCTTA‐3′. The 450‐bp fragment of the GAPDH gene was also amplified as an inner control. G250 was also analyzed by Western blot with the primary mouse anti G250 monoclonal antibody (Chemicon, Billerica, MA, USA). The cell lysates were extracted with RIPA buffer, and β‐actin was used as an inner control.

Virus construction and production

pZD55, the E1B55kD‐deleted oncolytic adenovirus construction plasmid and pZD55‐EGFP, pZD55 vector with reporter gene EGFP, were kindly provided by Professor Xinyuan Liu. G250 promoter was amplified from the plasmid pGLB‐G218, which was constructed previously; a 218‐bp G250 promoter fragment was inserted into pGL‐Basic. The luciferase assay had identified the activity of G218 in 786‐O and Hela cells. The plasmid pG250 was generated by placing G250 promoter into pZXC2, in which the E1A own promoter was deleted. The expression cassette of Ki67siRNA gene containing H1 promoter was produced by PCR from pSilencer3.1‐Ki67 and inserted into pZD55 or pG250 to construct pZD55‐Ki67 or pG250‐Ki67 successfully. The E1A own promoter of pZD55 and pZD55‐Ki67 were replaced by G250 promoter to construct pG250‐ZD55 and pG250‐ZD55‐Ki67 successfully. The plasmids pZD55‐Ki67, pG250‐Ki67 and pG250‐ZD55‐Ki67 were transfected into 293 cells together with plasmid pBHGE3 to obtain the recombinant CRAds, denoted ZD55‐Ki67, G250‐Ki67 and G250‐ZD55‐Ki67 respectively. The viral plaques appeared 9–12 days after infection. The recombinant adenoviruses ZD55‐EGFP, G250‐EGFP and G250‐ZD55‐EGFP carried report gene EGFP were also generated as control. These recombinant adenoviruses were verified by PCR. Viruses were plaque purified, propagated on HEK293 cells and functional PFU titers were determined by plaque assay on 293 cells.

Western blotting analysis

Cells were infected with ZD55‐Ki67, G250‐Ki67, G250‐ZD55‐Ki67, ZD55‐EGFP, G250‐EGFP or G250‐ZD55‐EGFP at a multiplicities of infection (MOI) of 10. Forty‐eight hours later, cells were harvested by trypsinization and resuspended in lysis buffer. The total protein concentration was determined with a bicinchoninic acid (BCA) protein assay kit (Beyotime Institute of Biotechnology, Beyotime, Haimen, China) as described in the manufacturer's protocol. Protein samples were separated on a 10% SDS‐polyacrylamide gel, then transferred to nitrocellulose membrane. Membranes were blocked in 3% BSA solution and incubated with primary antibody overnight at 4°C. Membranes were then washed and incubated with the appropriate secondary antibodies, and developed using NBT/BCIP color substrate (Promega, Madison, WI, USA). The density of the bands on the membrane were scanned and analyzed with an Image‐J analyzer. The primary antibodies used were rabbit anti‐E1A (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and mouse anti‐GAPDH (Beyotime), and GAPDH was used as an inner control.

RT‐PCR

Cells were cultured and infected as described above. At the indicated time points, total cellular RNA was extracted using the standard protocol. One microgram of total RNA was reverse transcribed to cDNA using PrimeScript RT reagent Kit. The sequences to amplify Ki‐67 gene were forward primer 5′‐CTTTGGGTGCGACTTGACG‐3′, and reverse primer 5′‐ GTCGACCCCGCTCCTTTT‐3′. The primers were synthesized by Invitrogen. The conditions of PCR were as follows: 30 cycles at 98°C for 10 s, 55°C for 30 s, and 72°C for 12 s. The 450‐bp fragment of the GAPDH gene was also amplified as an inner control. The PCR products were separated on 2% agarose gel electrophoresis, the pictures were taken, and quantification was done by an image analyzer (UVP, Upland, CA, USA).

Immunohistochemistry staining

786‐O, OSRC, ACHN and HK‐2 were infected with MOI = 10 ZD55‐Ki67, G250‐Ki67, G250‐ZD55‐Ki67, ZD55‐EGFP, G250‐EGFP, G250‐ZD55‐EGFP or PBS, respectively. Forty‐eight hours after transfection, media was removed from the infected cells, and then cells were washed with PBS three times, fixed with 4% polyoxymethylene for 30 min, washed with PBS three times again, incubated with 0.1% Triton X‐100 for 20 min, and washed with PBS three times; the following procedure was according to the instruction of the manufacturer. Ki‐67 positive staining was developed to produce brown reaction product.

Cytotoxicity assay

786‐O, OSRC, ACHN and HK‐2 cells were seeded at a density of 3 × 105 per well in a six‐well culture plate. After 24 h, cells were infected with G250‐Ki67, G250‐EGFP,G250‐ZD55‐Ki67 or G250‐ZD55‐EGFP, respectively, at various MOIs: 100, l0, 1, 0.1 and 0.01. Five days after infection, the cells were exposed to 2% crystal violet in 20% methanol for 15 min, washed with distilled water (dH2O), and photographed.

Cell viability assay

786‐O, OSRC, ACHN and HK‐2 cells were seeded at a density of 1 × 104 per well in a 96‐well culture plate. After 24 h, cells were also infected with G250‐Ki67, G250‐ZD55‐Ki67, G250‐EGFP or G250‐ZD55‐EGFP, respectively, at a 10 MOI. Cell proliferation was detected at 24, 48, 72, and 96 h after transfection. MTT solution (20 μL; 5 mg/mL) was added to each well, and the cells were further incubated at 37°C for 4 h. The supernatant was replaced with DMSO to dissolve the solid product. The absorbance at wavelength 570 nm was measured with a Multiskan Spectrum Microplate reader (Thermo Scientific, Vantaa, Finland). The ratio of the absorbance of treated cells relative to that of the untreated cells was calculated.

Virus replication assay

Logarithmically growing cells were cultured in six‐well plates. Twenty‐four hours later, cells were infected with G250‐Ki67, G250‐ZD55‐Ki67 or Ad‐Ki67 (a non‐replicative adenovirus carrying Ki67siRNA) at an MOI of 10. After 2 days' incubation, cells were lysed though three cycles of freeze and thaw. The titers of viral progenies were quantified on HEK293 cells with the TCID50 method. The replication multiples of adenovirus in the tested cells were equal to viral progeny titers at 48 h normalized with that at the beginning of infection.

Animal experiments

All procedures for animal experiments were approved by the Committee on the Use and Care of Animals and performed in accordance with the institution's guidelines. 786‐O tumor xenografts were established by subcutaneously inoculating 1 × 106 cells into the right flanks of 4–6‐week‐old BALB/c nude mice (Institute of Animal Center, the Chinese Academy of Sciences, Shanghai). When tumors reached between 6 and 8 mm in diameter, 40 mice were randomly assigned to groups: PBS‐treated (n = 10), G250‐ZD55‐Ki67‐treated (n = 10), G250‐ZD55‐EGFP‐treated (n = 10) and Ad‐Ki67‐treated (n = 10). The established tumors were injected with 100 μL of PBS or 2 × 108 pfu of various adenoviruses. The injections were repeated five times every other day, with a total dosage of 1 × 109 pfu of adenoviruses. Seven days after total injection, three mice were killed and tumors were removed for immunohistochemistry assay. The other animals were still fed until the end of the experiment. Tumor growth was monitored by periodic measurements with calipers, and tumor volume was calculated using the following formula: tumor volume (mm3) = maximal length (mm) × (perpendicular width) (mm2)/2. Animals were killed when the diameter of tumors reached 2 cm.

Statistical analysis

Experimental results were expressed as mean ± SD and assessed using Student's t‐test. Data were considered statistically significant at < 0.05.

Results

G250 expression in cell lines

Total RNA was isolated from a panel of cells in culture and performed RT‐PCR with specific primers to determine the expression of G250. The results showed that no expression of G250 mRNA in normal human cells (HK‐2). As shown in Figure 1(a), human renal cancer cell line 786‐O showed highly positive G250 mRNA expression, G250 mRNA expressed in OSRC was moderate and in ACHN it was very low. G250 protein expression in these cell lines was examined by Western blotting. In normal cell lines HK‐2, G250 was negative. But in 786‐O cells, G250 was significantly positive (Fig. 1b). The results were consistent with RT‐PCR assay. Moreover, these results corresponded to other reports.

Figure 1.

Figure 1

G250 expression in different cells and the expression of E1A protein in human renal carcinoma cells infected by different adenoviruses. (a) The total RNA was extracted by TRIZOL and reversed to cDNA. Reverse transcription‐polymerase chain reaction (RT‐PCR) was performed to detected G250 mRNA expression in786‐O, OSRC, ACHN and HK‐2 cells (a). Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was an inner control. (b) Western blotting was used to analyze the expression of G250 antigen in 786‐O, OSRC, ACHN and HK‐2 cells. β‐Actin was used as control. (c) 786‐O, OSRC, ACHN and HK‐2 cells were infected with ZD55‐Ki67, G250‐Ki67, G250‐ZD55‐Ki67, ZD55‐EGFP, G250‐EGFP or G250‐ZD55‐EGFP at an multiplicities of infection (MOI) of 10. Forty‐eight hours later, lysates from infected cells were subjected to Western blot assay. The membrane was blotted with anti‐E1A monoclonal antibody. GAPDH was an inner control.

Evaluation of core G250 promoter element for cancer‐specific expression

E1A protein is a prerequisite for adenovirus replication and an indicator of the potential of an adenovirus to lyse infected cells. To assess the effects of G250 promoter on driving the E1A expression, tumor cells and normal cells were infected with ZD55‐Ki67, G250‐Ki67, G250‐ZD55‐Ki67, ZD55‐EGFP, G250‐EGFP or G250‐ZD55‐EGFP. Western blotting results showed adenoviruses G250‐Ki67, G250‐ZD55‐Ki67, G250‐EGFP and G250‐ZD55‐EGFP could express E1A protein in G250 antigen‐positive cell lines 786‐O and OSRC highly, but not in low or no expression of G250 antigen of ACHN and HK‐2 cell lines. E1B55kD deleted viruses ZD55‐Ki67 and ZD55‐EGFP with wild type E1A promoter expressing E1A protein in all of the used renal carcinoma cell lines, but not in the normal cell line HK‐2 (Fig. 1c).

Expression of Ki67 in renal carcinoma cells and normal cells

In order to evaluate the efficiency of Ki67 siRNA, we infected the same panel of cell lines as in Figure 2 with 10 MOI ZD55‐Ki67, G250‐Ki67, G250‐ZD55‐Ki67, ZD55‐EGFP, G250‐EGFP or G250‐ZD55‐EGFP. Forty‐eight hours later, RT‐PCR was used to detect the Ki67 mRNA expression. There was no significant difference of Ki67 mRNA expression in G250‐positive 786‐O cells infected with G250‐Ki67, ZD55‐Ki67 and G250‐ZD55‐Ki67, compared with the control group, but the expression level was much lower than that in the 786‐O cells treated with G250‐EGFP, ZD55‐EGFP or G250‐ZD55‐EGFP. However, in OSRC cells with G250 moderately expressed, the Ki67 mRNA expression of ZD55‐Ki67 was lower than the G250‐Ki67 and G250‐ZD55‐Ki67 treatment group, and there was no detectable decrease of Ki67 expression in OSRC cells infected with G250‐EGFP, ZD55‐EGFP or G250‐ZD55‐EGFP. We also found that Ki67 mRNA expression was much lower in ACHN cells treated with ZD55‐Ki67 than treated with other viruses. The Ki67 mRNA expression in HK‐2 cells was not different in various groups (Fig. 2).

Figure 2.

Figure 2

The expression of Ki67 mRNA in human renal carcinoma cells. 786‐O, OSRC, ACHN and HK‐2 cells were infected with ZD55‐Ki67, G250‐Ki67, G250‐ZD55‐Ki67, ZD55‐EGFP, G250‐EGFP or G250‐ZD55‐EGFP at an multiplicities of infection (MOI) of 10. At 48 h, reverse transcription‐polymerase chain reaction (RT‐PCR) analyzed for Ki67 mRNA. In 786‐O cells the expressions of each treatment group were: G250‐EGFP (96.32 ± 1.79%), G250‐Ki67 (35.13 ± 2.01%), G250‐ZD55‐EGFP (97.12 ± 1.73%), G250‐ZD55‐Ki67 (36.61 ± 3.06%), ZD55‐Ki67 (36.46 ± 3.56%) and ZD55‐EGFP (95.71 ± 4.04%). There were significant differences between the G250‐Ki67, ZD55‐Ki67 or G250‐ZD55‐Ki67 group and the control group (< 0.01). The Ki67 mRNA expression in the G250‐EGFP, ZD55‐EGFP or G250‐ZD55‐EGFP group was similar to the control group. However, there was no significant difference between the G250‐Ki67 group and G250‐ZD55‐Ki67 group (> 0.05). In OSRC cells, the Ki67 mRNA expression of G250‐Ki67 (76.11 ± 3.52%), ZD55‐Ki67 (41.49 ± 3.89%) and G250‐ZD55‐Ki67 (77.58 ± 4.68%) treatment groups were lower than G250‐ZD55‐EGFP (97.51 ± 1.95%), ZD55‐EGFP (93.88 ± 2.57%) and G250‐EGFP (97.81 ± 2.41%) compared to the control (< 0.01). There were no significant differences between all the treatment groups in ACHN cells and HK‐2 cells (> 0.05). Ki67 mRNA level (ratio of Ki67 to glyceraldehyde 3‐phosphate dehydrogenase [GAPDH]) was quantified on an Image‐J software (LabWorks Software, UVP Upland, CA, USA) (right).

Next, we wished to investigate the expression of Ki67 protein in 786‐O, OSRC, ACHN and HK‐2 cells after treatment with different adenoviruses. We performed the infection assays, and 48 h later, the Ki67 protein expression was analyzed by immunohistochemistry staining. There were no significant differences between the positive rate of Ki67 protein expression in 786‐O cells infected with G250‐Ki67, ZD55‐Ki67 and G250‐ZD55‐Ki67, but they were much lower than cells infected with G250‐EGFP and G250‐ZD55‐EGFP. The similar tropism appeared in OSRC cells. As for ACHN cells, in the ZD55‐Ki67 treated group, there was lower Ki67 protein expression than other treated groups. And there were no significant difference in HK‐2 cells among these treated groups (Fig. 3).

Figure 3.

Figure 3

The expression of Ki67 protein in human renal carcinoma cells. 786‐O, OSRC, ACHN and HK‐2 cells were infected with G250‐EGFP, ZD55‐EGFP, G250‐Ki67, ZD55‐Ki67, G250‐ZD55‐EGFP and G250‐ZD55‐Ki67 at an multiplicities of infection (MOI) of 10 respectively. After 48 h, lysates from infected cells were subjected to immunohistochemical analysis for protein. In 786‐O cells the expression of each treatment group were: G250‐EGFP (58.27 ± 2.46%), G250‐Ki67 (36.59 ± 1.78%), G250‐ZD55‐EGFP (56.97 ± 3.71%), G250‐ZD55‐Ki67 (27.03 ± 0.99%), ZD55‐Ki67 (37.22 ± 2.09%) and ZD55‐EGFP (57.01 ± 1.11%). There were significant differences between the G250‐Ki67 group and G250‐ZD55‐Ki67 group compared to the G250‐EGFP treatment group and the G250‐ZD55‐EGFP group (< 0.01). However, there was no significant difference between the G250‐Ki67 group and G250‐ZD55‐Ki67 group (> 0.05). In OSRC cells, the Ki67 mRNA expression of G250‐Ki67 (36.43 ± 1.01%), ZD55‐Ki67 (22.35 ± 0.86%) and G250‐ZD55‐Ki67 (35.89 ± 1.46%) treatment group were lower than G250‐ZD55‐EGFP (42.76 ± 1.23%), ZD55‐EGFP (43.98 ± 1.36%) and G250‐EGFP (43.24 ± 2.75%) compared to the control (< 0.01). As for ACHN cells, in the ZD55‐Ki67 treated group, there was lower Ki67 protein expression than other treated groups. There were no significant differences between all the treatment groups in HK‐2 cells (> 0.05).

Both the mRNA and protein expression of Ki67 in cells infected with G250 promoter‐controlled carrying Ki67 siRNA adenoviruses were decreased in 786‐O and OSRC cells. These results showed that G250 promoter‐controlled adenoviruses had a higher selectivity in G250 antigen‐positive tumor cell lines.

Cytotoxic effect of oncolytic adenovirus on renal carcinoma cells

The cytotoxic effects of oncolytic adenovirus on 786‐O, OSRC, ACHN and HK‐2 cells were investigated by crystal violet staining. Cells were infected with G250‐based CRAds G250‐Ki67, G250‐ZD55‐Ki67, G250‐EGFP or G250‐ZD55‐EGFP at a MOI of 100, 10, 1, 0.1 and 0.01. Five days later, cells were stained with crystal violet. As shown in Figure 4, 786‐O cells were completely killed infected with each virus at a MOI of 100. Ten multiplicities of infection of G250‐ZD55‐Ki67 and G250‐Ki67 had always killed most of the 786‐O cells. In OSRC cells, G250‐ZD55‐Ki67 and G250‐Ki67 could only kill them partially at MOI of 100. All viruses had no lethal effect on ACHN and HK‐2 cells even at a MOI of 100.

Figure 4.

Figure 4

Tumor‐selective cytopathic effect of oncolytic virus. 786‐O, OSRC, ACHN and HK‐2 cells were seeded in 24‐well plates at a density of 1 × 104 cells for each well and infected with G250‐EGFP, G250‐Ki67, G250‐ZD55‐EGFP and G250‐ZD55‐Ki67 at the indicated multiplicities of infection (MOIs). Seven days later, cells were stained with crystal violet.

Effect of oncolytic adenovirus on cell proliferation in renal carcinoma cells

The tumor‐suppressing ability of G250‐based CRAds was assessed in vitro by MTT assay. All viruses had an inhibition effect on 786‐O cells and OSRC cells, and this inhibition was stronger on 786‐O cells than that on OSRC cells; however, G250 promoter controlled virus had no effect on ACHN cells and normal HK‐2 cells (Fig. 5). We also found that the inhibition effect of all viruses was dose‐dependent (data not shown).

Figure 5.

Figure 5

Effect on the proliferation of the human renal carcinoma cells. The cell proliferation inhibition effect of each virus on 786‐O increased as time went by, and the effect reached a peak at 96 h (< 0.05). Furthermore, the effects of G250‐ZD55‐Ki67 and G250‐Ki67 were stronger than that of G250‐EGFP and G250‐ZD55‐EGFP (< 0.05). The proliferation inhibition effect of the virus on OSRC cells was similar to the 786‐O cells; however, the effects were weaker than they were on 786‐O cells (< 0.05). All treatment groups demonstrated a scarce effect on ACHN cells as time went by, and there were no significant differences between the groups (> 0.05). The results of effects on HK‐2 cells were the same as ACHN cells (> 0.05).

In vitro replication ability in renal carcinoma cells

Efficient viral replication and high progeny production can greatly contribute to the antitumor capacity of CRAds. In order to detect the propagation of G250 promoter‐derived oncolytic adenovirus, here we studied the TCID50 assays at the indicated time points. 786‐O, OSRC, ACHN and HK‐2 cells were infected with G250 promoter‐based adenoviruses or a non‐replicative adenovirus carrying Ki67siRNA, Ad‐Ki67. As shown in Figure 6, the G250 promoter‐derived oncolytic adenovirus infected 786‐O, OSRC could produce high titers of viral progenies than the non‐replicative Ad‐Ki67. However, in ACHN and HK‐2 cells infected with these viruses, the replication ability decreased much lower.

Figure 6.

Figure 6

Replication of G250‐drived adenoviruses carrying Ki67 siRNA. Cells were infected with G250‐Ki67, G250‐ZD55‐Ki67 or Ad‐Ki67 (a non‐replicative adenovirus carrying Ki67siRNA) at an multiplicity of infection (MOI) of 10. After 2 days incubation, cells were lysed though three cycles of freeze and thaw. The titers of viral progenies were quantified on HEK293 cells with the TCID50 method. The replication multiples of adenovirus in the tested cells were equal to viral progeny titers at 48 h normalized with that at the beginning of infection.

Antitumor efficacy of G250‐Ki67 on renal carcinoma xenografts in nude mice

In order to investigate the effects of G250‐ZD55‐Ki67 treatment on tumor growth in vivo, 786‐O cells were injected subcutaneously into nude mice and four groups received G250‐ZD55‐Ki67, G250‐ZD55‐EGFP, Ad‐Ki67 (non‐replicative adenovirus carrying Ki67siRNA), and PBS intratumoral injection. After 7 weeks, all of the mice were killed and tumors were resected. In the PBS control group, tumors displayed rapid and continued outgrowth during the course of the experiment, and the mean tumor size was 2587.53 ± 776.84 mm3. The mean tumor size of the G250‐ZD55‐Ki67 treatment group was 320.24 ± 110.43 mm3, much smaller than that of the G250‐ZD55‐EGFP treatment group (1280.55 ± 386.71 mm3) and the Ad‐Ki67 treatment group (1436.54 ± 443.32 mm3). Tumor growth volume curve showed that animals treated with G250‐ZD55‐Ki67 exhibited a significant suppression of tumor development than G250‐ZD55‐EGFP and Ad‐Ki67 (Fig. 7a).

Figure 7.

Figure 7

The ability of G250‐ZD55‐Ki67 to inhibit the growth of renal cancer cell 786‐O xenografts in nude mice. (a) Tumor growth in mice was documented after injection of phosphate‐buffered saline (PBS), G250‐ZD55‐Ki67, G250‐ZD55‐EGFP and Ad‐Ki67 into tumor xenografts. (b,c) Histological analysis of tumor sections in treated groups. (b) Immunohistochemical staining for Ki67 protein in tumor sections (brown staining); (c) immunohistochemical staining for E1A protein in tumor sections (brown staining). (d) Western blotting detected the E1A expression in lysed tumor cells. (e) Apoptotic cells in tumor sections were analyzed by terminal deoxynucleotidyl transferase‐mediated dUTP nick end labeling (TUNEL) staining.

Ki67 protein and E1A protein expression in renal carcinoma xenografts in nude mice

To verify the therapeutic effect of G250‐ZD55‐Ki67 in vivo, we also analyzed the expression of Ki67 and E1A by immunohistochemistry. Tumors were frozen and used for immunohistochemical analysis. As shown in Figure 7(b), Ki‐67 staining showed a marked reduction of Ki‐67‐positive cells in G250‐ZD55‐Ki67‐treated group (126.57 ± 4.46), compared to Ad‐Ki67 (238.54 ± 7.73), G250‐ZD55‐EGFP (275.42 ± 6.45) and PBS (323.75 ± 8.56), according to IOD values calculating by the IPP image analysis software. The results demonstrated that G250‐ZD55‐Ki67 suppressed the Ki‐67 expression more potently than Ad‐Ki67 and G250‐ZD55‐EGFP, whereas G250‐ZD55‐EGFP had only a mild effect in reducing Ki‐67 expression than the PBS treatment. Moreover, as shown in Figure 7(c), E1A expressions were detected in the G250‐ZD55‐Ki67 and G250‐ZD55‐EGFP treatment groups but not in Ad‐Ki67 and PBS treatment groups, which indicated that G250‐ZD55‐Ki67 and G250‐ZD55‐EGFP could replicate in tumor cells. We also extracted the protein by homogenating tumor tissue in liquid nitrogen, and Western blot showed the same results of E1A protein expression detected by immunohistochemistry staining (Fig. 7d).

Apoptosis induced by Ki67 siRNA in xenograft tumors

Apoptotic cells in tumor sections were analyzed by TUNEL staining. TUNEL staining showed markedly more positive cells in the G250‐ZD55‐Ki67 group, the apoptosis rate (apoptosis cells/total cells) was 65.32 ± 3.24%, which were more significant than in the control groups with PBS (3.78 ± 1.64%) and the other two treatment groups, for G250‐ZD55‐EGFP (27.25 ± 1.10%), Ad‐Ki67 (31.43 ± 2.57%) (Fig. 7).

Discussion

Tumor‐specific promoters are used to control viral regulatory genes, such as adenoviral E1A, to restrict the replication of oncolytic adenoviruses to malignant cells and tissues.24 In this study, we explored that the G250 promoter could regulate E1A expression and viral replication, confer tumor‐specific replication oncolytic adenovirus and enable transcriptional targeting of renal cell carcinoma cell lines. Significantly, we found that G250 mRNA was expressed to some extent in the human renal carcinoma cell lines we tested, but not in normal cells. Consistent with the G250 expression data, we confirmed that the G250 promoter is highly activated in these human renal cell carcinoma cell lines. We also found that Ki67 mRNA was expressed to some extent in all of the three human renal cell carcinoma cell lines we tested, indicating that they were susceptible to adenoviral infection. Our previous experiments illustrated that the renal carcinoma cells transfected with Ki‐67 siRNA could result in inhibiting proliferation and inducing apoptotic cell death, this evidenced that Ki‐67 was a potent target gene for renal cell carcinoma gene therapy.20, 21

We proceeded to develop an E1B55kD deleted oncolytic adenovirus with the E1A gene controlled by the G250 promoter, armed with the Ki67‐siRNA gene, based on the data mentioned above. This G250‐regulated virus (G250‐ZD55‐Ki67) demonstrates tumor cell‐specific replication and cytotoxicity as well as potent therapeutic efficacy against renal carcinoma cells in vitro and in vivo.

In this study, the oncolytic adenovirus G250‐ZD55‐Ki67 had double the targeted potency of replication in renal carcinoma cells, and Ki67‐siRNA could reduce the cell expression of Ki67 mRNA and Ki67 protein, thus inhibition of cell proliferation and promote apoptosis. The difference between G250‐Ki67 and G250‐ZD55‐Ki67 was that E1B55kD was deleted in G250‐ZD55‐Ki67. There was high expression of the G250 promoter in 786‐O renal cancer cells; the expression of G250 promoter in the OSRC cells was lower, while there were no G250 promoter expressions in ACHN cells and normal renal tubular epithelial cells HK‐2. So the expression of E1A protein could be detected in RCC 786‐O and OSRC cells; however, G250 promoter controlled oncolytic adenovirus could not express the E1A protein in ACHN cells, the results indicate that the G250 promoter controlled oncolytic adenovirus possessed the specificity targeted to G250 positive renal carcinoma cells. In the normal HK‐2 cells, the E1A protein expression could not be detected proved the security of oncolytic adenovirus. In 786‐O cells infected with G250‐Ki67 and G250‐ZD55‐Ki67, the expression of Ki67 mRNA were 35.13 ± 2.01% and 36.61 ± 3.06%, compared with the control group. However, the expression of Ki67 mRNA in 786‐O cells infected with G250‐ZD55‐EGFP and G250‐EGFP was 97.12 ± 1.73% and 96.32 ± 1.79%. Compared with the control, in OSRC cells infected with G250‐Ki67 and G250‐ZD55‐Ki67, the Ki67 mRNA expression was 76.11 ± 3.52% and 77.58 ± 4.68%, obviously lower than the expression of cells infected with G250‐ZD55‐EGFP and G250‐EGFP, in which the expressions were 97.51 ± 1.95% and 97.81 ± 2.41%, respectively. The Ki67 mRNA expressions in ACHN cells infected with G250‐ZD55‐Ki67, G250‐ZD55‐EGFP, G250‐Ki67 and G250‐EGFP, were 94.19 ± 2.57%, 96.82 ± 0.65%, 95.92 ± 0.86% and 97.89 ± 1.17%, respectively, compared to controls. There were no differences of the Ki67 mRNA expression in HK‐2 cells treated with different viruses compared with the control. We detected the effects of proliferation inhibition and apoptosis induced by G250‐ZD55‐Ki67 and G250‐Ki67, with the results showing that the effects were stronger on 786‐O cells than on OSRC cells. However, the adenovirus almost showed no effects on ACHN cells and there were no differences between the G250‐ZD55‐Ki67 and G250‐Ki67. The effects of adenovirus on renal carcinoma cells attenuated with the decrease of G250 promoter expressions, which coincided with our expectation. Compared to G250‐EGFP, the oncolytic adenovirus arming Ki67‐siRNA manifested stronger potency of inhibition of cell proliferation and promoted apoptosis, thus, the results testified that the effects of Ki67‐siRNA were fully exploited. There was no significant difference between the activity of G250 promoter and wild adenovirus promoter.

The tumor growth inhibition curve indicated that the oncolytic adenovirus could effectively inhibit the growth of xenograft in nude mice; however, the xenograft could not be eliminated totally only by oncolytic adenovirus. Currently there are two ways for this problem: the first way is combination of the oncolytic adenovirus with chemotherapy or radiotherapy, and the anti‐tumor activities of chemotherapy or radiotherapy can be strengthened by oncolytic adenovirus. The other way is to insert anti‐tumor gene into the adenovirus vector, enforcing the ability of oncolytic adenovirus to kill tumor cells. The oncolytic adenovirus will replicate in tumor cells and kill them through the lytic replication cycle, and this effect can be enhanced by expressing anti‐cancer therapeutic molecules.22 Here, we selected Ki67 as the target gene for anti‐tumor, the oncolytic adenovirus expressed Ki767siRNA, which was under the control of G250 promoter, thus ensuring no harm was done to the normal surrounding cells. Furthermore, we consider the construction of oncolytic adenovirus expressing two anti‐cancer therapeutic molecules, one to induce cell apoptosis and another to inhibit tumor angiogenesis. Recent reports showed that oncolytic adenovirus armed with two transgenes could eradicate xenograft.25, 26

In conclusion, we have engineered a novel oncolytic adenovirus with the E1A gene controlled by the G250 promoter, the adenovirus displays improved oncolysis in G250 positive renal carcinoma 786‐O cell line compared with the G250 lower expression renal carcinoma OSRA cell line, and the adenovirus displays no oncolysis effects on G250 negative renal carcinoma ACHN cell line and normal renal tubular epithelial cells HK‐2. The results indicated that the G250 promoter regulated adenovirus had the potential to specifically target renal clear cell carcinoma cell population. Our results testified that the G250 promoter controlled oncolytic adenovirus expressing Ki67‐siRNA and showed potent growth inhibition effects on renal clear cell carcinoma xenografts in nude nice. This provides a deeper theoretical basis for further research of cancer viral‐gene therapy.

Disclosure Statement

The authors have no conflict of interest.

Acknowledgments

This project is supported by grants from the National Natural Science Foundation of China (Nos 30972976, 81071854, 81101702), the Science and Technology Department of Jiangsu province (Nos BK2009091, BK2009089, BK2011207) and the Science Foundation of Xuzhou Medical College (No. 2010KJZ04).

(Cancer Sci, doi: 10.1111/j.1349‐7006.2012.02380.x, 2012)

References

  • 1. Ries SJ, Brandts CH. Oncolytic viruses for the treatment of cancer: current strategies and clinical trials. Drug Discov Today 2004; 9: 759–68. [DOI] [PubMed] [Google Scholar]
  • 2. Jakubczak JL, Ryan P, Gorziglia M et al An oncolytic adenovirus selective for retinoblastoma tumor suppressor protein pathway‐defective tumors: dependence on E1A, the E2F‐1 promoter, and viral replication for selectivity and efficacy. Cancer Res 2003; 63: 1490–9. [PubMed] [Google Scholar]
  • 3. Rodriguez R, Schuur ER, Lim HY, Henderson GA, Simons JW, Henderson DR. Prostate attenuated replication competent adenovirus (ARCA) CN706: a selective cytotoxic for prostate‐specific antigen‐positive prostate cancer cells. Cancer Res 1997; 57: 2559–63. [PubMed] [Google Scholar]
  • 4. Hallenbeck PL, Chang YN, Hay C et al A novel tumor‐specific replication‐restricted adenoviral vector for gene therapy of hepatocellular carcinoma. Hum Gene Ther 1999; 10: 1721–33. [DOI] [PubMed] [Google Scholar]
  • 5. Ramachandra M, Rahman A, Zou A et al Re‐engineering adenovirus regulatory pathways to enhance oncolytic specificity and efficacy. Nat Biotechnol 2001; 19: 1035–41. [DOI] [PubMed] [Google Scholar]
  • 6. Yu DC, Sakamoto GT, Henderson DR. Identification of the transcriptional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res 1999; 59: 1498–504. [PubMed] [Google Scholar]
  • 7. Kubo S, Kawasaki Y, Yamaoka N et al Complete regression of human malignant mesothelioma xenografts following local injection of midkine promoter‐driven oncolytic adenovirus. J Gene Med 2010; 12: 681–92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Blok VT, Daha MR, Tijsma O et al A bispecific monoclonal antibody directed against both the membrane‐bound complement regulator CD55 and the renal tumor‐associated antigen G250 enhances C3 deposition and tumor cell lysis by complement. J Immunol 1998; 160: 3437–43. [PubMed] [Google Scholar]
  • 9. Lam JS, Pantuck AJ, Belldegrun AS, Figlin RA. G250: a carbonic anhydrase IX monoclonal antibody. Curr Oncol Rep 2005; 7: 109–15. [DOI] [PubMed] [Google Scholar]
  • 10. Luiten RM, Coney LR, Fleuren GJ, Warnaar SO, Litvinov SV. Generation of chimeric bispecific G250/anti‐CD3 monoclonal antibody, a tool to combat renal cell carcinoma. Br J Cancer 1996; 74: 735–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Duan Y, Zheng J, Han S et al A tumor targeted gene vector modified with G250 monoclonal antibody for gene therapy. J Control Release 2008; 127: 173–9. [DOI] [PubMed] [Google Scholar]
  • 12. van den Jongmans W, Oudenalder K, Tiemessen DM et al Targeting of adenovirus to human renal cell carcinoma cells. Urology 2003; 62: 559–65. [DOI] [PubMed] [Google Scholar]
  • 13. Gerdes J, Schwab U, Lemke H, Stein H. Production of a mouse monoclonal antibody reactive with a human nuclear antigen associated with cell proliferation. Int J Cancer 1983; 31: 13–20. [DOI] [PubMed] [Google Scholar]
  • 14. Beresford MJ, Wilson GD, Makris A. Measuring proliferation in breast cancer: practicalities and applications. Breast Cancer Res 2006; 8: 216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Liu E, Telem DA, Warner RR, Dikman A, Divino CM. The role of Ki‐67 in predicting biological behavior of goblet cell carcinoid tumor in appendix. Am J Surg 2011; 202: 400–3. [DOI] [PubMed] [Google Scholar]
  • 16. Ali HR, Dawson SJ, Blows FM et al A Ki67/BCL2 index based on immunohistochemistry is highly prognostic in ER‐positive breast cancer. J Pathol 2012; 226: 97–107. [DOI] [PubMed] [Google Scholar]
  • 17. Yerushalmi R, Woods R, Ravdin PM, Hayes MM, Gelmon KA. Ki67 in breast cancer: prognostic and predictive potential. Lancet Oncol 2010; 11: 174–83. [DOI] [PubMed] [Google Scholar]
  • 18. Vaisanen A, Kuvaja P, Kallioinen M, Turpeenniemi‐Hujanen T. A prognostic index in skin melanoma through the combination of matrix metalloproteinase‐2, Ki67, and p53. Hum Pathol 2011; 42: 1103–11. [DOI] [PubMed] [Google Scholar]
  • 19. Howell SJ, Wardley AM, Armstrong AC. Re: Ki67 index, HER2 status, and prognosis of patients with luminal B breast cancer. J Natl Cancer Inst 2009; 101: 1730. [DOI] [PubMed] [Google Scholar]
  • 20. Zheng JN, Ma TX, Cao JY et al Knockdown of Ki‐67 by small interfering RNA leads to inhibition of proliferation and induction of apoptosis in human renal carcinoma cells. Life Sci 2006; 78: 724–9. [DOI] [PubMed] [Google Scholar]
  • 21. Zheng JN, Sun YF, Pei DS et al Anti‐Ki‐67 peptide nucleic acid affects the proliferation and apoptosis of human renal carcinoma cells in vitro . Life Sci 2005; 76: 1873–81. [DOI] [PubMed] [Google Scholar]
  • 22. Toth K, Wold WS. Increasing the efficacy of oncolytic adenovirus vectors. Viruses 2010; 2: 1844–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. O'Shea CC. Viruses – seeking and destroying the tumor program. Oncogene 2005; 24: 7640–55. [DOI] [PubMed] [Google Scholar]
  • 24. Doloff JC, Jounaidi Y, Waxman DJ. Dual E1A oncolytic adenovirus: targeting tumor heterogeneity with two independent cancer‐specific promoter elements, DF3/MUC1 and hTERT. Cancer Gene Ther 2011; 18: 153–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Zhang Z, Zou W, Wang J et al Suppression of tumor growth by oncolytic adenovirus‐mediated delivery of an antiangiogenic gene, soluble Flt‐1. Mol Ther 2005; 11: 553–62. [DOI] [PubMed] [Google Scholar]
  • 26. Liu XY, Qiu SB, Zou WG et al Effective gene‐virotherapy for complete eradication of tumor mediated by the combination of hTRAIL (TNFSF10) and plasminogen k5. Mol Ther 2005; 11: 531–41. [DOI] [PubMed] [Google Scholar]

Articles from Cancer Science are provided here courtesy of Wiley

RESOURCES