Abstract
This study reports longitudinal viral RNA loads from the nasopharynx/throat in patients with mild and severe/critical coronavirus disease 2019 (COVID-19). We also investigated whether the duration of symptoms correlated with the duration of viral RNA shedding. A total of 56 patients were included. The highest viral loads occurred early after onset of symptoms. Neither the viral RNA loads in the upper respiratory tract nor the time to viral RNA clearance differed between patients with mild or severe/critical disease. There was a moderate correlation between number of days with symptoms and number of days with viral RNA shedding in patients with mild COVID-19.
Keywords: SARS-CoV-2, viral shedding, nasopharynx, COVID-19
The main finding of this study is that the viral RNA loads in the upper respiratory tract and the time to viral RNA clearance were in the same range for patients with mild or severe/critical coronavirus disease 2019.
Coronavirus disease 2019 (COVID-19) is an acute respiratory tract infection caused by a novel coronavirus, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Similar to influenza, the nasopharyngeal viral load of SARS-CoV-2 is highest at the time of presentation [1]. A previous study found that patients with severe COVID-19 have higher viral loads and shed viral RNA longer from the throat and nasopharynx than those with mild disease [2], and the authors suggested that nasopharyngeal levels of SARS-CoV-2 RNA might be used to assess disease severity and prognosis. We here report longitudinal viral loads in upper respiratory specimens from patients with mild COVID-19 and patients with severe/critical COVID-19. In addition, we have investigated whether the duration of symptoms correlates with the duration of viral RNA shedding in patients with mild COVID-19.
MATERIALS AND METHODS
Participants were recruited from the Department of Infectious Diseases, Sahlgrenska University Hospital, Gothenburg, Sweden, between 25 February and 23 April 2020. Severe/critical patients were defined as those requiring invasive mechanical ventilation or high-flow nasal oxygen and mild as those not requiring supplementary oxygen or hospitalization. The diagnosis of COVID-19 was made by real-time polymerase chain reaction (PCR) at the Department of Clinical Microbiology, Sahlgrenska University Hospital, Gothenburg, Sweden. Viral load, expressed as log10 of viral RNA per swab, was calculated as (47 – observed cycle threshold value) / 3.4. This formula applies the average of the parameters (slope and constant) that we observe when we quantify viruses in serum using quantitative PCR with serial dilution of quantification standards (plasmid carrying target sequence) and presumes a 10-µL sample volume in the reaction and a 97% efficiency in the PCR. We collected serial upper respiratory tract samples (1 nasopharyngeal swab and 1 throat swab put in a single collection tube with 1 mL of transport medium) for real-time PCR of SARS-CoV-2 RNA for all patients. Nucleic acids were extracted from 200 µL of sample in a Magnapure instrument (Roche Molecular, Branchburg, New Jersey), and 10 µL of the purified sample was used for 1-step reverse-transcription PCR in a QuantStudio 6 real-time PCR instrument. After 30 minutes of reverse transcription at 46°C, 45 cycles of amplification with 58°C annealing temperature were performed, using RdRP_F, GTCATGTGTGGCGGTTCACT and RdRP_R, CAACACTATTAGCATAAGCAGTTGT as primers, and RdRP_P, CAGGTGGAACCTCATCAGGAGATGC as fluorescent hydrolysis probe.
The date of disease onset was defined as the day when the first symptoms of COVID-19 were observed. For individuals with mild COVID-19, we also longitudinally recorded clinical symptoms (cough, fever >37.5°C, sore throat, rhinitis, and muscle pain). Patients with severe/critical COVID-19 were not included in this part as it was not possible to determine the duration of symptoms for those in this group who were sedated and in need of mechanical ventilation.
The study protocol was approved by the Swedish Ethical Review Authority (Dnr: 2020-01771) and patients were included after informed consent.
RESULTS
A total of 56 adult participants were included in the study. Of those with mild disease, 24 of 39 were female (median age, 43 years [range, 19–71 years]). Among patients with severe/critical COVID-19, 16 of 17 were male (median age, 52 years [range, 46–81 years]). Three of the patients with severe/critical COVID-19 died during the study period, on days 21, 26, and 31 after onset of symptoms. A total of 328 (mean, 5.9 [range, 2–12]) nasopharyngeal and throat swabs were collected.
The highest viral loads were observed early after onset of symptoms in both groups of participants (Figure 1A and 1B). At 7 days, mean viral load among virus-positive patients was 5.8 log10 copies/swab for those with mild disease (n = 37) and 5.5 log10 copies/swab for those with severe/critical disease (n = 12) (P = .53). At 14 days, mean viral load was 4.4 log10 copies/swab for those with mild disease (n = 38) and 4.2 log10 copies/swab for those with severe/critical disease (n = 14) (P = .56). Linear interpolation was used when samples were not taken on exactly days 7 and 14, using the values measured on the closest days just before and after, to estimate the values on days 7 and 14.
Figure 1.
Viral load in nasopharyngeal and throat swabs in patients with coronavirus disease 2019 (COVID-19). Longitudinal viral loads for 39 patients with mild disease (A) and 17 with severe/critical disease (B). Dotted lines mark the detection limit of the polymerase chain reaction assay. C, Kaplan–Meier curve indicates time to viral RNA clearance for those with mild and severe/critical COVID-19.
Neither the viral loads in nasopharynx and throat nor the time to viral RNA clearance differed between patients with mild or severe/critical disease (Figure 1A and 1B). The median duration of viral RNA shedding was 24.0 days in patients with mild disease and 22.5 days in patients with severe/critical disease (Figure 1C).
We recorded clinical symptoms for 34 of the 39 participants with mild disease. Follow-up was done by regular phone calls. The most common presenting symptom was cough and fever, both occurring in 27 of 34 participants (79%), followed by muscle pain in 22 (65%), rhinitis in 20 (59%), and sore throat in 16 (47%). There was a moderate correlation between number of days with symptoms and number of days with viral RNA shedding (Pearson r = 0.34; P = .05) (Supplementary Figure). Most participants (26/34) continued to be positive for SARS-CoV-2 RNA in the upper respiratory tract after the resolution of symptoms; 20 (59%) were PCR positive for >2 days after symptoms had resolved, 12 (35%) for >7 days, and 10 (29%) for >14 days.
Discussion
We found that the SARS-CoV-2 viral RNA loads from nasopharynx and throat were as high among individuals with mild disease as those with severe/critical disease and that there were no significant differences between the 2 groups with regard to duration of viral RNA shedding from the upper respiratory tract. These findings are both in agreement and disagreement with previous studies.
Similar to our results, previous studies, most of them small, have reported that the viral loads in the upper respiratory tract peak at the time of, or early after, onset of symptoms [1–6]. High initial viral loads in the upper respiratory tract indicate a high degree of viral RNA shedding and thereby a potential for high risk of transmission during the early stages of the disease. This pattern of viral RNA shedding is similar to influenza, but different from the Middle East respiratory syndrome and severe acute respiratory syndrome coronavirus infections, where the peak viral load usually occurs between days 7 and 10 after onset of symptoms [7, 8]. In addition, individuals with COVID-19 have been shown to shed SARS-CoV-2 viral RNA a few days prior to occurrence of symptoms [9].
There are several reports [2, 10–12] where patients with severe to critical COVID-19 have been demonstrated to have higher, in some studies much higher, viral RNA loads in the upper or lower respiratory tract compared to patients with mild to moderate COVID-19. In 1 of these studies, patients with a higher baseline viral load (at admission to hospital) were more likely to develop severe disease [11]. Based on this, it has been suggested that higher viral loads could be associated with worse clinical outcome and that the respiratory tract levels of SARS-CoV-2 RNA might be useful for estimating disease severity and prognosis. The results from our study and 2 other smaller studies [3, 7] differ from this. We did not find any correlation between disease severity and viral RNA load; SARS-CoV-2 viral RNA loads from nasopharynx and throat in patients with mild COVID-19 were as high as in those with severe/critical disease. Our findings do not therefore support using levels of SARS-CoV-2 RNA as a prognostic marker. There are several possible explanations for the conflicting results. One is that the definitions of disease severity for participants with mild as well as severe/critical disease are not the same in all studies. There are also some differences in the study populations regarding age, sex, and/or comorbidities and the sampled material (nasopharynx, throat, sputum, or saliva). In 1 study it was not possible to determine how long after disease onset the samples were taken, since only information about number of days from hospital admission to sampling was provided [10]. Finally, various interventions such as antiviral drugs and corticosteroids were used in some studies, which could possibly have had an impact on SARS-CoV-2 viral RNA levels and duration of viral RNA shedding [10, 12]. It should be noted that samples from the lower respiratory airways, such as tracheal aspirate samples or sputum, were not analyzed in our study. SARS-CoV-2 RNA levels might be higher in the lower than the upper airways, especially later in the course of infection [1, 5, 13].
In this longitudinal study, approximately half of the patients were PCR positive for SARS-CoV-2 for >20 days after onset of symptoms and there was no significant difference in time of viral RNA clearance between those with mild and severe/critical COVID-19, which is in contrast with other studies where patients with severe COVID-19 took longer to clear the virus from the upper respiratory tract than those with mild disease [2, 14].
There was a moderate correlation between number of days with symptoms and number of days with positive PCR for SARS-CoV-2 in the nasopharynx and throat. About one-third of the participants continued to test positive for SARS-CoV-2 RNA after >14 days of resolution of symptoms. The presence of viral RNA does not always, however, correlate with viability and transmissibility of virus. Live virus has been demonstrated to be easier to isolate from sputum during the first week of symptoms as compared to later on despite continuous high viral loads; after 8 days of symptoms, virus could not be isolated from any samples in 1 study [13]. In addition, the transmissibility of SARS-CoV-2 seems to be higher when exposure occurs within the first 5 days of onset of symptoms in the index case, compared to those exposed later [15].
To conclude, in this study we found that the viral load in the upper respiratory tract did not differ between individuals with mild or severe/critical COVID-19, and neither did the duration of viral RNA shedding. Our findings therefore do not support using levels of SARS-CoV-2 RNA as a prognostic marker.
Supplementary Data
Supplementary materials are available at The Journal of Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.
Notes
Acknowledgments. This work was supported by Swedish State Support for Clinical Research (ALFGBG-717531); and by the SciLifeLab/KAW National COVID-19 Research Program Project (grant number V-2020-0250).
Potential conflicts of interest. All authors: No reported conflicts of interest. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed.
REFERENCES
- 1. To KK, Tsang OT, Leung WS, et al. Temporal profiles of viral load in posterior oropharyngeal saliva samples and serum antibody responses during infection by SARS-CoV-2: an observational cohort study. Lancet Infect Dis 2020; 20:565–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Liu Y, Yan LM, Wan L, et al. Viral dynamics in mild and severe cases of COVID-19. Lancet Infect Dis 2020; 20:656–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Zou L, Ruan F, Huang M, et al. SARS-CoV-2 viral load in upper respiratory specimens of infected patients. N Engl J Med 2020; 382:1177–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Lescure FX, Boudma L, Nguyen D, et al. Clinical and virological data of the first cases of COVID-19 in Europe: a case series. Lancet Infect Dis 2020; 20:697–706. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Pan Y, Zhang D, Yang P, Poon LLM, Wang Q. Viral load of SARS-CoV-2 in clinical samples. Lancet Infect Dis 2020; 20:411–2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Peiris JS, Chu CM, Cheng VC, et al. HKU/UCH SARS Study Group Clinical progression and viral load in a community outbreak of coronavirus-associated SARS pneumonia: a prospective study. Lancet 2003; 361:1767–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Lui G, Ling L, Lai CK, et al. Viral dynamics of SARS-CoV-2 across a spectrum of disease severity in COVID-19. J Infect 2020; 81:318–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Chan JF, Lau SK, To KK, Cheng VC, Woo PC, Yuen KY. Middle East respiratory syndrome coronavirus: another zoonotic betacoronavirus causing SARS-like disease. Clin Microbiol Rev 2015; 28:465–522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Arons MM, Hatfield KM, Reddy SC, et al. Public Health–Seattle and King County and CDC COVID-19 Investigation Team Presymptomatic SARS-CoV-2 infections and transmission in a skilled nursing facility. N Engl J Med 2020; 382:2081–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Huang JT, Ran RX, Lv ZH, et al. Chronological changes of viral shedding in adult inpatients with COVID-19 in Wuhan, China [manuscript published online ahead of print 23 May 2020]. Clin Infect Dis 2020. doi:10.1093/cid/ ciaa631. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Yu X, Sun S, Shi Y, Wang H, Zhao R, Sheng J. SARS-CoV-2 viral load in sputum correlates with risk of COVID-19. Crit Care 2020; 24:170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Zheng A, Fan J, Yu F, et al. Viral load dynamics and disease severity in patients infected with SARS-CoV-2 in Zhejang province, China, January–March 2020: retrospective cohort study. BMJ 2020; 369:m1443. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Wölfel R, Corman VM, Guggemos W, et al. Virological assessment of hospitalized patients with COVID-2019. Nature 2020; 581:465–9. [DOI] [PubMed] [Google Scholar]
- 14. Fang Z, Zhang Y, Hang C, Ai J, Li S, Zhang W. Comparisons of viral shedding time of SARS-CoV-2 of different samples in ICU and non-ICU patients. J Infect 2020; 81:147–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Cheng HY, Jian SW, Liu DP, et al. Contact tracing assessment of COVID-19 transmission dynamics in Taiwan and risk at different exposure periods before and after symptom onset. JAMA Intern Med 2020; 180:1156–63 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.

