Protein/Peptide Transduction in Metanephric Explant Culture

Abstract

While gene targeting methods have largely supplanted cell/explant culture models for studying developmental processes, they have not eliminated the need for or value of such approaches in the investigator’s technical arsenal. Explant culture models, such as those devised for the metanephric kidney and its progenitors, remain invaluable as tools for screening regulatory factors involved in tissue induction or in the inhibition of progenitor specification. Thus, some factors capable of inducing tissue condensations or nephronic tubule formation in explants of metanephric mesenchyme have been identified through direct treatment of cultures rather than lengthy genetic engineering in animals. Unfortunately, renal progenitors are largely refractory to most contemporary methods for gene manipulation, including transfection and viral transduction, so the applications of explant culture have been rather limited. However, methods for protein or peptide transduction offer greatly improved efficiencies for uptake and expression/regulation of proteins within cells and tissues. Biologically active TAT- or penetratin-fusion proteins/peptides are readily taken up by most cells in metanephric explants or monolayer cultured cells (Plisov et al., J Am Soc Nephrol 16:1632–1644, 2005; Osafune et al., Development 133:151–161,2006; Wang et al., Cell Signal 22:1717–1726, 2010; Tanigawa, Dev Biol 352:58–69, 2011), allowing a direct functional evaluation of theoretically any protein, including biologically active enzymes and transcription factors, or any targeted interactive domain within a protein.

1. Introduction

The successful ectopic expression of a gene dictates not only an efficient delivery system for a variety of cell types but also strong expression of the transgene once delivered. Furthermore, it is difficult to titrate expression levels accurately with genetic constructs, and there is a nagging problem of cell transfectability especially in primary tissues. To circumvent these complications, techniques have been developed that instead efficiently deliver entire biologically active fusion proteins or peptides directly using polycationic cell-penetrating peptides (CPPs)/protein transduction domains. The HIV-1 Trans activator of Transcription (TAT) protein or Drosophila homeoprotein Antennapaedia (penetratin) contain an arginine-rich domain, which, when fused with a biologically active protein/peptide, oligonucleotide, or siRNA, greatly enhances the translocation of the fused element into virtually any mammalian cell [1]. The wide uptake spectrum is thought to result from binding of the CPP to negatively charged cell-surface proteoglycans, such as heparan sulfate-modified proteins. In the case of TAT protein, the active 11-amino acid sequence (residues 47–57) has been used to transduce not only peptides but also biologically active full-length proteins (some as large as 120 kDa) into cultured tissues and into rodents systemically following intraperitoneal injection [2, 3]. On the other hand, the 16-amino acid domain in penetratin (residues 43–58) has been applied primarily to peptide or oligonucleotide [1]. These shorter peptides, however, can be generated by direct chemical synthesis using D-amino acids, which are more resistant to proteolytic degradation within the cell and therefore tend to be significantly more active.

Uptake by cells of TAT- or other CPP-fusion proteins is a multistep process involving TAT-domain binding to cell surface molecules, such as glycans, followed by macropinocytosis, a type of actin-mediated fluid phase endocytosis that is carried out by membrane protrusions that engulf fluid surrounding the cell [4]. This event appears to be independent of glycan interactions, since TAT-protein transduction can occur in glycan-deficient cells [5]. The process then brings the TAT cargo into endosomal vesicles, which must be perturbed in some manner to allow release of the fusion protein into the cytoplasm or the nucleus for biological activity. It has been demonstrated that chemical permeabilization of endosomal membranes can induce the release of cargo/content, markedly decreasing the effective dose required for biological activity following transduction. It is this release from endosomes that appears to be the rate-limiting step in protein transduction, suggesting that activity of CPP-fusion proteins can be enhanced by endosomolytic agents.

While efforts to use protein transduction for therapeutic purposes are ongoing, the application of this technology remains fairly limited despite its apparent efficacy [6–9]. In our own studies, we have observed highly efficient uptake of a FITC-labeled Cited1 TAT-fusion protein (Fig. 1) or a rhodamine-labeled penetratin-Stat1-fusion peptide (Fig. 2). In both cases, transduction is observed in the preponderance of cells within renal progenitor explant cultures, and both reagents regulate differentiation in the transduced tissues [6, 8]. Moreover, we were able to design a peptide to specifically target Stat1 but not Stat3 transcriptional activation, and a similarly targeted Stat3 peptide that inhibited Stat3 but not Stat1 signaling, [8, 10] so these molecules can be highly specific. Finally, using this approach, it is also possible to target a particular domain within a protein and alter its ability to interact with other macromolecules at that region, thus providing a tool for biochemically dissecting a specific domain-related protein function in viable cells. For example, helix-C, a putative 13th Armadillo repeat in β-catenin, is believed to be principally responsible for its interaction with a TCF family member in activating canonical Wnt signaling. A peptide designed to target that domain completely blocks TCF-dependent transcription without apparently affecting β-catenin’s critical role in cell adhesion, since Wnt-stimulated mesenchymal cells convert to epithelial tubules despite the presence of the peptide inhibitor [9]. This approach should allow us to independently examine each functional domain within any given protein.

Fig. 1.

Full-length TAT-Cited1 is taken up by most cells in explant or monolayer cultures. Cells were nuclear stained with Hoechst 33342 or treated overnight with FITC-labeled TAT-Cited1 protein and imaged by confocal microscopy. Cells in explants of metanephric mesenchyme (upper panels) or monolayer cultures of the immortalized line Rat Inducible Metanephric Mesenchyme-18 (RIMM-18, lower panels) show a fairly uniform intracellular distribution of labeled protein. Large bright spots of labeling are surface precipitates

Fig. 2.

A 26-amino acid penetratin-Stat1 fusion peptide readily permeates and is taken up by cells in cultured tissue explants. Cells were nuclear stained with DAPI or treated for 3 h with a rhodamine-labeled penetratin peptide and imaged by confocal microscopy. Cells in explants of intact metanephric mesenchymes (upper panels) or ureteric buds (lower panels) incorporated labeled peptide in virtually all cells, although labeling was most prominent in cells at the tissue periphery

Production of TAT proteins is generally accomplished by expression in and purification from bacterial cultures, and protocols are well described by the developer of this technology, Steven Dowdy [2]. The advantages of this approach have already been described, and its application seems virtually unlimited, as both nuclear and cytoplasmic proteins have been targeted. The complications of this approach are somewhat similar to those encountered in efforts to concentrate a protein by ultrafiltration, i.e., the tendency of concentrated proteins or peptides to self-associate and precipitate, rendering them inactive. This is combated with the use of strong denaturants such as urea, which must then be removed or greatly diluted prior to tissue treatment. As Dowdy indicates, there is no single protocol for every TAT-fusion protein. Conditions must be optimized for each protein produced to ensure uptake and biological activity. We will outline the procedures that we have found useful in producing fusion proteins or peptides for explant culture studies. These tissues are quite susceptible to toxicity, so removal of bacterial contamination is critical. Furthermore, they are cultured on small-pored polycarbonate filters floated on culture medium, so tissue penetration can be a problem. This seems a greater problem for intact kidney rudiments as opposed to separated progenitors, i.e., ureteric buds or metanephric mesenchymes, as FITC-labeled peptides are restricted only from the ureteric bud in intact metanephroi (not shown). However, it would seem that even this problem can be circumvented by microinjection directly into the lumen of the ureteric bud [11].

2. Materials

2.1. Sequences for TAT Cloning

1. Forward and reverse oligonucleotide primers for gene of interest. Primers should be designed to include restriction sites that allow for proper frame reading and orientation within the vector. We have used primers for the transcriptional co-activator Cited1 as the gene of interest. Rat Cited1-Forward primer: 5’-d(GATGGTACCATGCCAACTATGTCGAGGC)-3’; Rat Cited1-Reverse primer: 5’-d(GATCTCGAGTCAGCAGCCAGAGGGAAAATC)-3’. These contain sequences that are recognized in duplex by restriction enzymes KpnI and XhoI.

2. Novex 10 % polyacrylamide/Tricine/SDS gels (Invitrogen).

3. Agarose, GenePure LE (BioExpress).

4. Ethidium bromide solution (10 mg/ml stock).

5. TE buffer: 10 mM Tris–HCl, 10 mM EDTA, pH 8.0; TAE buffer (50× stock from Quality Biological, Inc).

6. Na-acetate.

7. 5× DNA loading buffer: 80 % glycerol, 10 mM Tris–HCl, 10 mM EDTA, pH 8.0.

8. Ultrafree-DA centrifugal filter units (Millipore).

2.2. Cloning into TAT Vectors

1. pTAT and pTAT-HA vectors contain a 6× Histidine coding sequence upstream of the TAT or TAT-HA coding region followed by a polylinker region with unique cloning sites to insert genetic sequences of interest. These vectors were obtained from Stephen F. Dowdy (Howard Hughes Medical Institute and Department of Cellular and Molecular Medicine, University of California, San Diego School of Medicine, La Jolla, CA 92093-0686).

2. 10× Multicore buffer (Promega).

3. Various restriction enzymes for modifying PCR fragment and confirming insert identity.

4. DNA ligase.

5. 2× Rapid Ligation Buffer (Promega).

6. Calf intestinal alkaline phosphatase.

7. Escherichia coli strain TOP10 (Invitrogen).

8. Ampicillin is dissolved in distilled water at 100 mg/ml (1,000× stock) and stored frozen.

9. LB medium is prepared using 25 g powdered LB mix (Sigma) dissolved in 1 l distilled water and autoclaved. For selection, ampicillin is added to cooled medium to a final concentration of 100 μg/ml.

10. LB agar plates are prepared from 35 g powdered LB agar (Sigma) dissolved in 1 l distilled water and autoclaved. Add ampicillin as above for selection.

11. Super Optimal Catabolite (SOC) medium (Invitrogen).

12. T7 forward primer: 5’-d(TAATACGACTCACTATAGG)-3’.

13. Qiagen Qiaprep Spin MiniPrep kit.

2.3. Bacterial Production of Fusion Protein

1. l-arabinose.

2. Escherichia coli strains BL21(DE), BL21 Star™ (DE3)pLysS cells [F-ompT hsdSB(rB–, mB–) gal dcm rne131 (DE3) pLysS (CamR)], and BL21-AI™ F-ompT hsdSB(rB–, mB–) gal dcm araB::T7RNAP-tetA (Invitrogen).

3. Denaturing Buffers: 8 M urea, 100 mM NaCl, 10 mM imidazole, and 20 mM HEPES, pH 7.4, 6.0, 5.3, or 4.0.

4. Nickel-chelating ProBond resin (Invitrogen).

5. FITC-labeling kit (Invitrogen).

3. Methods

The Methods describe the creation, expression, and purification of TAT-fusion proteins as well as the use of the TAT-fusion proteins to treat explanted metanephric progenitors. Full-length murine Cited1 cDNA is used as an example and was produced from Ell.5–12.5 mouse or E13.5–14.5 rat embryos. The pTAT-Cited1 bacterial expression vector was generated by cloning Cited1 cDNA in frame into the vector pTAT-HA (hemagglutinin antigen tag), which includes 5’-ATG-(His)×6-TAT-HA-MCS cassette to enable purification and detection of the recombinant TAT-fusion protein.

3.1 Gene Cloning into TAT Vectors

1. Gene sequences are amplified using standard RT-PCR methods from total RNA derived from E11.5–12.5 mouse or 13.5–14.5 rat embryos (see Note 1). Primers (shown in Subheading 2) include sequences that encode sites for restriction enzyme digestion. Amplified PCR fragments are prepared for insertion into a preexisting multiple cloning site by restriction digestion with enzymes KpnI and XhoI. This provides for a proper reading frame and orientation in the vector. Incubation mixes included the Cited1 PCR fragment (40 μL, ~2 μg), 10× Multicore buffer (5 μL), 10 U/μL KpnI (2 μL), and 10 U/μL XhoI (2 μL). Mixes are incubated for 3 h at 37 °C.

2. Digested fragments are then mixed with 5× DNA loading buffer and gel purified on 0.8 % agarose/TAE gel containing ethidium bromide (0.5 μg/mL).

3. Gels are run for 1 h at 100 V and visualized with UV light.

4. The appropriate band is cut from the gel with a clean scalpel or razor blade.

5. To purify the DNA fragment (~700 bp for Cited1) from the agarose, the block containing the DNA is placed in an Ultrafree®-DA filter and spun for 10 min at 2,700 × g.

6. The flow-through containing purified cDNA insert is collected and the DNA concentration determined.

7. To prepare the pTAT-HA vector for cDNA sequence insertion, it is first linearized with restriction enzymes KpnI and XhoI in the following reaction mix: pTAT-HA (10 μg), distilled water (26 μL), 10× Multicore buffer (10 μL), 10 ÛL KpnI (2 μL), and 10 μL XhoI (2 μL). This is incubated for 3 h at 37 °C.

8. The linearized vector is then isolated by precipitation with three volumes of ice-cold 100 % ethanol in the presence of 0 3 M Na-acetate, centrifuged at 21,000 × g/4 °C, washed in 70 % ethanol, and dissolved in 50 μL TE buffer.

9. The purified linearized vector is then dephosphorylated to prevent vector self-ligation. This is accomplished in the following reaction: vector (10 μg in 50 μL TE buffer), distilled water (38 μL), 10× calf intestine phosphatase buffer (10 μL), and 10 μL calf intestine phosphatase (2 μL). This is incubated for 1 h at 37 °C.

10. The enzyme is removed with phenol/chloroform extraction and ethanol precipitation, as described above and the dephosphorylated vector dissolved in 50 μL TE buffer. The vector is further gel purified in agarose to remove the short XhoI/ KpnI-generated DNA fragments as described in steps 2–6 of this section and diluted to 1 μg/10 μL in distilled water.

11. Ligation of the insert into the vector is accomplished in the following reaction mix: 1 μL (0.1 μg) of pTAT-HA from step 10 of this section, 2 μL (~0.5 μg) of PCR fragments from step 6 of this section, 5 μL of 2× Rapid Ligation Buffer, 1 μL of distilled water, and 1 μL of DNA ligase. The mix is incubated overnight at 10 °C.

3.2. Generating pTAT Constructs in E. coli Cells

1. For bacterial transformation, TOP10 chemically competent cells (50 μL) are incubated on ice for 1 h with 1 μL of the ligation mixture from step 11 in the previous section.

2. This mixture is then heat shocked at 42 °C for 45 s, returned to the ice, diluted with 1 mL SOC medium, and incubated for 1 h at 37 °C with shaking.

3. Cells are then pelleted at 10,600 × g and resuspended in 50 μL of SOC medium.

4. The suspension is plated on LB agar containing 100 μg/mL ampicillin and plates incubated at 37 °C overnight. Plates with colonies may be stored for several days at 4 °C prior to analysis.

5. For colony analysis, 10–20 colonies are selected from the plates with sterile tips and re-plated on a fresh LB-agar Master plate and labeled for later identification.

6. The remainder of each colony is resuspended in a PCR tube with 20 μL PCR mix as follows for confirmation by PCR amplification: 2 μL of 10× PCR buffer, 0.5 μL of 25 mM dNTPs, 12 μL of distilled water, 1 μL of 50 mM MgC12, 5 μL of 25 μM T7 Forward primer, 0.5 μL of 25 μM Cited1 Reverse primer, 0.05 μL of 5 U/μL Taq polymerase, and ~0.2 μL of transformed E. coli cells.

7. PCR reactions are run as described in Subheading 3.1, step 6 and analyzed according to Subheading 3.2, steps 2 and 3.

8. Colonies (2–4), which produce the appropriately sized PCR fragment (~700 bp for Cited1), are then selected from the Master plate and grown overnight in LB/Amp medium.

9. Plasmid DNA is then purified using a Qiagen Qiaprep Spin MiniPrep kit, according to the manufacturer’s instructions, analyzed with restriction enzymes (KpnI, XhoI, and others as appropriate), and sequenced to verify the identity and integrity of the plasmids.

3.3. Production and Purification of TAT-Fusion Protein

1. Mix 1 μL of 10 ng/μL TAT-Cited1 plasmid DNA with 50 μL of competent E. coli BL21-AI cells and follow the transformation protocol described above in Subheading 3.3, steps 1–4 with this new cell line (see Note 2).

2. Colonies (2–4) are selected and grown overnight in 5 mL LB/Amp at 37 °C with shaking.

3. The overnight cultures are then diluted 1/100 in LB/Amp and grown to an OD₆₀₀ that approximates 0.6–0.8 optical units against a LB blank.

4. As mentioned, BL21-AI cells require l-arabinose to induce the expression of T7 RNA polymerase and therefore TAT-Cited1 protein. To accomplish this, arabinose is added to a final concentration of 0.2 % and cultures are shaken at 37 °C for an additional 4 h.

5. Cells are then pelleted by centrifugation at 5,000 rpm for 30 min at 4 °C, resuspended, and washed in cold PBS, and again pelleted.

6. The washed pellet is resuspended and lysed in 8 mL of Denaturing Lysis Buffer (8 M urea, 20 mM HEPES, pH 7.4, 100 mM NaCl, and 10 mM imidazole). To facilitate dissociation, the suspension is also sonicated on ice, 4× for 1 min at the maximum power setting followed by a 2-min interval to cool the lysates (see Note 3).

7. Bacterial debris is removed by centrifugation (10,600 × g for 15 min) and the supernatant collected and incubated overnight with 1 mL nickel-chelating ProBond resin, which was washed with Denaturing Lysis Buffer.

8. A 1-mL slurry of resin with bound TAT fusion-protein is poured into a 10-mL column such as provided with the Invitrogen ProBond kit and washed first with 6 mL of Denaturing Lysis Buffer. The effluent should be collected in the event that the TAT-fusion protein does not bind to the column matrix.

9. The column resin is then washed 2× with 6 mL of Denaturing Wash1 Buffer (8 M urea, 20 mM HEPES, pH 6.0, 100 mM NaCl, and 10 mM imidazole) and the effluent collected from each wash.

10. The resin is further washed 2× by mixing with 4 mL Denaturing Wash2 Buffer (8 M urea, 20 mM HEPES, pH 5.3, 100 mM NaCl, and 10 mM imidazole) and the effluent collected from each wash.

11. For elution, 5 mL of Denaturing Elution Buffer (8 M urea, 20 mM HEPES, pH 4.0, 100 mM NaCl, and 10 mM imidazole) are passed through the column and collected as 1 mL fractions. 10 μL of each wash and elution fractions are analyzed in 10 % SDS-PAGE gels for quantity and purity by staining with Coomassie blue. Dowdy reported that unfolding and rapid refolding of purified TAT-fusion proteins improves protein transduction efficiency probably by unmasking the TAT-PTD domain. He recommends either desalting on a PD-10 column or elution from an HPLC ion-exchange column. To rapidly remove denaturant (urea) and salts from the TAT-Cited1 preparation, we instead precipitated the protein with ethanol.

12. For this, combine fractions containing TAT-Cited1 and precipitate protein with nine volumes of ice-cold ethanol. Keep on dry ice for 30 min. Do not allow the solution to freeze.

13. The solution is then spun at 5,000 × g for 30 min/4 °C to collect the protein, and the precipitate is washed with ice-cold 90 % ethanol and dissolved in 0.2 M NaHCO₃ , pH 5.5 for FITC labeling or phosphate-buffered saline (PBS) for use in culture.

14. The dissolved preparation in then spun for 10 min/4 °C at 21,000 × g to remove insoluble protein and quantified.

15. It is often useful to FITC-label proteins in order to assess uptake and intracellular localization. This was performed on the same preparations using a FITC-labeling reagent (Invitrogen/ Molecular Probes). For this, 100 μL of TAT-fusion protein (200 μg) in 0.2 M NaHCO₃ buffer, pH 5.5, is mixed with 20 μL of active FITC-labeling reagent (10 mg/mL DMSO) for 30 min at room temperature. To remove unincorporated label, the protein is precipitated with nine volumes of ice-cold ethanol and washed in 90 % ice-cold ethanol. Protein is solubilized in sterile PBS and stored at 4 °C for use in culture. For long-term storage, proteins should be stabilized in 10 % v/v glycerol and frozen at −80 °C in small aliquots to avoid multiple freeze-thaw cycles (see Note 4).

16. TAT-fusion proteins are generally applied to cultures (monolayer or explant) at concentrations between 0.05 and 1 μM and are often toxic at higher concentrations. Levels for should optimized though for each case (see Notes 5–7).

3.4. Penetratin Fusion Peptide Synthesis

Another approach to molecular regulation involves the targeting of specific protein-binding domains using peptidomimetics or decoys that mimic the normal binding partner of a protein [12]. It is well beyond the scope of this chapter to describe the chemical modeling that is used to rationally design these reagents. Suffice it to say that by increasing our understanding of these interactions and relationships, we also gain insight into targeting them. In our own work, we have applied structural information from X-ray crystallography and NMR studies in the design of peptides that disrupt oligomerization of the Stat protein. Specifically, we have a generated a library of cell-permeable peptides that target the 12-amino acid second α-helix of Stat1 or Stat3 [8, 10]. The peptides produced consist of the 14–16 amino acids covering helix 2 of the Stat molecule fused at the C-terminus with 16 amino acids from penetratin (residues 43–58). Since the synthesis requires instrumentation that is not readily available to most molecular biology labs, we will provide primarily experimental details sufficient for a chemistry lab. Such peptides may be custom synthesized by businesses with this expertise, for example AnaSpec.

1. Peptides are generated by solid-phase peptide synthesis on a 433A Peptide Synthesizer (Applied Biosystems) equipped with a conductivity monitoring unit utilizing Fmoc amino acid derivatives (AnaSpec). The synthesis is performed with conditional blocking of unreacted amino groups with acetic anhydride for easier purification of the resulting peptides (see Note 8).

2. Peptides are cleaved from the resin with 87.5 % trifluoroacetic acid containing 5 % water, 5 % thioanisol, and 2.5 % triisopropyl-silane (v/v), precipitated with cold diethyl ether, washed five times with ether, and lyophilized overnight.

3. Peptides are dissolved in dimethylformamide and purified by HPLC on a preparative (25 × 250 mm) Atlantis C18 reverse-phase column (Agilent Technologies) in a gradient of 0.05 % (v/v) trifluoroacetic acid in water and acetonitrile containing 0 05 % trifluoroacetic acid.

4. Fractions are analyzed by electrospray LC/MS in an Agilent 1100 series instrument (Agilent Technologies) with the use of a Zorbax 300SB-C18 Poroshell column and a gradient of 5 % acetic acid in water and acetonitrile.

5. Fractions containing more than 95 % pure product are combined and freeze-dried from 5 % acetic acid to ensure conversion into acetate salts.

6. The purity and structure are confirmed by LC/MS with separation in a Zorbax 300SB-C18 analytical column and Microsorb-MW 300A C8 (Varian) column.

7. For fluorescence labeling, purified peptides with C-terminal Cys are reacted with maleimide-tetramethylrhodamine (Invitrogen) added at 10 % excess in acetonitrile-PBS, 1:1, pH 7.2.

8. After overnight incubation at 25 °C, the reaction mixture is injected onto a preparative HPLC column and labeled peptides are purified as described above.

9. Peptides are solubilized in 100 % DMSO at 10 mM and stored at −20 °C (see Note 9).

3.5. Tissue Explantation

1. E11.5–12.5 mouse or E13.5–14.5 rat embryos from timed-mated animals are generally used for studies of the developing kidney. These periods represent the early stages of metanephric development for both species. Metanephroi can be removed from embryos during this period, and progenitor ureteric bud separated from metanephric mesenchyme if necessary.

2. Separations of metanephric progenitor populations and conditions for tissue cultivation are well described in ref. 13.

3. Tissues are placed on type IV collagen-coated 0.1 μM pore-size polycarbonate filters (see Note 10). Filters are collagen coated by soaking the surface with a concentrated solution of mouse collagen (BD Biosciences) and allowing them to dry.

4. Intact metanephroi are best cultured in Dulbecco’s modified Eagle’s medium-Ham’s F12 medium supplemented with 10 % fetal bovine serum. Separated progenitors are better maintained in serum-free or low serum (1–2 %) conditions supplemented with factors described in our previous publication shown above. Tissues are grown in a humidified incubator with 7 % CO₂ at 37 °C.

4. Notes

1. The sequence of interest from Cited1 was PCR amplified in a mix of 10× PCR buffer (2 μL), 25 mM dNTPs 0.5 μL, 50 mM MgCl2 (1 μL), distilled water (12 μL), cDNA (0.25 μg), 0.1 mM Forward primer (0.5 μL), 0.1 mM Reverse primer (0.5 μL), and 5 ϋ/μL Taq polymerase (0.05 μL). For Cited1, incubation mixes were heated to 95 °C for 3 min, and amplified using 37 cycles of 92 °C/1 min, 50 °C/1 min, and 72 °C/2 min with a final elongation step of 72 °C for 5 min.

2. To produce recombinant TAT-Cited1 fusion protein, we initially used the recommended E. coli line BR21(DE). This cell line requires isopropyl β-d-1-thiogalactopyranoside (IPTG) in the growth medium to induce expression of T7 RNA polymerase, which, in turn, drives the transcription of TAT-mRNA. The BR21(DE) cells failed to express TAT-Cited1 protein. Apparently these cells are leaky for T7 RNA polymerase expression and therefore produce some TAT-Cited1 protein even in the absence of IPTG induction. The protein was toxic for the cells expressing it and selected against their growth in culture, resulting in the overgrowth of cells that did not express it. To reduce the expression of TAT-Cited1 in cells prior to induction with IPTG, we used another E. coli cell line BR21 Star™ (DE3)pRysS. These cells express pRysS to lower the basal levels of T7 polymerase that drives expression of the target protein (TAT-Cited1). The expression of TAT-Cited1 in these cells was also poor. The only cell line that allowed strong inducible expression of TAT-Cited1 was BR21-AI™. The strain carries a chromosomal insertion of a cassette containing the T7 RNA polymerase gene in the araB locus, allowing expression of T7 RNA polymerase to be tightly regulated by the araBAD promoter, which is active only hL-arabinose is present in the growth medium. This cell line is recommended for expression of toxic genes as it provides the tightest control of T7 expression.

3. A protease inhibitor cocktail should be added to preparations especially in the absence of denaturant.

4. TAT-fusion proteins are unstable and suffer the same technical issues faced in protein purification in general. They tend to precipitate at high concentrations or with repeated freeze-thaw cycles. For this reason, preparations should be centrifuged prior to addition to culture medium, and confocal microscopy should be applied to confirm cellular uptake. Furthermore, biological activity, when possible, should be assessed after one freeze-thaw cycle

5. Uptake of TAT-fusion proteins occurs quite rapidly, often detectable within minutes of application and peaks in a matter of hours.

6. As mentioned in the Introduction, transduced proteins/peptides collect in endosomes and their release may be rate limiting in elicited a biological effect. For that reason, it may be useful to try endosomolytic agents such as Endo-Porter (Gene Tools, LLC) to facilitate their intracellular release and enhance their biological activity.

7. Because of potential toxicity, some effort should be directed to producing appropriate control reagents. These could include a TAT-fusion protein generated from a mutated biologically inactive form of the protein of interest or another protein not relevant to the biological system under investigation, e.g., β-galactosidase.

8. During the de novo synthesis of peptides with C-terminal Cys, deprotection is performed with 20 % piperidine containing 0.1 M HOBt to avoid the formation of dehydro-alanine. The synthesizer should be reprogrammed to deliver appropriate amounts of deprotection mixture composed of 0.25 M HOBt in 50 % piperidine in N-methyl-pyrrolidone.

9. Peptides are generally effective at concentrations below 1 μM. Higher levels may cause toxicity, so biological effects should be optimized by titration.

10. Larger pore-sized filters distort the visual field and prevent visualization by phase-contract microscopy.