Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Nov 17.
Published in final edited form as: Mol Reprod Dev. 2020 Aug 10;87(9):998–1008. doi: 10.1002/mrd.23409

Follistatin treatment modifies DNA methylation of the CDX2 gene in bovine preimplantation embryos

Mohamed Ashry 1,2,3, Sandeep K Rajput 1,4, Joseph K Folger 1, Chunyan Yang 5, Jason G Knott 2, George W Smith 1
PMCID: PMC7670970  NIHMSID: NIHMS1620228  PMID: 32776625

Abstract

CDX2 plays a crucial role in the formation and maintenance of the trophectoderm epithelium in preimplantation embryos. Follistatin supplementation during the first 72 hr of in vitro culture triggers a significant increase in blastocyst rates, CDX2 expression, and trophectoderm cell numbers. However, the underlying epigenetic mechanisms by which follistatin upregulates CDX2 expression are not known. Here, we investigated whether stimulatory effects of follistatin are linked to alterations in DNA methylation within key regulatory regions of the CDX2 gene. In vitro-fertilized (IVF) zygotes were cultured with or without 10ng/ml of recombinant human follistatin for 72 hr, then cultured without follistatin until Day 7. The bisulfite-sequencing analysis revealed differential methylation (DM) at specific CpG sites within the CDX2 promoter and intron 1 following follistatin treatment. These DM CpG sites include five hypomethylated sites at positions −1384, −1283, −297, −163, and −23, and four hypermethylated sites at positions −1501, −250, −243, and +20 in the promoter region. There were five hypomethylated sites at positions +3060, +3105, +3219, +3270, and +3545 in intron 1. Analysis of transcription factor binding sites using MatInspector combined with a literature search revealed a potential association between differentially methylated CpG sites and putative binding sites for key transcription factors involved in regulating CDX2 expression. The hypomethylated sites are putative binding sites for FXR, STAF, OCT1, KLF, AP2 family, and P53 protein, whereas the hypermethylated sites are putative binding sites for NRSF. Collectively, our results suggest that follistatin may increase CDX2 expression in early bovine embryos, at least in part, by modulating DNA methylation at key regulatory regions.

Keywords: bovine preimplantation embryo, CDX2, DNA methylation, follistatin

1. INTRODUCTION

Despite decades of extensive research, oocyte developmental competence remains a major limiting factor of the success of assisted reproductive technologies in humans and livestock species (Ashry & Smith, 2015; Rajput et al., 2013). Our laboratory previously demonstrated a positive association between transcript abundance of the TGFβ binding protein follistatin and developmental competence in adult (high-quality) versus prepubertal (low-quality) bovine oocytes (Patel et al., 2007). Likewise, we established a positive association between follistatin levels and oocyte quality using a brilliant cresyl blue (BCB) staining model. Follistatin transcripts were higher in BCB positive (BCB +) high-quality oocytes compared to BCB− oocytes (Ashry et al., 2015). Functional studies revealed that maternally derived follistatin is essential for early development in bovine preimplantation embryos and that exogenous follistatin supplementation during the first 72 hr of in vitro embryo culture improves the developmental capacity of bovine (Ashry et al., 2015; Ashry, Lee, Folger, Rajput, & Smith, 2018; Ashry, Rajput, et al., 2018; Lee, Bettegowda, Wee, Ireland, & Smith, 2009; Patel et al., 2007; Zhenhua et al., 2017) and Rhesus macaque embryos (VandeVoort, Mtango, Lee, Smith, & Latham, 2009). Interestingly, in vitro-produced (IVP) blastocysts derived from embryos treated with follistatin exhibit higher trophectoderm (TE) cell numbers and increased expression of caudal-type homeobox 2 (CDX2) messenger RNA (mRNA; Lee et al., 2009; Zhenhua et al., 2017).

CDX2 is a key transcription factor that is required for the formation and/or maintenance of the blastocyst TE lineage in multiple species including mice, cattle, and primates (Berg et al., 2011; Goissis & Cibelli, 2014; Sritanaudomchai et al., 2009; Strumpf et al., 2005). In bovine blastocysts, increased levels of CDX2 are associated with higher pregnancy rates after embryo transfer (El-Sayed et al., 2006). Conversely, transfer of CDX2 knockdown bovine blastocysts into surrogate females resulted in poorly elongated embryos on Day 14 of pregnancy due to reduced TE cell proliferation (Berg et al., 2011). Collectively, these experimental findings demonstrate that CDX2 is a molecular determinant of blastocyst quality and embryo elongation in cattle.

During early embryo development, CDX2 expression can be negatively controlled by epigenetic modifications such as DNA methylation (Liu et al., 2007; M.-T. Zhao, Rivera, & Prather, 2013). Methylation of cytosine residues in CpG dinucleotides is facilitated by the activity of DNA methyltransferase (DNMT) enzymes (Vassena, Dee Schramm, & Latham, 2005; Young & Beaujean, 2004). CpG methylation causes DNA to become less accessible to the transcriptional machinery, consequently preventing gene expression (Bird & Wolffe, 1999). As follistatin treatment during the initial 72 hr of culture significantly increased CDX2 transcript abundance in blastocysts, we hypothesized that follistatin augments CDX2 expression in part through changes in DNA methylation. CDX2 expression is controlled via multiple regulatory regions, including a 5′ upstream region, a proximal promoter, and an intronic enhancer (Intron 1; Benahmed et al., 2008; Wang & Shashikant, 2007). In the present study, we cultured bovine preimplantation embryos with or without a maximal stimulatory dose of follistatin (Lee et al., 2009) during the first 72 hr of culture and then at the blastocyst stage evaluated DNA methylation at key regulatory regions in CDX2. Our results indicate that the follistatin-mediated increase in CDX2 expression is associated with changes in CpG methylation that overlap key binding motifs for transcription factors implicated in CDX2 regulation.

2. RESULTS

2.1. Effects of follistatin supplementation on embryonic development and CDX2 expression in blastocysts

Consistent with our previously published results for bovine IVP embryos, follistatin supplementation (10 ng/ml) during the initial 72 hr of in vitro embryo culture resulted in a significant increase in blastocyst development on Day 7 (30.6 ± 1.05 vs. 22.1 ± 1.03%; p < .05) for follistatin-treated versus control, respectively (Figure 1a). Furthermore, the transcript abundance of CDX2 was significantly increased in Day 7 blastocysts from embryos that had been treated with follistatin, compared to untreated controls (p < .05; Figure 1b).

FIGURE 1.

FIGURE 1

Open in a new tab

Effects of follistatin supplementation on blastocyst development and CDX2 expression in early bovine embryos. Zygotes were cultured in the presence or absence of 10 ng/ml recombinant human follistatin during the initial 72 hr of in vitro culture. Then, 8–16 cell embryos were isolated, washed, and cultured in fresh media without follistatin until Day 7. (a) Percentage of embryos developing to the blastocyst stage. (b) Quantitative real-time polymerase chain reaction analysis of CDX2 abundance in blastocysts in response to follistatin treatment. Target gene mRNA expression data were normalized relative to the abundance of RPS18 as a housekeeping gene. Data are expressed as mean ± standard error of the mean. CTRL, control; FST, follistatin treatment; mRNA, messenger RNA. Values with different superscripts indicate significant differences (p < .05)

2.2. Follistatin treatment induces changes in DNA methylation at key regulatory regions in the CDX2 gene in bovine blastocysts

To investigate the effect of exogenous follistatin supplementation (10 ng/ml) on the methylation status of the CDX2 promoter we performed bisulfite-sequencing analysis. First, we searched for CpG islands within the CDX2 promoter (Figure 2) using MethPrimer software (Li & Dahiya, 2002). We identified two fragments proximal to the transcriptional start site (TSS); P1 (−1644 to −1180) and P2 (−126 to +305). For P1 and P2, the target sequences contained 27 CpG sites and 41 CpG sites, respectively (Figures 3a and 4a). The bisulfite-sequencing analysis revealed that the overall methylation status of fragment P1 was 6.2 ± 1.67% and 4.7 ± 1.32% for control and follistatin-treated groups, respectively (Figure 3b). Further analysis demonstrated that 19 CpG sites were methylated in 2.1–31.2% of the clones sequenced (Figure 3b). As described in the methods section, only CpG sites with ≥20% methylation in at least one group were analyzed by Fischer's exact test to determine if the site was differentially methylated between the treatment and control group. In fragment P1 there were five CpG sites that met this threshold for analysis, two CpG sites at positions −1384 and −1283 were hypomethylated and one CpG site at −1501 was hypermethylated in response to follistatin treatment (p < .05; Figure 3c).

FIGURE 2.

FIGURE 2

Open in a new tab

Schematic representation of the regulatory region of CDX2 gene and its CpG content (%). Three different fragments within the promoter region (fragment P1; −1644 to −1180; P2, −305 to +126) and intron 1 (fragment I +3030 to +3710) were selected for bisulfite-sequencing analysis. ATG, translation initiation codon (methionine); TSS, transcriptional start site

FIGURE 3.

FIGURE 3

Open in a new tab

Effect of follistatin on DNA methylation status of fragment P1 of CDX2 in early bovine embryos. (a) The genomic position of the target fragment. (b) DNA methylation profile of individual CpG sites within fragment P1 of the CDX2 regulatory region (−1644 to −1180) in untreated control and follistatin-treated embryos (n = 6 replicates/15 blastocysts per group). Genomic DNA was subjected to bisulfite treatment followed by PCR amplification. Each PCR product was subcloned and eight clones per replicate were sequenced. Clones are represented in rows (numbers on left represent independent replicates from which clones are derived) and CpG sites are represented in columns. The methylation status, either unmethylated (open circle) or methylated (closed circle), is indicated at each CpG site. (c) Individual CpG sites with ≥20% methylation at least in one group were analyzed by Fisher's exact test. FST, follistatin treatment; PCR, polymerase chain reaction; TSS, transcriptional start site. Values show the methylation percentage and those values marked with an asterisk are significantly different (*p < .05)

FIGURE 4.

FIGURE 4

Open in a new tab

Effect of follistatin on the DNA methylation status of fragment P2 of CDX2 in early bovine embryos. (a) The genomic position of the target fragment. (b) DNA methylation profile of individual CpG sites in CDX2 promoter (−305 to 126) in untreated control and follistatin-treated embryos (n = 6 replicates/15 blastocysts per group). Genomic DNA was subjected to bisulfite treatment followed by PCR amplification. Each PCR product was subcloned and eight clones per replicate were sequenced. Clones are represented in rows (numbers on left represent independent replicates from which clones are derived) and CpG sites are represented in columns. The methylation status, either unmethylated (open circle) or methylated (closed circle), is indicated at each CpG site. (c) Individual CpG sites with ≥20% methylation at least in one group were analyzed by Fisher's exact test. FST, follistatin treatment; PCR, polymerase chain reaction; TSS, transcriptional start site. Values show the methylation percentage and those values marked with an asterisk are significantly different (*p < .05)

For P2, the overall methylation rate was 3.6 ± 0.23% and 3 ± 0.43% for control and follistatin-treated embryos, respectively (Figure 4b). Analysis of individual CpG methylation sites revealed that only 11 CpG sites were methylated in 2.1–70.8% of the sequenced clones (Figure 4b), with six CpG sites meeting the criteria for analysis (≥20% methylation at least in one group). Statistical analysis revealed that three CpG sites at positions −279, −163, and −23 were hypomethylated and three other sites at positions −250, −243, and +20 were hypermethylated in response to follistatin supplementation (p < .05; Figure 4c).

2.3. Follistatin treatment induces changes in DNA methylation within intron 1 of the CDX2 gene in bovine blastocysts

Given that the CDX2 regulatory region in mammals encompasses the proximal promoter region and intron 1, a fragment of intron 1 was selected for bisulfite-sequencing analysis. The selected fragment (I) was 680 base pairs in length (+3030 to +3710) and contained 26 CpG sites (Figure 5a). The bisulfite-sequencing analysis revealed that its overall methylation rate was 10 ± 1.47% and 2.4 ± 1.41% for control and follistatin-treated groups, respectively (Figure 5b). Analysis of methylation of individual CpG sites showed that 22 CpG sites were methylated in the 2.1–58.3% clones sequenced, with six CpG sites meeting the threshold for analysis, ≥20% methylation at least in one group (Figure 5b). Five of these CPG sites were hypomethylated at positions +3060, +3105, +3219, +3270, and +3545 in response to follistatin treatment (p < .05; Figure 5c).

FIGURE 5.

FIGURE 5

Open in a new tab

Effect of follistatin on the DNA methylation status of fragment I of CDX2 in early bovine embryos. (a) The genomic position of the target fragment. (b) DNA methylation profile of individual CpG sites in intron 1 of the CDX2 regulatory region (+3030 to +3710) in untreated control and follistatin-treated embryos (n = 6 replicates/15 blastocysts per group). Genomic DNA was subjected to bisulfite treatment followed by PCR amplification. Each PCR product was subcloned and eight clones per replicate were sequenced. Clones are represented in rows (numbers on left represent independent replicates from which clones are derived) and CpG sites are represented in columns. The methylation status, either unmethylated (open circle) or methylated (closed circle), is indicated at each CpG site. (c) Individual CpG sites with ≥20% methylation at least in one group were analyzed by Fisher's exact test. FST, follistatin treatment; PCR, polymerase chain reaction; TSS, transcriptional start site. Values show the methylation percentage and those values marked with an asterisk are significantly different (*p < .05)

2.4. Potential association between differentially methylated CpG sites and putative binding sites for transcription factors that may regulate CDX2 expression

DNA methylation can interfere with the binding of transcription factors, either by directly inhibiting binding (Iguchi-Ariga & Schaffner, 1989) or indirectly by recruiting a methyl DNA binding protein that acts as a barrier (Boyes & Bird, 1991). We hypothesized that differentially methylated CpGs within the CDX2 promoter and intron 1 were enriched with binding sites for key transcription factors required for CDX2 expression. To test this hypothesis, we used MatInspector software to search for transcription factor binding motifs present in fragments P1 and P2, and intron 1 of the CDX2 gene. In addition, we performed a literature search on the function of those transcription factors. This analysis revealed the presence of several binding sites for key transcription factors implicated in CDX2 regulation. In fragment P1 derived from follistatin-treated embryos, there were putative binding sites for farnesoid X receptor (FXR) and a sequence-specific zinc finger protein (STAF) that were located proximal to hypomethylated CpGs. Most interestingly in fragment P2 there were three CpG sites that were hypomethylated and three sites that were hypermethylated in response to follistatin treatment. The hypomethylated CpGs contained putative binding sites for octamer-binding transcription factor 1 (OCT1), activating enhancer-binding protein 2 family (AP2F), and p53 protein. Of the three sites that were hypermethylated, there were binding sites for neuron-restrictive silencer factor (NRSF), a negative regulator of gene transcription. In fragment I of intron 1, there were four CpG sites that were hypomethylated in follistatin-treated IVF embryos. These included two putative binding sites for the Krüppel-like transcription factor (KLF) and two potential binding sites for AP2 family proteins. A complete list of the transcription factor motifs can be found in Table 1. Collectively, these results indicate that follistatin treatment induces changes in DNA methylation at key regulatory regions that contain binding motifs for transcription factors implicated in CDX2 regulation.

TABLE 1.

Transcription factor motif analysis of methylated CpG sites effected by follistatin treatment

Fragment Location (bp
from TSS)a 		CpG methylation
in response to FST		 Transcription factors
P1 −1501 ↑ EGRF, NRF1, ZF15, CTCF
−1384 ↓ NOLF, FXRE
−1283 ↓ NRSF, STAF
P2 −279 ↓ STEM, OCT1
−250 ↑ E2F, NRSF, HESF, NRF1, ZF5F
−243 ↑ ZF5F, E2FF
−163 ↓ ZFXY, AP2F
−23 ↓ P53F
I 20 ↑ HNFP, NRSF
3060 ↓ PAX2, SORY
3105 ↓ HEAT, CTCF, AP2F
3219 ↓ MYOD, GREF
3270 ↓ KLFS
3545 ↓ ZF02, SAL2, BEDF, EGRF, GLIF, KLFS, NDPK
Open in a new tab

Abbreviations: FST, follistation treatment; TSS, transcriptional start site.

a

Putative transcription factor binding sites that overlap differentially methylated CpG sites.

3. DISCUSSION

Several studies have demonstrated embryotrophic effects of follistatin in promoting early embryonic development and increasing trophectoderm cell number and CDX2 expression in bovine and rhesus monkey blastocysts (Lee et al., 2009; Patel et al., 2007; VandeVoort et al., 2009; Rajput et al., 2020). However, the mechanism by which follistatin augments CDX2 expression is not well understood. The results of the present study indicate that follistatin may upregulate CDX2 expression, in part, through changes in DNA methylation at key regulatory regions. These differentially methylated regions contain transcription factor binding motifs that could act as regulatory circuits for controlling CDX2 expression. CpG methylation at gene regulatory regions can either inhibit or stimulate transcription factor binding resulting in changes in transcriptional activity (Yin et al., 2017). In this study, loss of methylation at specific CpGs likely increased CDX2 transcription by allowing key transcription factors to gain access to the CDX2 regulatory regions. Conversely, an increase in methylation at select CpGs may have prevented repressive transcription factors from binding and inhibiting CDX2 transcription.

We previously demonstrated that follistatin treatment had a positive impact on increasing TE cell numbers in bovine embryos (Lee et al., 2009; Zhenhua et al., 2017). Importantly, in the present study, we do not believe that increased TE cell numbers dramatically affected the observed methylation changes on CDX2 regulatory regions. In fact, the vast majority of CpG regions analyzed were hypomethylated in the follistatin-treated group compared to the control group. This suggests that even with a greater number of TE cells in follistatin-treated embryos there still was a significant reduction in CpG methylation that is consistent with increased CDX2 transcription in these embryos. Thus, we believe follistatin treatment has a direct effect on CDX2 expression.

CDX2 expression is temporally and spatially regulated in preimplantation embryos (Cockburn & Rossant, 2010; Niwa et al., 2005; Rayon et al., 2016). Several transcriptional and epigenetic mechanisms control CDX2 expression during early embryonic development (Saha et al., 2013; Senner, Krueger, Oxley, Andrews, & Hemberger, 2012; Yuan et al., 2009). DNA methylation is a common epigenetic mechanism that has been shown to regulate gene expression and other functions in preimplantation embryos. As DNA methylation mainly occurs in CpG dinucleotides (Ziller et al., 2011), the bovine CDX2 gene was analyzed using a CpG island prediction software which revealed multiple CpG islands upstream and downstream of the TSS. To investigate the effects of follistatin supplementation on the methylation status of CDX2 in early bovine embryos, two different fragments in the proximal promoter region and one fragment in intron 1 were selected for bisulfite-sequencing analysis. This analysis revealed that CDX2 is generally hypomethylated which is consistent with a previous report that showed that the overall methylation percentage of CDX2 was 0.9 ± 0.2% and 0% in IVF and SCNT blastocysts, respectively (Zhang et al., 2016).

The regulation of gene expression by transcription factors is a vital mechanism for controlling cell proliferation and differentiation. Thus, the identification of transcription factor binding sites is essential in understanding the regulatory circuits that control cellular processes such as cell division and differentiation (Boyd et al., 2010). The CDX2 gene contains multiple regulatory elements in the promoter region and intron 1 and is directly regulated by several transcription factors including, but are not limited to, TFAP2C, KLFs, TEAD4, and GATA3 (Benahmed et al., 2008; Cao et al., 2015; Home et al., 2009; Rayon et al., 2014; Wang & Shashikant, 2007).

In fragment P1 there was a decrease in methylation at a putative binding site for the FXR as well as one for STAF. Though we do not have any direct evidence that FXR is regulating CDX2 expression in bovine embryos, FXR has been shown to induce CDX2 expression in rat gastric epithelial cells (Xu et al., 2010). Likewise, STAF has been shown to be a promiscuous activator of multiple genes and was postulated to interact with OCT1 to promote gene expression (Schaub, Myslinski, Schuster, Krol, & Carbon, 1997).

In promoter fragment P2 and intron 1 of the CDX2 gene follistatin treatment resulted in hypomethylation of several putative binding sites for transcription factors previously shown to regulate CDX2 expression in mouse embryos and trophoblast cells. These transcription factor families include the AP2 family, OCT transcription factors, and the KLF family. These transcription factors are positive regulators of CDX2 expression. Transcription factor Ap2γ (TFAP2C), a member of the AP2 transcription factor family, regulates CDX2 expression during early mouse embryogenesis by binding to an intronic enhancer (Cao et al., 2015). The OCT site is highly conserved in the CDX2 promoter in human, bovine, mouse, chicken, and zebrafish (Reece-Hoyes, Keenan, Pownall, & Isaacs, 2005). CDX2 is a direct transcriptional target of OCT1 which is required for maintenance and differentiation of trophoblast stem cells in mouse (Jin & Li, 2001; Reece-Hoyes et al., 2005; Sebastiano et al., 2010). In addition, a KLF binding motif was identified in intron 1. KLF family members such as KLF5 are essential for TE development and can regulate CDX2 expression in preimplantation mouse embryos (Lin, Wani, Whitsett, & Wells, 2010; Z. D. Zhao et al., 2016; T. Zhao, Liu, & Chen, 2015). Interestingly, follistatin also decreased methylation at a putative binding site for p53 protein in fragment P2. Though we are not aware of any direct evidence of p53 regulating CDX2 in embryos, it has been shown that activation of p53 can induce CDX2 expression in human embryonic stem cells (Maimets, Neganova, Armstrong, & Lako, 2008).

Follistatin also increased methylation at specific CpG sites in the P2 fragment. These CpG sites contained two putative binding sites for a transcriptional corepressor known as neuron-restrictive silencing factor (NRSF). To our knowledge there are no published reports describing the regulation of CDX2 by NRSF; however, NRSF was shown to be a negative regulator of several other genes during neuronal development (Schoenherr & Anderson, 1995). We speculate that NRSF could be a negative regulator of CDX2 expression and that follistatin treatment may increase DNA methylation to prevent the binding of NRSF allowing higher expression.

On the basis of our experimental observations, we postulate that follistatin may augment CDX2 expression by one or more epigenetic mechanisms. One potential mechanism is through modulation of DNA methyltransferases and demethylases. DNA methyltransferases have been shown to be stimulated by culturing bovine embryos with exogenous TGFβ1 (Barrera, Garcia, & Miceli, 2018). Similarly, BMP signaling through SMAD 1/5 was shown to regulate DMNT3b in mouse embryonic stem cells (Gomes Fernandes et al., 2016), suggesting that follistatin may regulate DNA methylation through this mechanism. Conversely, DNA demethylases such as activation-induced cytidine deaminase (AID) and ten-eleven translocation enzymes could also be involved with active demethylation of CDX2 regulatory regions. TGFβ1 signaling was shown to induce loss of DNMT3A and recruitment of SMAD2/3 and AID at a tumor suppressor gene to facilitate demethylation and transcriptional activation (Thillainadesan et al., 2012). Collectively, these experimental findings support a role for TGFβ1 signaling and follistatin in the modulation of DNA methylation at gene promoters.

In summary, results of the present study indicate that follistatin may augment CDX2 expression in early bovine embryos, at least in part, by modulating DNA methylation of key regulatory regions within the CDX2 gene. These regulatory regions contain several transcription factor binding motifs that may serve as regulatory circuits for transcription factors that positively and negatively regulate CDX2 expression during early embryogenesis. Future studies are required to elucidate the precise molecular mechanism by which follistatin augments CDX2 expression through modulation of DNA methylation.

4. MATERIALS AND METHODS

4.1. Ethics statement

Embryos used in this study were generated by in vitro fertilization (IVF) using oocytes harvested from ovaries collected at a local slaughterhouse within the state of Michigan. Ethical approval was not required by the Michigan State University institutional animal care and use committee (IACUC).

4.2. In vitro embryo production and follistatin supplementation

Ovaries collection, oocytes retrieval, and in vitro embryo production were performed as previously described (Bettegowda, Patel, Ireland, & Smith, 2006). Zygotes were cultured in the presence or absence of 10 ng/ml recombinant human follistatin (R&D Systems, Minneapolis, MN) during the initial 72 hr of in vitro culture (Lee et al., 2009). Then, 8–16 cell embryos were isolated, washed, and cultured in fresh media without follistatin until Day 7 when blastocysts were collected and snap-frozen in lysis buffer and stored at −80°C until used for nucleic acids isolation.

4.3. Genomic DNA and RNA isolation, reverse transcription, and quantitative real-time polymerase chain reaction (RT-PCR)

Genomic DNA and total RNA were simultaneously isolated from both blastocyst groups (n = 15 blastocyst/pool, n = 6 replicates) using the Allprep DNA/RNA micro kit (Qiagen, Valencia, CA). Total RNA from each sample was utilized for reverse transcription using iScript cDNA synthesis kit (BioRad, Hercules, CA) according to the manufacturer's instructions. Quantification of CDX2 transcript was done by quantitative RT-PCR using a CFX96TM Real-time PCR System and SsoAdvanced Universal SYBR Green Supermix (BioRad). Amplification conditions were as followed. An initial denaturation at 95°C for 3 min then 40 cycles of 95°C for 15 s and 60.8°C for 1 min. (Ashry et al., 2015; Patel et al., 2007). At the end of the reaction, a melting curve was ran to confirm the amplification of a single product. CDX2 primers were designed using PerlPrimer1 Software v1.1.21. Transcript abundance for CDX2 was normalized relative to the abundance of endogenous control, bovine ribosomal protein S18 (RPS18). The Primer sequences used for qRT-PCR were: CDX2 (AM293662) forward: FCGTCTGGAGCTGGAGAAGGA, reverse: CGGCCAGTTCGGCTTTC; RPS18 (NM_001033614) forward: GTGGTGTTGAGGAAAGCAGACA, reverse: TGATCACACGTTCCACCTCATG.

4.4. Bisulfite treatment, genomic DNA amplification, cloning, and sequencing

Genomic DNA was subjected to bisulfite treatment using EpiTect Bisulfite Kit (Qiagen) according to the manufacturer's instructions. Universally methylated and non-methylated pUC19 DNA Set (Zymo Research, CA) was used as a control for bisulfite conversion efficiency and accuracy of methylation detection. The bovine CDX2 gene sequence (GenBank ID: NC_037339, Region 32081960-32087314) was retrieved from the NCBI database and subjected to CpG island prediction using MethPrimer software (http://www.urogene.org/methprimer/index1.html), which revealed multiple CpG islands upstream and downstream of the transcription start site (TSS; +1; genomic Position 32083604). Three different fragments within the promoter region (fragment P1; −1644 to −1180; P2, −305 to +126) and intron 1 (fragment I, +3030 to +3710) were selected for bisulfite-sequencing analysis. The bisulfite primers were designed using the web-based MethPrimer software (Li & Dahiya, 2002). Large numbers of nested PCR primer sets were selected and tested by gradient PCR with the template of bisulfite-treated DNA from granulosa cells. Validated primers sequence information is summarized in Table 2. Bisulfite PCR was performed by using GoTaq DNA Polymerase (Promega, Madison, WI) with bisulfite-converted genomic DNA as the template, each reaction was carried out in 50 μl volume and contained 1× PCR buffer, 0.2 μM forward and reverse primers, 1.25 unit of the Go Taq DNA polymerase, 1ml of 10 mM dNTP mix (Promega) and 6 μl bisulfite-converted DNA template. Amplification conditions were as follows, an initial denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 44–52°C for 30 s., and extension at 72°C for 45 s. A final extension of 72°C for 10 min was also included. The amplified PCR products were analyzed in a 1.5% agarose gel, target fragments were extracted by QIAquick Gel Extraction Kit (Qiagen) and purified by using QIAquick PCR Purification Kit (Qiagen) according to the manufacturer's instructions. Purified PCR products were then directly cloned into a pCR4-TOPO vector using a TOPO TA cloning kit for Sequencing (Invitrogen, Grand Island, NY). The TOPO cloning reaction was subsequently transformed into One Shot TOP10 chemically competent cells (Invitrogen). After transformation, competent cells were grown overnight on Luria-broth agar plates containing 50 μg/ml ampicillin. For each transformation, positive clones were screened by colony PCR using M13 primers and a total of eight clones/replicate were purified and submitted to the genomic core facility at Michigan State University for Sanger sequencing.

TABLE 2.

List of methylation-specific primer sequences

Gene ID Primer sequence Amplicon size
CDX2_P1 OF 5′-TTTGTAAAGTGGAGAAGATGATAAGATT-3′ 595 bp
OR 5′-CATTTACAAAATAAAACATATCTCCAAAA-3′
IF 5′-AAAGGATATTGGATGGAGTTTTAGAG-3′ 487 bp
IR 5′-TTTCATCTCCAAAAAATAAAAAAAA-3′
CDX2_P2 OF 5′-AATTTGTGATTGGAGGTTAAAGTGTAT-3′ 595 bp
OR 5′-TCCTTATCCAAAAAATAACTCAC-3′
IF 5′-TTTTTAATAATAAAGGTTTGAATATTTAGT-3′ 498 bp
IR 5′-ACCTCACCATACTACCCAAAAAC-3′
CDX2_I OF 5′-TATTGTTTGAGGTTGTGTTTTTTTT-3′ 681 bp
OR 5′-AAAAAAATTCCCTTTCTATTTATTTTATTA-3′
IF 5′-GGTTTGTAAAGGGTTTTATTTGAATAA-3′ 550 pb
IR 5′-ATACAACAACTAACAACTATCCCCTC-3′
Open in a new tab

Abbreviations: F, forward primer; IF, inner forward; IR, inner reverse; OF, outer forward; OR, outer reverse; R, reverse primer; bp, base pairs.

4.5. Analysis and interpretation of bisulfite-sequencing data

Bisulfite-sequencing data were aligned to the reference sequence using by BioEdit Sequence Alignment Editor (Ibis Biosciences, Carlsbad, CA). Aligned sequences were automatically processed, filtered for sequence identity, conversion rate and clonal sequences and analyzed by Bisulfite Sequencing DNA Methylation Analysis (BISMA) Software (Rohde, Zhang, Reinhardt, & Jeltsch, 2010), and Bisulfite Sequencing Data Presentation and Compilation (BDPC) web interface (Rohde et al., 2008). Conversion rate was determined based on the percentage of non-CpG cytosine conversion into thymine. Clones with a sequence identity of ≥90% and conversion rate of ≥95% were considered for analysis. Methylation percentage was calculated for each individual CpG site and CpG sites with ≥20% methylation at least in one group were considered potential differentially methylated sites (DMS) and were subjected to statistical analysis by Fisher's exact test (Sproul et al., 2011; Warden et al., 2013). Methylation plotter (Mallona, Diez-Villanueva, & Peinado, 2014) was used to generate the methylation grids with some modifications.

4.6. Analysis of transcription factors binding sites

Analysis of the putative transcription factor binding sites was done by using MatInspector (Genomatix) combined with a literature search to unveil the potential association between the differentially methylated CpG sites and transcription factors that may bind to the regulatory regions of CDX2 gene.

4.7. Statistical analysis

To investigate the effects of follistatin supplementation on early embryonic development and CDX2 expression, differences between treatment means were analyzed by Student's t test with the developmental data arcsine transformed before analysis. Data are presented as untransformed mean ± standard error. For the methylation studies, CpG sites with ≥20 methylations at least in one group were analyzed by Fisher's exact test.

ACKNOWLEDGMENTS

This study was supported by the National Institute of Child Health and Human Development of the National Institutes of Health (grant numbers R01HD072972 and T32HD087166) and Michigan State University AgBioResearch. The funding agencies had no role either in study design, data collection, analysis, or interpretation or in the writing of the report or in the decision to submit the paper for publication.

Footnotes

CONFLICT OF INTERESTS

The authors declare that there are no conflict of interests.

REFERENCES

  1. Ashry M, Lee K, Folger JK, Rajput SK, & Smith GW (2018). Follistatin supplementation during in vitro embryo culture improves developmental competence of bovine embryos produced using sex-sorted semen. Reproductive Biology, 18(3), 267–273. 10.1016/j.repbio.2018.06.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ashry M, Lee K, Mondal M, Datta TK, Folger JK, Rajput SK, … Smith GW (2015). Expression of TGFbeta superfamily components and other markers of oocyte quality in oocytes selected by brilliant cresyl blue staining: Relevance to early embryonic development. Molecular Reproduction and Development, 82(3), 251–264. 10.1002/mrd.22468 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ashry M, Rajput SK, Folger JK, Knott JG, Hemeida NA, Kandil OM, … Smith GW (2018). Functional role of AKT signaling in bovine early embryonic development: Potential link to embryotrophic actions of follistatin. Reproductive Biology and Endocrinology, 16(1), 1 10.1186/s12958-017-0318-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ashry M, & Smith GW (2015). Application of embryo transfer using in vitro produced embryos: Intrinsic factors affecting efficiency. Cattle Practice, 23(1), 8. [PMC free article] [PubMed] [Google Scholar]
  5. Barrera AD, Garcia EV, & Miceli DC (2018). Effect of exogenous transforming growth factor beta1 (TGF-beta1) on early bovine embryo development. Zygote, 26(3), 232–241. 10.1017/S096719941800014X [DOI] [PubMed] [Google Scholar]
  6. Benahmed F, Gross I, Gaunt SJ, Beck F, Jehan F, Domon-Dell C, … Duluc I (2008). Multiple regulatory regions control the complex expression pattern of the mouse Cdx2 homeobox gene. Gastroenterology, 135(4), 1238–1247. 10.1053/j.gastro.2008.06.045. 1247. e1231-1233. [DOI] [PubMed] [Google Scholar]
  7. Berg DK, Smith CS, Pearton DJ, Wells DN, Broadhurst R, Donnison M, & Pfeffer PL (2011). Trophectoderm lineage determination in cattle. Developmental Cell, 20(2), 244–255. 10.1016/j.devcel.2011.01.003 [DOI] [PubMed] [Google Scholar]
  8. Bettegowda A, Patel OV, Ireland JJ, & Smith GW (2006). Quantitative analysis of messenger RNA abundance for ribosomal protein L-15, cyclophilin-A, phosphoglycerokinase, beta-glucuronidase, glyceraldehyde 3-phosphate dehydrogenase, beta-actin, and histone H2A during bovine oocyte maturation and early embryogenesis in vitro. Molecular Reproduction and Development, 73(3), 267–278. 10.1002/mrd.20333 [DOI] [PubMed] [Google Scholar]
  9. Bird AP, & Wolffe AP (1999). Methylation-induced repression—Belts, braces, and chromatin. Cell, 99(5), 451–454. [DOI] [PubMed] [Google Scholar]
  10. Boyd M, Hansen M, Jensen TGK, Perearnau A, Olsen AK, Bram LL, … Troelsen JT (2010). Genome-wide analysis of CDX2 binding in intestinal epithelial cells (Caco-2). The Journal of Biological Chemistry, 285(33), 25115–25125. 10.1074/jbc.M109.089516 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Boyes J, & Bird A (1991). DNA methylation inhibits transcription indirectly via a methyl-CpG binding protein. Cell, 64(6), 1123–1134. 10.1016/0092-8674(91)90267-3 [DOI] [PubMed] [Google Scholar]
  12. Cao Z, Carey TS, Ganguly A, Wilson CA, Paul S, & Knott JG (2015). Transcription factor AP-2gamma induces early Cdx2 expression and represses HIPPO signaling to specify the trophectoderm lineage. Development, 142(9), 1606–1615. 10.1242/dev.120238 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cockburn K, & Rossant J (2010). Making the blastocyst: Lessons from the mouse. Journal of Clinical Investigation, 120(4), 995–1003. 10.1172/JCI41229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. El-Sayed A, Hoelker M, Rings F, Salilew D, Jennen D, Tholen E, … Tesfaye D (2006). Large-scale transcriptional analysis of bovine embryo biopsies in relation to pregnancy success after transfer to recipients. Physiological Genomics, 28(1), 84–96. 10.1152/physiolgenomics.00111.2006 [DOI] [PubMed] [Google Scholar]
  15. Goissis MD, & Cibelli JB (2014). Functional characterization of CDX2 during bovine preimplantation development in vitro. Molecular Reproduction and Development, 81(10), 962–970. 10.1002/mrd.22415 [DOI] [PubMed] [Google Scholar]
  16. Gomes Fernandes M, Dries R, Roost MS, Semrau S, deMelo Bernardo A, Davis RP, … de Sousa Lopes SM (2016). BMP-SMAD signaling regulates lineage priming, but is dispensable for self-renewal in mouse embryonic stem cells. Stem Cell Reports, 6(1), 85–94. 10.1016/j.stemcr.2015.11.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Home P, Ray S, Dutta D, Bronshteyn I, Larson M, & Paul S (2009). GATA3 is selectively expressed in the trophectoderm of peri-implantation embryo and directly regulates Cdx2 gene expression. Journal of Biological Chemistry, 284(42), 28729–28737. 10.1074/jbc.M109.016840 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Iguchi-Ariga SM, & Schaffner W (1989). CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation. Genes and Development, 3(5), 612–619. 10.1101/gad.3.5.612 [DOI] [PubMed] [Google Scholar]
  19. Jin T, & Li H (2001). Pou homeodomain protein OCT1 is implicated in the expression of the caudal-related homeobox gene Cdx-2. Journal of Biological Chemistry, 276(18), 14752–14758. 10.1074/jbc.M008277200 [DOI] [PubMed] [Google Scholar]
  20. Lee KB, Bettegowda A, Wee G, Ireland JJ, & Smith GW (2009). Molecular determinants of oocyte competence: Potential functional role for maternal (oocyte-derived) follistatin in promoting bovine early embryogenesis. Endocrinology, 150(5), 2463–2471. 10.1210/en.2008-1574 [DOI] [PubMed] [Google Scholar]
  21. Li LC, & Dahiya R (2002). MethPrimer: Designing primers for methylation PCRs. Bioinformatics, 18(11), 1427–1431. [DOI] [PubMed] [Google Scholar]
  22. Lin SC, Wani MA, Whitsett JA, & Wells JM (2010). Klf5 regulates lineage formation in the pre-implantation mouse embryo. Development, 137(23), 3953–3963. 10.1242/dev.054775 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liu T, Zhang X, So CK, Wang S, Wang P, Yan L, … Chen X (2007). Regulation of Cdx2 expression by promoter methylation, and effects of Cdx2 transfection on morphology and gene expression of human esophageal epithelial cells. Carcinogenesis, 28(2), 488–496. 10.1093/carcin/bgl176 [DOI] [PubMed] [Google Scholar]
  24. Maimets T, Neganova I, Armstrong L, & Lako M (2008). Activation of p53 by nutlin leads to rapid differentiation of human embryonic stem cells. Oncogene, 27(40), 5277–5287. 10.1038/onc.2008.166 [DOI] [PubMed] [Google Scholar]
  25. Mallona I, Diez-Villanueva A, & Peinado MA (2014). Methylation plotter: A web tool for dynamic visualization of DNA methylation data. Source Code for Biology and Medicine, 9, 11 10.1186/1751-0473-9-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Niwa H, Toyooka Y, Shimosato D, Strumpf D, Takahashi K, Yagi R, & Rossant J (2005). Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell, 123(5), 917–929. 10.1016/j.cell.2005.08.040 [DOI] [PubMed] [Google Scholar]
  27. Patel OV, Bettegowda A, Ireland JJ, Coussens PM, Lonergan P, & Smith GW (2007). Functional genomics studies of oocyte competence: Evidence that reduced transcript abundance for follistatin is associated with poor developmental competence of bovine oocytes. Reproduction, 133(1), 95–106. 10.1530/rep.1.01123 [DOI] [PubMed] [Google Scholar]
  28. Rajput SK, Lee K, Zhenhua G, Di L, Folger JK, & Smith GW (2013). Embryotropic actions of follistatin: Paracrine and autocrine mediators of oocyte competence and embryo developmental progression. Reproduction, Fertility, and Development, 26(1), 37–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Rajput SK, Yang C, Ashry M, Folger JK, Knott JG, & Smith GW (2020). Role of bone morphogenetic protein signaling in bovine early embryonic development and stage specific embryotropic actions of follistatin. Biology of Reproduction, 102(4), 795–805. 10.1093/biolre/ioz235 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Rayon T, Menchero S, Nieto A, Xenopoulos P, Crespo M, Cockburn K, … Manzanares M (2014). Notch and hippo converge on Cdx2 to specify the trophectoderm lineage in the mouse blastocyst. Developmental Cell, 30(4), 410–422. 10.1016/j.devcel.2014.06.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rayon T, Menchero S, Rollan I, Ors I, Helness A, Crespo M, … Manzanares M (2016). Distinct mechanisms regulate Cdx2 expression in the blastocyst and in trophoblast stem cells. Scientific Reports, 6, 27139 10.1038/srep27139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Reece-Hoyes JS, Keenan ID, Pownall ME, & Isaacs HV (2005). A consensus Oct1 binding site is required for the activity of the Xenopus Cdx4 promoter. Developmental Biology, 282(2), 509–523. 10.1016/j.ydbio.2005.03.035 [DOI] [PubMed] [Google Scholar]
  33. Rohde C, Zhang Y, Jurkowski TP, Stamerjohanns H, Reinhardt R, & Jeltsch A (2008). Bisulfite sequencing Data Presentation and Compilation (BDPC) web server—A useful tool for DNA methylation analysis. Nucleic Acids Research, 36(5), e34 10.1093/nar/gkn083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Rohde C, Zhang Y, Reinhardt R, & Jeltsch A (2010). BISMA—Fast and accurate bisulfite sequencing data analysis of individual clones from unique and repetitive sequences. BMC Bioinformatics, 11, 230 10.1186/1471-2105-11-230 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Saha B, Home P, Ray S, Larson M, Paul A, Rajendran G, … Paul S (2013). EED and KDM6B coordinate the first mammalian cell lineage commitment to ensure embryo implantation. Molecular and Cellular Biology, 33(14), 2691–2705. 10.1128/MCB.00069-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Schaub M, Myslinski E, Schuster C, Krol A, & Carbon P (1997). Staf, a promiscuous activator for enhanced transcription by RNA polymerases II and III. EMBO Journal, 16(1), 173–181. 10.1093/emboj/16.1.173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Schoenherr CJ, & Anderson DJ (1995). The neuron-restrictive silencer factor (NRSF): A coordinate repressor of multiple neuron-specific genes. Science, 267(5202), 1360–1363. [DOI] [PubMed] [Google Scholar]
  38. Sebastiano V, Dalvai M, Gentile L, Schubart K, Sutter J, Wu GM, … Matthias P (2010). Oct1 regulates trophoblast development during early mouse embryogenesis. Development, 137(21), 3551–3560. 10.1242/dev.047027 [DOI] [PubMed] [Google Scholar]
  39. Senner CE, Krueger F, Oxley D, Andrews S, & Hemberger M (2012). DNA methylation profiles define stem cell identity and reveal a tight embryonic-extraembryonic lineage boundary. Stem Cells, 30(12), 2732–2745. 10.1002/stem.1249 [DOI] [PubMed] [Google Scholar]
  40. Sproul D, Nestor C, Culley J, Dickson JH, Dixon JM, Harrison DJ, … Ramsahoye BH (2011). Transcriptionally repressed genes become aberrantly methylated and distinguish tumors of different lineages in breast cancer. Proceedings of the National Academy of Sciences of the United States of America, 108(11), 4364–4369. 10.1073/pnas.1013224108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sritanaudomchai H, Sparman M, Tachibana M, Clepper L, Woodward J, Gokhale S, … Mitalipov S (2009). CDX2 in the formation of the trophectoderm lineage in primate embryos. Developmental Biology, 335(1), 179–187. 10.1016/j.ydbio.2009.08.025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Strumpf D, Mao CA, Yamanaka Y, Ralston A, Chawengsaksophak K, Beck F, & Rossant J (2005). Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development, 132(9), 2093–2102. 10.1242/dev.01801 [DOI] [PubMed] [Google Scholar]
  43. Thillainadesan G, Chitilian JM, Isovic M, Ablack JN, Mymryk JS, Tini M, & Torchia J (2012). TGF-beta-dependent active demethylation and expression of the p15ink4b tumor suppressor are impaired by the ZNF217/CoREST complex. Molecular Cell, 46(5), 636–649. 10.1016/j.molcel.2012.03.027 [DOI] [PubMed] [Google Scholar]
  44. VandeVoort CA, Mtango NR, Lee YS, Smith GW, & Latham KE (2009). Differential effects of follistatin on nonhuman primate oocyte maturation and pre-implantation embryo development in vitro. Biology of Reproduction, 81(6), 1139–1146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Vassena R, Dee Schramm R, & Latham KE (2005). Species-dependent expression patterns of DNA methyltransferase genes in mammalian oocytes and preimplantation embryos. Molecular Reproduction and Development, 72(4), 430–436. 10.1002/mrd.20375 [DOI] [PubMed] [Google Scholar]
  46. Wang WC, & Shashikant CS (2007). Evidence for positive and negative regulation of the mouse Cdx2 gene. Journal of Experimental Zoology B Molecular Development and Evolution, 308(3), 308–321. 10.1002/jez.b.21154 [DOI] [PubMed] [Google Scholar]
  47. Warden CD, Lee H, Tompkins JD, Li X, Wang C, Riggs AD, … Yuan YC (2013). COHCAP: An integrative genomic pipeline for single-nucleotide resolution DNA methylation analysis. Nucleic Acids Research, 41(11), e117 10.1093/nar/gkt242 [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Xu Y, Watanabe T, Tanigawa T, Machida H, Okazaki H, Yamagami H, … Arakawa T (2010). Bile acids induce cdx2 expression through the farnesoid x receptor in gastric epithelial cells. Journal of Clinical Biochemistry and Nutrition, 46(1), 81–86. 10.3164/jcbn.09-71 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yin Y, Morgunova E, Jolma A, Kaasinen E, Sahu B, Khund-Sayeed S, … Taipale J (2017). Impact of cytosine methylation on DNA binding specificities of human transcription factors. Science (New York, NY), 356(6337), eaaj2239 10.1126/science.aaj2239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Young LE, & Beaujean N (2004). DNA methylation in the preimplantation embryo: The differing stories of the mouse and sheep. Animal Reproduction Science, 82–83, 61–78. 10.1016/j.anireprosci.2004.05.020 [DOI] [PubMed] [Google Scholar]
  51. Yuan P, Han J, Guo G, Orlov YL, Huss M, Loh YH, … Ng HH (2009). Eset partners with Oct4 to restrict extraembryonic trophoblast lineage potential in embryonic stem cells. Genes and Development, 23(21), 2507–2520. 10.1101/gad.1831909 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zhang S, Chen X, Wang F, An X, Tang B, Zhang X, … Li Z (2016). Aberrant DNA methylation reprogramming in bovine SCNT preimplantation embryos. Scientific Reports, 6, 30345 10.1038/srep30345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhao M-T, Rivera RM, & Prather RS (2013). Locus-specific DNA methylation reprogramming during early porcine embryogenesis. Biology of Reproduction, 88(2), 48 10.1095/biolreprod.112.104471 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zhao T, Liu C, & Chen L (2015). Roles of Klf5 acetylation in the self-renewal and the differentiation of mouse embryonic stem cells. PLOS One, 10(9), e0138168 10.1371/journal.pone.0138168 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Zhao ZD, Zan LS, Li AN, Cheng G, Li SJ, Zhang YR, … Zhang YY (2016). Characterization of the promoter region of the bovine long-chain acyl-CoA synthetase 1 gene: Roles of E2F1, Sp1, KLF15, and E2F4. Scientific Reports, 6, 19661 10.1038/srep19661 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zhenhua G, Rajput SK, Folger JK, Di L, Knott JG, & Smith GW (2017). Pre- and peri-/post-compaction follistatin treatment increases in vitro production of cattle embryos. PLOS One, 12(1), e0170808 10.1371/journal.pone.0170808 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Ziller MJ, Muller F, Liao J, Zhang Y, Gu H, Bock C, … Meissner A (2011). Genomic distribution and inter-sample variation of non-CpG methylation across human cell types. PLOS Genetics, 7(12), e1002389 10.1371/journal.pgen.1002389 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES