Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2020 Nov 18;10(12):539. doi: 10.1007/s13205-020-02533-6

Reduction of cadmium accumulation in the grains of male sterile rice Chuang-5S carrying Pi48 or Pi49 through marker-assisted selection

Qiuhong Chen 1,#, Wei Tang 1,#, Gai Zeng 1, Haowen Sheng 1, Weijie Shi 1, Yinghui Xiao 1,2,✉
PMCID: PMC7672139  PMID: 33224708

Abstract

To reduce cadmium (Cd) accumulation in the grains of rice Chuang-5S (C5S), a gene OsHMA3 and a QTL qlGCd3 related to low-Cd accumulation were separately introgressed into the recipient parent C5S (male sterile line) by molecular marker-assisted breeding. The recurrent parent C5S was then replaced by NIL (near-isogenic line)-C5S with the blast resistance gene Pi48 or Pi49 to construct the BC2F1 generation. Finally, two groups of improved materials of C5S, which pyramided the gene/QTL associated with low-Cd accumulation and blast resistance gene, were developed. The Cd accumulation, agronomic traits, genetic background and blast resistance of these improved C5S materials were evaluated. The results showed that the average Cd content of improved C5S material carrying OsHMA3 and qlGCd3 was, respectively, reduced by 52.8% and 50.8% compared with that of C5S, indicating that the gene related to low-Cd accumulation was, successfully, transferred to C5S with stable expression. The main agronomic traits of the improved materials were consistent with those of C5S. Besides, the improved C5S lines showed stronger blast resistance than C5S and more than 88% similarity to the genetic background of C5S. These two groups of improved materials may be further utilized for the breeding of advanced male sterile lines or superior hybrid rice.

Keywords: Rice, Chuang-5S, Marker-assisted selection, Cadmium, Rice blast, Thermo-sensitive genic male sterile

Introduction

Long-term consumption of rice with excess cadmium (Cd) can cause serious damage to human health (Ueno et al. 2010; Tang et al. 2017; Wang et al. 2019). Hence, various measures have been taken to alleviate Cd pollution in rice grains, such as the remediation of Cd-contaminated soil and improvement of cultivation techniques. However, the applicability of these methods is rather low due to their low efficiency or operability and high costs (Liu et al. 2016; Feng et al. 2019). Planting of rice varieties with low-Cd accumulation has been widely recognized as an effective and economic way to reduce the Cd content in rice grains (Wang et al. 2016; Li et al. 2017; Chen et al. 2018; Luo et al. 2018). However, very few low-Cd accumulation rice varieties are available so far, which largely impedes the implementation of this method due to the following reasons (Zhao et al. 2018). First, the threat of excess Cd in rice has not received sufficient attention, which leads to poor excavation of low-Cd germplasm resources and also largely hinders large-scale research on the mechanisms of Cd absorption, translocation and accumulation in rice. Second, the identification technology and procedure for Cd concentration in rice grains are still inadequate, resulting in slow progress in the breeding of rice varieties with low-Cd accumulation. Then, molecular marker-assisted selection (MAS) was proposed as the most powerful tool to select rice varieties with low-Cd accumulation (Ishikawa et al. 2012). Compared with traditional breeding methods, molecular marker-assisted breeding (MAB) can greatly shorten the breeding period with more precise selections. For example, a rice variety C815S with blast resistance was obtained merely by one cross, followed by three generations of backcross and one self-crossing using MAS (Cao et al. 2015). To date, MAS technology has been successfully applied to the improvement of various desirable traits in rice, such as blast resistance, brown planthopper resistance and high yield potential (Nie et al. 2016; Zhu et al. 2016).

More and more genes or QTLs related to Cd accumulation in rice have been identified in recent years (Tan et al. 2017; Ding et al. 2018; Luo et al. 2018; Xiong et al. 2018), which greatly facilitate the breeding of low-Cd accumulation rice with MAS tool (Ishikawa et al. 2012; Abe et al. 2013). So far, about 30 genes associated with Cd absorption or accumulation in rice have been reported (Tang et al. 2016 Xiong et al. 2018), and various Cd accumulation-related QTLs have been identified in some special rice germplasm resources as well, such as LAC23, Nipponbare(NPB) and Cho-Ko-Koku (Tezuka et al. 2010; Abe et al. 2013). OsLCT1 is a functional gene that regulates the transport of Cd from the phloem to the grain in rice and further controls the Cd content in rice grains (Uraguchi et al. 2011). qlGCd3, an effective QTL in LAC23, inhibits the migration of Cd from rice above-ground tissues to grains reducing the content of Cd in grains (Abe et al. 2013). OsNRAMP2 is the candidate gene for the novel QTL qCd3-2 associated with Cd accumulation in rice grains (Zhao et al. 2018). Four amino acid differences were found in the open reading frame of OsNRAMP2 between high- and low-Cd accumulation rice accessions. The allele from low-Cd accumulation accessions can significantly increase the Cd sensitivity and accumulation in yeast compared with the control or the allele from high-Cd accumulation accessions, indicating that OsNRAMP2-L (the allele from low-Cd accumulation accessions) plays a certain role in Cd transport in yeast. OsHMA2 can reduce the root-to-shoot transport of Cd in rice (Satoh-Nagasawa et al. 2011; Takahashi et al. 2012). Besides, OsHMA3 can inhibit the transport of Cd from rice root to the aerial part through isolating Cd from cytoplasm to vacuoles, and the expression of OsHMA3 in NPB can reduce the Cd concentration in the grains (Ueno et al. 2010; Miyadate et al. 2011; Ueno et al. 2011; Ishikawa et al. 2011; Satoh-Nagasawa et al. 2013).

Chuang-5S (referred to as C5S hereafter), an indica thermo-sensitive genic male sterile (TGMS) rice line bred by Hunan Agricultural University, is characterized by high general combining ability, stable fertility and high outcrossing rate. The hybrid seeds produced from C5S are characterized by the advantages of high germination rate and less glume-opening (Wang et al. 2014; Shu et al. 2015), which are thus suitable for direct seeding and machine transplanting (Chen et al. 2015). Both of these two planting patterns demand a large amount of seeds. Chuangliangyou 4418, a high-yield hybrid rice variety produced from C5S, was identified as a high-quality rice variety that reaches the national standard of high-quality rice GB/T 17891-1999 of China (https://www.ricedata.cn/). In this study, we attempted to introgress the gene or QTL (OsHMA3 or qlGCd3) related to low-Cd accumulation into NIL-C5S with blast resistance gene Pi48 or Pi49 by MAB, and finally developed the improved lines of C5S, which simultaneously carry low-Cd accumulation-related gene/QTL and blast resistance gene.

Materials and methods

Materials

C5S and NIL-C5S carrying Pi48 or Pi49 were used as the recurrent parents in this study. Two dominant blast resistance genes Pi48 and Pi49 were derived from rice XZ3150 and MWG, respectively, (Cao et al. 2015). One donor parent was the recombinant inbred line (RIL) Cd14030, which harbors OsHMA3, a gene related to low-Cd accumulation from NPB (Uraguchi et al. 2011). Cd14030 was constructed from rice NPB and R1126. The other donor parent was the rice cultivar LAC23, which harbors one QTL (qlGCd3) related to low-Cd accumulation. LAC23 is a tropical upland japonica rice cultivar bred in Africa, and has a lower Cd content in grains than Japanese rice cultivars (Abe et al. 2013). All the experimental seeds were provided by the Rice Research Institute of Hunan Agricultural University, China.

Molecular marker selection and PCR analysis

Sixteen molecular markers linked to the target genes were finally determined based on previous research (Table 1) (Ueno et al. 2010; Liu et al. 2012; Sun et al. 2012; Abe et al. 2013; Cao et al. 2015). DNA samples were prepared by the sucrose extraction method (Cao et al. 2013). The PCR system (10 μL) for marker amplification was as follows: 1.0 μL of 10 × buffer (Mg2+), 0.2 μL of 5 mM dNTPs, 1.0 μL of 2 pmol/μL primer pair, 0.1 μL of 5 U/μL Taq Enzyme, 1.0 μL of DNA template (about 10 ng/μL), and 6.7 μL ddH2O. The PCR machine was ABI PCR system 2700. The PCR profile was 94 °C for 5 min, followed by 25–30 cycles of 94 °C for 30 s, 50 °C or below 55 °C for 1 min, 72 °C for 30 s, and finally 72 °C for 10 min. The amplification products were separated by electrophoresis on 8% nondenaturing polyacrylamide gel, and then visualized by silver staining. Four markers showing good polymorphisms among parents were selected for foreground selection, whose detailed information is shown in Table 2. SSR marker RM16153 was used for qlGCd3 detection; SSR marker RM21268 was employed to detect OsHMA3; and SSR markers RM224 and LY2 were used to detect Pi49 and Pi48, respectively.

Table 1.

Molecular markers screened for polymorphism between recurrent parent and donor parent

Gene type Gene/QTL Source Chr Marker type Marker name
Low-Cd accumulation-related gene/QTL qlGCd3 LAC23 3 SSR RM1352, RM6970, RM1373, RM16153
OsHMA3 NPB 7 SSR RM21251, RM21260, RM21261, RM21263, RM21264, RM21265, RM21268, RM21275, OsHMA3-29, OsHMA3-30
Rice blast resistance genes Pi49 MWG 11 SSR RM224
Pi48 XZ3150 12 SSR LY2
Open in a new tab

Table 2.

SSR markers for foreground selection

Gene or QTL Chr Marker Genetic or physical distance between marker and gene Primers Position of Marker on Chr (bp) (https://rapdb.dna.affrc.go.jp/) Tm
(ºC)
OsHMA3 7 RM21268

119.932 kb

(Ueno et al. 2010)

F: gcaaactagcaagtagcaagaacg

R: gagtgcctgtgtgtataggatacg

 7,529,485–7,529,590 55
qlGCd3 3 RM16153

 < 3.5 Mb

(Abe et al. 2013)

F: tggttgtggtatagcacggtaagc

R: tgacccaaggagatactaggttgc

 35,020,665–35,020,929 55
Pi49 11 RM224

about 6 cM

(Sun et al. 2012)

F: atcgatcgatcttcacgagg

R: tgctataaaaggcattcggg

 27,673,251–27,673,372 55
Pi48 12 LY2

about 0.025 cM

(Liu et al. 2012)

F: attacgctcgatagtggc

R: ctagcgggaggttggaag

 11,935,927–11,936,129 55
Open in a new tab

Evaluation of Cd accumulation and agronomic traits

The characteristics of Cd accumulation were investigated by pot experiments. The experimental soil was collected from the field near the Dongting Lake, with a Cd concentration of about 2.06 mg/kg. The soil was put into six plastic pots (length = 75 cm, width = 55 cm, height = 23 cm) after thorough drying, grinding and mixing. Each pot contained 25 kg soil supplemented with 21.64 g compound fertilizer. All the materials in the pot were mixed thoroughly with water.

The experiment was carried out with six replications, and each replication included ten rice plants: four improved BC2F2 plants of C5S lines from two groups of breeding schemes and six parent plants (NPB, LAC23 and Chuang-5S), with two plants for each material. One replication was planted in one pot with a planting space of 15 cm × 15 cm. Flooded rice cultivation was carried out over the entire growth period of rice in this assay. All other field managements were performed as conventional rice cultivation. During the flowering period, pollination was performed between the plants of all sterile lines and plants of a paternal parent at the same flowering stage. The plant height, spike length, number of effective tillers, grain number per panicle, number of primary branches and number of secondary branches were recorded during the mature stage. Only one plant of each improved BC2F2 material and one plant of C5S in every replication were chosen to evaluate these agronomic traits. The data of six replications were averaged to measure the value of each material.

The seeds harvested from each improved C5S material or each parent in every replication were, respectively, dried under the sun and then separated into chaff and brown rice by a rice husker (JLGJ 4.5). The brown rice was loaded into sequentially numbered paper bags, which were then dried in an oven at 65 °C to a constant weight. Then, the brown rice was crushed into powders with a plant grinder and put into sequentially numbered ziplock bags. The powders were then digested by a mixture of nitric acid and perchloric acid (volume ratio = 4:1), and sent to the detection center of Guangzhou GRG Metrology and Test Technology CO., LTD (Hunan Branch) for the determination of Cd concentration by an atomic absorption spectrophotometer with graphite furnace technique (GB 5009.15-1996, National Food Safety Standard in China, method for determination of cadmium in foods). The reagents used in the digestion process were all of analytical grade. The data of six replications were averaged to indicate the value of the material.

Blast resistance identification

Due to the lack of homozygous BC2F2 seedlings in the summer of 2016, successive inbreeding was conducted in Changsha of Hunan Province in the summer of 2016 and Sanya of Hainan Province in the winter of 2016 to obtain BC2F4 seeds. The evaluation of blast resistance was performed in the summer of 2017 at Liuyang of Hunan Province through natural infection in uniform blast nursery with BC2F4 seedlings. The seeds of improved BC2F4 C5S lines (with homozygous OsHMA3 and Pi49 or with homozygous qlGCd3 and Pi48), C5S (recurrent parent) and CO39 (highly susceptible spreader) were sown on May 10, and five lines were chosen for each genotype of the improved C5S. One hundred seeds of every line and C5S were sown with CO39 around. About 30 days later, the disease reaction was visually scored according to a 0–9 SES scale (Standard Evaluation System, IRRI, 1996) when the susceptible check CO39 showed more than 90% dead seedlings. Ten representative plants were examined for each line, and the average score was taken to measure the disease level of each line. The scores of all materials were calculated and compared. Scores 0–3 were considered as resistant (R), 4 as moderately resistant (MR), and 5–9 as susceptible (S).

Genetic background examination of improved lines

The whole-genome high-density single-nucleotide polymorphism (SNP) array GSR40K was used to evaluate the similarity in genetic background between the improved lines and the recurrent parent C5S. This SNP array was developed based on Infinium technology, and comprises 32,607 high-quality SNP and insertion–deletion (InDel) markers evenly distributed on the 12 chromosomes of rice. For each improved line or C5S, the total DNA was extracted from the leaves of five plants. Genetic background similarity analysis was performed at Wuhan Greenfafa Institute of Novel Genechip R&D Co., LTD (Wuhan, China) (https://greenfafa.com/), according to the Infinium HD Assay Ultra Protocol (https://www.illumina.com/).

Statistical analysis

The original data of each replication were analyzed by Microsoft Office Excel (2010) and the least significant difference test (LSD) was carried out by DPS software.

Results

Development of introgressed and pyramided lines of C5S by MAB

In this study, a low-Cd accumulation-related gene (OsHMA3) from one donor parent Cd14030 and QTL (qlGCd3) from the other donor parent LAC23 were introgressed into the TGMS line C5S, respectively. The recurrent parent C5S was replaced by NIL-C5S with blast resistance gene Pi49 or Pi48 to construct the BC2F1 generation in backcrossing. Since the breeding scheme was similar for the two donor parents, we only elaborated the breeding scheme from the donor parent Cd14030 (Fig. 1). NIL-C5S with Pi49 was employed in this breeding process, while NIL-C5S with Pi48 was utilized in the other breeding process for donor parent LAC23.

Fig. 1.

Fig. 1

Open in a new tab

Breeding scheme for developing introgression lines of C5S carrying OsHMA3 and Pi49

The hybridization between C5S (female parent) and Cd14030 (male parent) was carried out at Hunan Province of China in the summer of 2014. Eight F1 hybrid seeds were harvested, which were then germinated at Changsha in the winter of 2014 and genotyped by the marker RM21268. The results showed that RM21268 was heterozygous in all the eight F1 seedlings (Table 3). Then, the eight seedlings were transplanted in Sanya of Hainan Province, and the plants with the most similar agronomic characteristics such as morphological traits (plant height, plant and leaf color, plant and leaf type; same as below) and developmental periods to those of C5S were selected as the male parent to backcross with C5S. Finally, BC1F1 seeds were obtained.

Table 3.

Genotyping results of each generation during the breeding process

Generation Screened or selected plants Numbers in Group 1 Numbers in Group 2
(C5S/ Cd14030) (C5S/LAC23)
F1(Summer 2014) Screened plants 8 17
Selected plants 8 17
BC1F1(Spring 2015) Screened plants 192 172
Selected plants 14 5
BC2F1(Winter 2015) Screened plants 260 10
Selected plants 19 3
BC2F2(Summer 2016) Screened plants 600 200
Selected plants 38 40(9)*
Open in a new tab

“*” indicates 40 seedlings with homozygous genotypes for RM16153 (qlGCd3), nine of which had homozygous genotypes for LY2 (Pi48)

A total of 192 BC1F1 seedlings were planted at Changsha of Hunan Province in the summer of 2015. The genotypes of these 192 seedlings were identified with the marker RM21268. The results showed that RM21268 was heterozygous in 14 BC1F1 plants (Table 3), from which 10 plants with the most similar agronomic characteristics such as morphological traits and developmental periods to C5S were selected. In light of the fertility segregation, the sterile individuals of the 10 BC1F1 plants were selected as the female parents to backcross with fertile NIL-Chuang-5S (Pi49) under cold water irrigation; while the fertile individuals were used as male parents to backcross with the sterile NIL-C5S (Pi49), and BC2F1 seeds were obtained.

The BC2F1 seedlings were cultivated on rice nursery trays at Changsha in the winter of 2015. A total of 260 DNA samples were extracted from the leaves of BC2F1 seedlings, and the genotype of every seedling was identified with the two markers RM21268 and RM224. Nineteen BC2F1 seedlings heterozygous for both markers (Table 3) were transplanted in Hainan Province of China and became self-fertile due to the naturally low temperature conditions of Hainan. BC2F2 seeds were harvested from the BC2F1 plants with the most similar agronomic characteristics to the recurrent parent C5S.

Six hundred seeds of BC2F2 population were sown in the seedling bed after germination in the summer of 2016 at Changsha. The genotype of every BC2F2 seedling was identified with the two markers RM21268 (Fig. 2) and RM224 (Fig. 3). As a result, 38 BC2F2 seedlings showing homozygous genotypes for RM21268 (OsHMA3, NPB) and RM224 (Pi49, MWG) were obtained (Table 3).

Fig. 2.

Fig. 2

Open in a new tab

Genotypes of marker RM21268 (for gene OsHMA3) in the parents and some BC2F2 individuals bred from Cd14030 and C5S. Note DL: DNA ladder; P1: NPB; P2: MWG; P3: C5S; 1: BC2F2 individual with homozygous genotype from NPB; 2: BC2F2 individual with homozygous genotype from C5S or MWG; 3: BC2F2 individual with heterozygous genotype from NPB and MWG or from NPB and C5S. Black arrows indicate the amplified target products for each allele in different parents

Fig. 3.

Fig. 3

Open in a new tab

Genotypes of marker RM224 (for gene Pi49) in the parents and some BC2F2 individuals bred from Cd14030 and C5S. Note DL: DNA ladder; P1: NPB; P2: MWG; P3: C5S; 1: BC2F2 individual with homozygous genotype from C5S; 2: BC2F2 individual with homozygous genotype from MWG; 3: BC2F2 individual with heterozygous genotype from NPB and C5S; 4: BC2F2 individual with heterozygous genotype from MWG and C5S; 5: BC2F2 individual with heterozygous genotype from NPB and MWG. Black arrows indicate the amplified target products for each allele in different parents

After the parallel breeding process of group 2 between the donor parent LAC23 and the recipient parent C5S (or NIL-C5S with Pi48) (Table 3), we examined the polymorphisms of the two markers RM16153 (Fig. 4) and LY2 (Fig. 5) in the BC2F2 seedlings. Finally, 40 BC2F2 seedlings with homozygous genotypes for RM16153 (qlGCd3, LAC23) were obtained, among which nine had homozygous genotypes for LY2 (Pi48, XZ3150) as well (Table 3).

Fig. 4.

Fig. 4

Open in a new tab

Genotypes of marker RM16153 (for QTL qlGCd3) in the parents and some BC2F2 individuals bred from LAC23 and C5S. Note DL: DNA ladder; P1: LAC23; P2: XZ3150; P3: C5S; 1: BC2F2 individual with homozygous genotype from LAC23; 2: BC2F2 individual with homozygous genotype from XZ3150; 3: BC2F2 individual with homozygous genotype from C5S; 4: BC2F2 individual with heterozygous genotype from LAC23 and C5S; 5: BC2F2 individual with heterozygous genotype from LAC23 and XZ3150; 6: BC2F2 individual with heterozygous genotype from XZ3150 and C5S. Black arrows indicate the amplified target products for each allele in different parents

Fig. 5.

Fig. 5

Open in a new tab

Genotypes of marker LY2 (for gene Pi48) in the parents and some BC2F2 individuals bred from LAC23 and C5S. Note DL: DNA ladder; P1: LAC23; P2: XZ3150; P3: C5S; 1: BC2F2 individual with homozygous genotype from LAC23; 2: BC2F2 individual with homozygous genotype from C5S; 3: BC2F2 individual with homozygous genotype from XZ3150; 4: BC2F2 individual with heterozygous genotype from LAC23 and C5S; 5: BC2F2 individual with heterozygous genotype from XZ3150 and C5S. Black arrows indicate the amplified target products for each allele in different parents

Determination of Cd content in the brown rice of BC2F2 plants and their parents

The average Cd contents in the brown rice of two groups of BC2F2 plants and three parent cultivars were, respectively, determined, and significant difference analysis was performed (Table 4). As a result, the average Cd contents in the brown rice of both groups of BC2F2 plants were lower than 0.2 mg/kg, which is the maximum allowable level of Cd in the National Food Safety Standard of Foods in China (GB2762-2017) (Zhang et al. 2015). The average Cd content in the brown rice of the BC2F2 plants carrying homozygous OsHMA3 and Pi49 was 0.0382 mg/kg, and that of the BC2F2 plants carrying homozygous qlGCd3 and homozygous or heterozygous Pi48(±) was 0.0398 mg/kg, which was, respectively, reduced by 52.8% and 50.8% relative to that of C5S (0.0809 mg/kg). The average Cd content in NPB and LAC23 was 0.0226 mg/kg and 0.0242 mg/kg, respectively, and that of C5S was significantly higher than that of NPB, LAC23 or the two groups of BC2F2 plants.

Table 4.

Cd contents in the brown rice of BC2F2 plants and the parents

Materials Average Cd concentration (mg/kg) 1% significance level
C5S 0.0809 ± 0.0093 a
C5S (OsHMA3 + Pi49) 0.0382 ± 0.0106 b
NPB 0.0226 ± 0.0038 b
C5S (qlGCd3 ± Pi48) 0.0398 ± 0.0075 b
LAC23 0.0242 ± 0.0016 b
Open in a new tab

Evaluation of agronomic traits of BC2F2 plants and C5S

The main agronomic traits of the two groups of BC2F2 plants and their recurrent parent C5S were evaluated, and the statistical significance was analyzed (Table 5). The results showed that the number of primary branches and total grains per panicle in the BC2F2 plants carrying homozygous OsHMA3 and Pi49 were increased significantly compared with those in C5S, and the panicles of the BC2F2 plants carrying homozygous qlGCd3 and homozygous or heterozygous Pi48(±) were significantly longer than that of C5S.

Table 5.

Comparison of the main agronomic traits between BC2F2 plants and C5S

Materials Plant height (cm) Panicle length (cm) Number of tillers Number of grains per panicle Number of primary branches per panicle Number of secondary branches per panicle
C5S (OsHMA3 + Pi49) 63.9 ± 3.3 18.0 ± 0.6 8.8 ± 1.3 173.5 ± 23.3* 10.8 ± 1.3* 37.8 ± 9.4
C5S (qlGCd3 ± Pi48) 69.2 ± 3.1 21.9 ± 0.2* 8.0 ± 1.6 161.8 ± 33.8 10.0 ± 0.8 36.3 ± 10.0
C5S 64.1 ± 3.9 19.1 ± 1.2 8.8 ± 1.0 133.8 ± 20.0 9.0 ± 0.8 29.5 ± 4.7
Open in a new tab

“*” means a significant difference (P < 0.05) compared with the recurrent parent C5S. LSD method was used for multiple comparison

Evaluation of the blast resistance of BC2F4 plants and C5S

According to the standards for the evaluation of rice leaf blast, the statistical results of the scores for disease reaction are shown in Table 6. The disease reaction scores of the susceptible control CO39 and recurrent parent C5S were 8.8 and 6.3, respectively. The scores of introgression C5S lines carrying homozygous OsHMA3 and Pi49 were 2.5–2.7, and those of introgression C5S lines carrying homozygous qlGCd3 and Pi48 were 3.5–3.8. The results revealed that the disease resistance of BC2F4 plants of introgression C5S lines was greatly improved relative to that of their recurrent parent C5S.

Table 6.

Leaf blast resistance scores of BC2F4 plants and C5S

Lines Genotype Disease level Scores Lines Genotype Disease level Scores
C5S – 6.3 ± 1.3 b CO39 / 8.8 ± 0.4 a
C5S-9–1 (OsHMA3 + Pi49) 2.7 ± 1.0 d C5S-8–1 (qlGCd3 + Pi48) 3.7 ± 0.8 c
C5S-9–2 (OsHMA3 + Pi49) 2.6 ± 1.0 d C5S-8–2 (qlGCd3 + Pi48) 3.5 ± 0.7 c
C5S-9–3 (OsHMA3 + Pi49) 2.5 ± 0.5 d C5S-8–3 (qlGCd3 + Pi48) 3.7 ± 0.8 c
C5S-9–4 (OsHMA3 + Pi49) 2.5 ± 0.9 d C5S-8–4 (qlGCd3 + Pi48) 3.8 ± 0.8 c
C5S-9–5 (OsHMA3 + Pi49) 2.7 ± 0.7 d C5S-8–5 (qlGCd3 + Pi48) 3.8 ± 0.8 c
Open in a new tab

Genetic background examination of the improved lines

To obtain improved TGMS lines with stable agronomic characters for further hybrid rice breeding, the improved materials of C5S obtained above were subjected to several self-pollinations, genotyping and phenotyping. At present, the BC2F5 materials of C5S with OsHMA3 and Pi49, and BC2F7 materials of C5S with qlGCd3 and Pi48 have been developed. GSR40K, a whole-genome high-density SNP array, was then used to analyze the genetic background of two selected improved lines BC2F5–C5S–OsHMA3–Pi49 and BC2F7–C5S–qlGCd3–Pi48. As shown in Fig. 6, the genetic background recovery rates of the recurrent parent in BC2F5–C5S–OsHMA3–Pi49 and BC2F7–C5S–qlGCd3–Pi48 were 88.81% and 94.74%, respectively, as measured by the percentages of the polymorphic markers showing the same genotype with C5S. Large chromatin fragments of recurrent parent C5S were substituted in the positions (purple dots) of Pi49 in chromosome 11, OsHMA3 in chromosome 7, Pi48 in chromosome 12, and qlGCd3 in chromosome 3, indicating the successful introgression of the target genes.

Fig. 6.

Fig. 6

Open in a new tab

Haplotype maps of genetic background profiling of two improved C5S lines using the GSR40K array. Note The red line (BB) represents a homozygous genotype different from C5S, and the blue line (AB) represents the heterozygous genotype. The purple dots indicate the positions of the introgressed genes

Discussion

The pyramiding breeding is successful

The genetic background examination results indicate that the improved lines retained more than 88% of the C5S genome, and the target genes were also successfully introgressed. The examination results coupled with previous genotyping and phenotyping results indicate that the improved lines have obtained the blast resistance genes and low-Cd accumulation gene/QTL, and the related traits have been improved. The genetic background examination also showed that the improved lines retain the homozygous TGMS genes of C5S, though this result is not shown. These improved lines can be further exploited for the breeding of advanced male sterile lines or new hybrid rice varieties with lower Cd content and resistance to rice blast.

Marker-assisted breeding is an effective way to breed rice varieties with low-Cd accumulation

MAB, a method that detects the presence of the target genes through the identification of closely linked molecular markers, can facilitate the selection of target traits. It has the advantages of less time consumption and higher accuracy compared with traditional breeding methods, and the genotype identification is not affected by environmental conditions. The grain quality (Yang et al. 2015), blast resistance or brown planthopper resistance (Li et al. 2016; Chukwu et al. 2019) has been successfully improved by MAS tool in many rice varieties, but relatively less research has been focused on the reduction of Cd accumulation in rice grains by MAS tool.

A molecular marker-assisted selection system for mutant allele nramp5 has been constructed with the mutant materials produced by ion beam radiation. It was found that the defective transporter protein osnramp5 encoded by the mutant nramp5 can significantly reduce Cd uptake by the roots, resulting in lower Cd concentrations in the straw and grain. The offspring genotypes of these mutant materials were identified by this system (Ishikawa et al. 2012). Takahashi et al. (2016) screened the rice F5 population with the DNA marker of OsHMA3 gene to select the individuals containing the gene from ‘Cho-ko-koku’, which finally contributed to the breeding of the rice variety Akita110 that can be used for the remediation of Cd-contaminated soil.

This study reduced the Cd accumulation in the brown rice of the TGMS line C5S by MAB. The gene/QTL related to low-Cd accumulation and the blast resistance gene were pyramided in the improved BC2F2 materials of C5S through one cross, two generations of backcross and one self-crossing. The Cd accumulation and major agronomic traits of the improved BC2F2 materials were evaluated. The results showed that the average Cd contents in the improved BC2F2 materials carrying OsHMA3 and qlGCd3 were reduced by 52.8% and 50.8%, respectively, relative to that in C5S (Table 4), and their major agronomic traits were similar to those of C5S (Table 5), indicating that MAB is an effective way to reduce Cd accumulation in rice grains.

Gene pyramiding breeding is an important direction for the breeding of low-Cd accumulation rice

Different Cd accumulation genes may have different functional models. For example, OsIRTs, OsNramp1 and OsNramp5 mainly regulate the Cd accumulation in rice roots; OsHMA3, OsHMA2 and OsMTP1 control the Cd transport from rice root to the aerial part; OsLCT1, OsLCD and OsHMA9 mainly regulate the Cd accumulation in rice grains (Tang et al. 2016). This study successfully bred two groups of improved TGMS materials of rice with relatively low accumulations of Cd. The improved material derived from Chuang-5S and Cd14030 harbors one gene related to low-Cd accumulation (OsHMA3) and one blast resistance gene (Pi49); while that derived from Chuang-5S and LCA23 has one QTL related to low-Cd accumulation (qlGCd3) and one blast resistance gene (Pi48). These two groups of improved BC2F2 materials can be further crossed with each other to pyramid low-Cd accumulation-related genes and QTLs quickly, which may help to take the advantages of various genes in different Cd accumulation pathways and eventually reduce the Cd content in rice grains.

Funding

We appreciate the funding support from the National Natural Science Foundation of China (Grant No. 31171834), National Key Research and Development program (Grant No. 2016YFD0101100), Science and Technology Major Project of Hunan Province (Grant No. 2015NK1001-2).

Compliance with ethical standards

Conflict of interest

On behalf of all authors, the corresponding author states that there is no conflict of interest.

Footnotes

Qiuhong Chen and Wei Tang have contributed equally to this work.

References

  1. Abe T, Nonoue Y, Ono N, Omoteno M, Kuramata M, Fukuoka S, Yamamoto T, Yano M, Ishikawa S. Detection of QTLs to reduce cadmium content in rice grains using LAC23/Koshihikari chromosome segment substitution lines. Breeding Sci. 2013;63(3):284–291. doi: 10.1270/jsbbs.63.284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Cao Z, Zeng G, Sheng HW, Xiao YH. A simple approach for rapid preparation of rice genomic DNA for PCR analysis. J Hunan Agric Univ. 2013;39(1):13–16. [Google Scholar]
  3. Cao Z, Zeng G, Hao M, Sheng HW, Ye NZ, Xiao YH. Improving blast resistance of dual-purpose genic sterile line C815S by using molecular marker-assisted selection. MPB. 2015;13(6):1193–1200. [Google Scholar]
  4. Chen LY, Lei DY, Tang WB, Deng HB, Xiao YH, Zhang GL. Review on the methods of hybrid rice breeding. J Hunan Agric Univ. 2015;41(1):1–6. [Google Scholar]
  5. Chen XH, Ouyang YN, Fan YC, Qiu BY, Zhang GP, Zeng FR. The pathway of transmembrane cadmium influx via calcium-permeable channels and its spatial characteristics along rice root. J Exp Bot. 2018;69(21):5279–5291. doi: 10.1093/jxb/ery293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chukwu SC, Rafii MY, Ramlee SI, Ismail SI, Oladosu Y, Okporie E, Onyishi G, Utobo E, Ekwu L, Swaray S, Jalloh M. Marker-assisted selection and gene pyramiding for resistance to bacterial leaf blight disease of rice (Oryza sativa L.) Biotechnol Biotec Equip. 2019;33:1–16. [Google Scholar]
  7. Ding YF, Gong SH, Wang Y, Wang FJ, Bao H, Sun JW, Cai C, Yi KK, Chen ZX, Zhu C. MicroRNA166 modulates cadmium tolerance and accumulation in rice. Plant Physiol. 2018;177:1691–1703. doi: 10.1104/pp.18.00485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Feng WL, Guo ZH, Xiao XY, Peng C, Shi L, Ran HZ, Xu WX. Atmospheric deposition as a source of cadmium and lead to soil-rice system and associated risk assessment. Ecotox Environ Safe. 2019;180:160–170. doi: 10.1016/j.ecoenv.2019.04.090. [DOI] [PubMed] [Google Scholar]
  9. Ishikawa S, Suzui N, Ito-Tanabata S, Ishii S, Igura M, Abe T, Kuramata M, Kawachi N, Fujimaki S. Real-time imaging and analysis of differences in cadmium dynamics in rice cultivars (Oryza sativa) using positron-emitting 107 Cd tracer. BMC Plant Biol. 2011;11(1):172. doi: 10.1186/1471-2229-11-172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Ishikawa S, Ishimaru Y, Igura M, Kuramataa M, Abea T, Senourab T, Hased Y, Arao T, Nishizawa NK, Nakanishi H. Ion-beam irradiation, gene identification, and marker-assisted breeding in the development of low-cadmium rice. PNAS. 2012;109(47):19166–19171. doi: 10.1073/pnas.1211132109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Li YY, Li SC, Li XF. Research progress of molecular marker-assisted selection for pyramiding disease and insect resistance genes in rice. Guangdong Agric Sci. 2016;43(6):119–126. [Google Scholar]
  12. Li K, Yu HY, Li TX, Chen GD, Huang F. Cadmium accumulation characteristics of low-cadmium rice (Oryza sativa L.) line and F1 hybrids grown in cadmium-contaminated soils. Environ Sci Pollut Res. 2017;24(21):1–11. doi: 10.1007/s11356-017-9350-5. [DOI] [PubMed] [Google Scholar]
  13. Liu Y (2012) Fine mapping of blast resistance gene Pi48 in rice cultivar Xiangzi 3150, Dissertation, Hunan agricultural University.
  14. Liu LC, Liu SX, Li YC, Min J, Huang HM. Research Progress of Cadmium Accumulation and Regulation in Rice. Chinese Agricultural Sciences Bulletin. 2016;32(24):1–5. [Google Scholar]
  15. Luo JS, Huang J, Zeng DL, Peng JS, Zhang GB, Ma HL, Guan Y, Yi HY, Fu YL, Han B, Lin HX, Qian Q, Gong JM. A defensin-like protein drives cadmium efflux and allocation in rice. Nat Commun. 2018;9(645):1–9. doi: 10.1038/s41467-018-03088-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Miyadate H, Adachi S, Hiraizumi A, Tezuka K, Nakazawa N, Kawamoto T, Katou K, Kodama I, Sakurai K, Takahashi H, Satoh-Nagasawa N, Watanabe A, Fujimura T, Akagi H. OsHMA3, a P1B-type of ATPase affects root-to-shoot cadmium translocation in rice by mediating efflux into vacuoles. New Phytol. 2011;189:190–199. doi: 10.1111/j.1469-8137.2010.03459.x. [DOI] [PubMed] [Google Scholar]
  17. Nie YY, Li X, Mao LH, Yan ML, Yan LA, Cai YH. Improving blast resistance of parental restorer lines R225 by marker-assisted selection. china Rice. 2016;22(3):60–63. [Google Scholar]
  18. Satoh-Nagasawa N, Mori M, Nakazawa N, Kawamoto T, Nagato Y, Sakurai K, Takahashi H, Watanabe A, Akagi H. Mutations in rice (Oryza sativa) heavy metal ATPase 2 (OsHMA2) restrict the translocation of zinc and cadmium. Plant Cell Physiol. 2011;53:213–224. doi: 10.1093/pcp/pcr166. [DOI] [PubMed] [Google Scholar]
  19. Satoh-Nagasawa N, Mori M, Sakurai K, Takahashi H, Watanabe A, Akagi H. Functional relationship heavy metal P-type ATPases (OsHMA2 and OsHMA3) of rice (Oryza sativa) using RNAi. Plant Biotechnol. 2013;30:511–515. [Google Scholar]
  20. Shu ZF, Chen Y, Liu Z, Yuan L, Xiong C, Zhang HQ. Correlation between outcrossing characteristics and stigma feature of 5 PTGMS lines. Crop Res. 2015;29(4):343–347. [Google Scholar]
  21. Sun PY, Liu JL, Wang Y, Jiang N, Wang SH, Dai YS, Gao J, Li ZQ, Pan SJ, Wang D, Li W, Liu XL, Xiao YH, Liu EM, Wang GL, Dai LY. Molecular mapping of the blast resistance gene Pi49 in the durably resistant rice cultivar Mowanggu. Euphytica. 2012;192(1):45–54. [Google Scholar]
  22. Takahashi R, Bashir K, Ishimaru Y, Nishizawa NK, Nakanishi H. The role of heavy-metal ATPases, HMAs, in zinc and cadmium transport in rice. Plant Signal Behav. 2012;7:1605–1607. doi: 10.4161/psb.22454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Takahashi R, Ito M, Katou K, Sato K, Nakagawa S, Tezuka K, Akagi H, Kawamoto T. Breeding and characterization of the rice (Oryza sativa L.) line “Akita 110” for cadmium phytoremediation. Soil Sci Plant Nutr. 2016;188(4):1–6. [Google Scholar]
  24. Tan MP, Cheng D, Yang YN, Zhang GQ, Qin MJ, Chen J, Chen YH, Jiang MY. Co-expression network analysis of the transcriptomes of rice roots exposed to various cadmium stresses reveals universal cadmium- responsive genes. Bmc Plant Biol. 2017;17(194):1–18. doi: 10.1186/s12870-017-1143-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Tang W, Xiao YH. Research progress of physiological and molecular mechanisms of cadmium accumulation in rice. J Anhui Agric Sci. 2016;44(27):4–9. [Google Scholar]
  26. Tang L, Mao BG, Li YK, Lv QM, Zhang LP, Chen CY, He HJ, Wang WP, Zeng XF, Shao Y, Pan YL, Hu YY, Peng Y, Fu XQ, Li HQ, Xia ST, Zhao BR. Knockout of OsNramp5 using the CRISPR/Cas9 system produces low Cd-accumulating indica rice without compromising yield. Sci Rep. 2017;7(1):1–12. doi: 10.1038/s41598-017-14832-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Tezuka K, Miyadate H, Katou K, Kodama K, Matsumoto S, Kawamoto T, Masaki S, Satoh H, Yamaguchi M, Sakurai K, Takahashi H, Satoh-Nagasawa N, Watanabe A, Fujimura T, Akagi H. A single recessive gene controls cadmium translocation in the cadmium hyperaccumulating rice cultivar Cho-Ko-Koku. Theor Appl Genet. 2010;120(6):1175–1182. doi: 10.1007/s00122-009-1244-6. [DOI] [PubMed] [Google Scholar]
  28. Ueno D, Yamaji N, Kono I, Huanga CF, Andob T, Yanoc M, Ma JF. Gene limiting cadmium accumulation in rice. PNAS. 2010;107(38):16500–16505. doi: 10.1073/pnas.1005396107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ueno D, Koyama E, Yamaji N, Ma JF. Physiological, genetic, and molecular characterization of a high-Cd-accumulating rice cultivar. Jarjan J Exp Bot. 2011;62(7):2265–2272. doi: 10.1093/jxb/erq383. [DOI] [PubMed] [Google Scholar]
  30. Uraguchi S, Kamiya T, Sakamoto T, Kasaia K, Satoc Y, Nagamurac Y, Yoshidab A, Kyozukab J, Ishikawad S, Fujiwaraa T. Low-affinity cation transporter (OsLCT1) regulates cadmium transport into rice grains. PNAS. 2011;108(52):20959–20964. doi: 10.1073/pnas.1116531109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang YB, Hao M, Lei DY, Tang WB, Chen LY. Character of early growth and quick development of genic male sterility lines. Crop Res. 2014;28(4):341–344. [Google Scholar]
  32. Wang MA, Yin LH, Pen JX, Nie LL, Li YJ, He J, Zhang W, Ao HJ. Effects of VIP technology on reducing cadmium content in rice. China Rice. 2016;22(1):43–47. [Google Scholar]
  33. Wang P, Chen HP, Kopittke PM, Zhao FJ. Cadmium contamination in agricultural soils of China and the impact on food safety. Environ Pollut. 2019;249:1038–1048. doi: 10.1016/j.envpol.2019.03.063. [DOI] [PubMed] [Google Scholar]
  34. Xiong WT, Wang P, Yan TZ, Cao BB, Xu J, Liu DF, Luo MZ. The rice “fruit-weight 2.2-like” gene family member OsFWL4 is involved in the translocation of cadmium from roots to shoots. Planta. 2018;247(5):1247–1260. doi: 10.1007/s00425-018-2859-0. [DOI] [PubMed] [Google Scholar]
  35. Yang RF, Bai JJ, Fang J, Zeng W, Pu ZZ, Li GX. Establishment of marker-assisted selection system for breeding rice varieties with high resistant starch content. J Nucl Agric Sci. 2015;29(12):2259–2267. [Google Scholar]
  36. Zhang L, Zhang X, Li TX, Ji L, Zheng T. Cd uptake and distribution characteristics of Cd pollution-safe rice materials. Scientia Agricultura Sinica. 2015;48(1):174–184. [Google Scholar]
  37. Zhao JL, Yang W, Zhang SH, Yang TF, Liu Q, Dong JF, Fu H, Mao XX, Liu B. Genome-wide association study and candidate gene analysis of rice cadmium accumulation in grain in a diverse rice collection. Rice. 2018;11:61. doi: 10.1186/s12284-018-0254-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhu YW, Lin YR, Chen L. Advances in molecular breeding of rice in China. J Xiamen Univ (Natural Science) 2016;55(5):661–671. [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES