Abstract
In this study, we identified three neuroparsin (NP) genes in Macrobrachium nipponense: Mn-NP1, Mn-NP2, and Mn-NP3, encoding 99, 100, and 101 amino acid proteins, respectively. Multiple sequence alignments showed that these genes contained 12 cysteine residues, of which 11 were at conserved positions. The total sequence identity between the genes was 47.5%, and they showed a high degree of sequence identity (> 54% similarity) with other crustacean genes. Phylogenetic tree analysis showed that Mn-NPs were clustered at different branches, indicating that Mn-NPs may have different functions. Tissue distribution data revealed that the three genes were present in males and females during the breeding and nonbreeding season, but their expression patterns differed. Mn-NP1 was highly expressed in the breeding season, in the male testis, and highly expressed in the nonbreeding season, in the female ovary. Mn-NP3 exhibited biased female expression in the breeding and nonbreeding season, with dominant expression in the ovary. All Mn-NPs were detected during embryo development, but with different expression patterns. These data indicated that Mn-NP1 may function during embryonic development, and that Mn-NP2 may be expressed during early embryo cell division, and late larval development. Mn-NP3 expression patterns reflected maternal inheritance, and may be associated with ovarian maturation. These expression data suggested that Mn-NP1 and Mn-NP2 are negatively correlated with ovarian development, with inhibition roles during this development. Mn-NP3 may be involved in vitellogenesis.
Keywords: Macrobrachium nipponense, Neuroparsin, Ovary maturation, Reproduction
Introduction
Neuroparsins (NP) are neuroendocrine polypeptides first discovered in the migratory locust, Locusta migratoria. They encode 97–106 amino acid proteins, with predicted signal peptides and mature peptides of 25–29 and 72–77 amino acids, respectively (Girardie et al. 1989). The NP structure is similar to the N-terminal domain of the vertebrate insulin growth factor-binding protein, and may play important role in insulin-associated peptide signaling pathways during growth and development, by binding to endogenous insulin-like related peptides (Badisco et al. 2007). Polypeptides were initially isolated from brain neuroendocrine cells of L. migratoria, and later from Schistocerca gregaria, with reported inhibitory effects on vitellogenesis (Claeys et al. 2003; Janssen et al. 2001; Badisco et al. 2011). In addition, in insects, NPs may function in development, molting, reproduction, carbohydrate regulation, and lipid metabolism (Brown et al. 1998; Veenstra et al. 2010). In crustaceans, four neuroparsins (NP1–NP4) were discovered using transcriptome analysis of Scylla paramamosain, suggesting that NP1–3 may stimulate early vitellogenesis, whereas NP4 was implicated in late yolk accumulation (Bao et al. 2015). Two NPs, Mro-NP-1, and Mro-NP-2, were identified from transcriptomic sequencing data from the female Macrobrachium rosenbergii, with expression profile data indicating an involvement in ovary development (Suwansaard et al. 2015). However, NP functions in crustacean NPs remain unclear.
The oriental river prawn (Macrobrachium nipponense) is a valuable commercial fishery resource in China (Fu et al. 2012). In summer, female prawns have a short sexual maturity stage, which leads to prevalent individual miniaturization and bring risks for large-scale farming (Qiao et al. 2015). The main reason for this short stage is because the ovaries mature too fast. Therefore, it is important to study ovarian maturation in M. nipponense, academically and commercially. The crustacean eyestalk and cerebral ganglia are the main neuroendocrine system sites, from where several hormones involved in reproduction are secreted (Nagaraju 2011; Suwansaard et al. 2015). In our previous study investigating reproduction-related genes, we performed comparative transcriptomic analyses of the eyestalk and cerebral ganglia from the female M. nipponense, in the breeding and nonbreeding season. Three NP genes, Mn-NP1, Mn-NP2, and Mn-NP3, were significantly and differentially expressed in the eyestalk, between the breeding and nonbreeding seasons, suggesting a regulatory role in M. nipponense ovarian maturation (Qiao et al. 2017).
In this study, Mn-NP1, Mn-NP2, and Mn-NP3 were identified in M. nipponense. We investigated their expression patterns in different tissues, during ovary development and embryo stages. We also provide important reproductive information on the effects of NPs in M. nipponense females, and provide useful data which could improve female reproduction of this important crustacean species.
Materials and methods
Experimental prawns
Wild adult M. nipponense, weighing 2.0 ± 0.25 g, were collected from Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi, China. All prawns were transferred to the laboratory and cultured in indoor tanks with aerated freshwater. They were fed paludina twice a day for 1 week. Experimental prawns were anesthetized using MS222 (30 mg/L) anesthesia. No endangered or protected species were collected in this study. The research was approved by the Institutional Animal Care and Use Ethics Committee of the Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences (Wuxi, China).
Cloning and characterization of full-length Mn-NPs
Mn-NP ESTs were obtained from an M. nipponense eyestalk transcriptome cDNA library (NCBI, PRJNA339889). Prime Primer 5.0 was used to design 3′ and 5′ RACE primers. All primer sequences are listed (Table 1).
Table 1.
Universal and specific primers used in this study
| Primer name | Sequence(5′ → 3′) | Experiment |
|---|---|---|
| Mn-NP1-F | AAGATGAAGTCGTTTACTGCTGC | PCR(ORF) |
| Mn-NP1-R | GAAGTTGAAGGAGGAAGCAATCC | PCR(ORF) |
| Mn-NP2-F | AAGTCGTCCAGAACCTCAACAAT | PCR(ORF) |
| Mn-NP2-R | ACCAACCAACACCAGAAGATGAA | PCR(ORF) |
| Mn-NP3-F | TTCTCTCTTGTGGAGTGGAAGGA | PCR(ORF) |
| Mn-NP3-R | AGAAGAAGTAAGAGAGCGTCGTG | PCR(ORF) |
| Mn-NP1-qF | TGTACTCAACATGATCGTCCCC | Real-time PCR |
| Mn-NP1-qR | CCTTAGCGCACACTTCATTCCTA | Real-time PCR |
| Mn-NP2-qF | AATTCCTTCCGCTCCTTTGTCAT | Real-time PCR |
|
Mn-NP2-qR Mn-NP3-qF Mn-NP3-qR EIF-F (qPCR) EIF-R (qPCR) |
ACTCAAGATTTCCGCACCATCC ATCCTCCTGACTTCAATGCTGC TAGGTGCCGTATTTGCACGATT CATGGATGTACCTGTGGTGAAAC CTGTCAGCAGAAGGTCCTCATTA |
Real-time PCR Real-time PCR Real-time PCR Real-time PCR Real-time PCR |
| NP1-3′outer primer | GTGCTCCTCGTTGTACTCAACA | 3′RACE |
| NP1-3′inner primer | CTGATTGTGTGTCAACTGCTTGG | 3′RACE |
| NP2-3′outer primer | CCTTCCGCTCCTTTGTCATCTAC | 3′RACE |
| NP2-3′inner primer | GATGGTGCGGAAATCTTGAGTG | 3′RACE |
| NP3-3′outer primer | ACGATCCTCCTGACTTCAATGC | 3′RACE |
| NP3-3′inner primer | GACGCCATATTTTATGTGTGGGA | 3′RACE |
| NP1-5′outer primer | CCTTAGCGCACACTTCATTCCTA | 5′RACE |
| NP1-5′inner primer | ACACTTCATTCCTACACCAATCCA | 5′RACE |
| NP2-5′outer primer | TGGGAGCACATTTGACGATGTAA | 5′RACE |
| NP2-5′inner primer | ATGTAACACCCAGCACAGTATCC | 5′RACE |
| NP3-5′outer primer | TAGGTGCCGTATTTGCACGATT | 5′RACE |
| NP3-5′inner primer | GATTCGACGTTCACTTGTTGCC | 5′RACE |
Total RNA was extracted from eyestalks using RNAiso Plus Reagent (TaKaRa, Japan), according to the manufacturer’s instructions. A cDNA template was synthesized using Reverse Transcriptase M-MLV Kit (TaKaRa). RACE reactions were performed using a 3-full RACE Core Set Ver. 2.0 Kit and a 5′-full RACE Kit (TaKaRa). PCR products were separated using 1.2% agarose gel electrophoresis, and purified using a SanPrep ColuMn DNA Gel Extraction Kit (Sangon, China). Products were sequenced on an ABI3730 DNA Analyzer by Sangon Biotech Co., Ltd (Shanghai).
Sequences from RACE reactions were assembled using DNAMAN 6.0. The open-reading frame (ORF) finder program, https://ncbi.nlm.nih.gov/gorf/gorf.html, was used to predict amino acid sequences. Full-length Mn-NP cDNA sequences were analyzed using BLASTX and BLASTN databases (https://www.ncbi.nlm.nih.gov/BLAST/). Signal sequence predictions were performed using SignalP4.1 (https://www.cbs.dtu.dk/services/SignalP). SMART (https://smart.embl-heidelberg.de/) was used to predict and analyze basic physical protein properties, structural domains, signal peptides, transmembrane structures, and hydrophilic and hydrophobic properties. Multiple sequence alignments of amino acid sequences were performed using DNAMAN 6.0 software. A phylogenetic tree was generated using the neighbor-joining method by Molecular Evolutionary Genetics Analysis (MEGA 5.1) and bootstrapping replications were 1000.
Mn-NP tissue distribution in breeding and nonbreeding seasons
Various tissues including, eyestalk (Ey), brain (Br), heart (He), hepatopancreas (Hep), gill (Gi), muscle (Mu), and ovary (Ov)/testis (Te) were collected from mature prawns during the breeding season (BS, June 2019), and nonbreeding season (NBS, January 2019) (n = 5). Samples were dissected out and immediately frozen in liquid nitrogen, and then stored at − 80 °C until processed. Quantitative PCR (qPCR) was used to quantify Mn-NP mRNA expression levels.
Mn-NP expression patterns during development stages
Embryo developmental stages were microscopically observed and collected after spawning, using a previously published protocol (Zhang et al. 2013). Larvae were continuously collected every 5 days after hatching, from 1 to 15 days (P1–P15). Post-larvae were collected every 5 days, from 1 to 15 days after metamorphosis (PL1–PL15) (n = 5). Samples were processed as described above.
Mn-NP expression profiles during ovary maturation
The ovary development stages of adult female prawns have been classified into five stages, according to color (Qiao et al. 2015). We collected ovaries at different development stages (n = 5). Samples were processed as described above.
Quantitative real-time PCR (qPCR) and statistical analysis
QPCR (quantitative real-time reverse transcription PCR) was used to quantify Mn-NP mRNA expression levels. QPCR primers were designed using Prime Primer 5.0 according to the full-length sequence of Mn-NPs (Table 1). Complementary DNA synthesis and qPCR steps were performed as described previously (Xu et al. 2018). In reference to a previous study, eukaryotic translation initiation factor 5A (EIF) was chosen as a reference gene for relative quantification (Hu et al. 2018). Messenger RNA expression levels were calculated using the 2−ΔΔCT method (Livak et al. 2001). Statistical analyses were performed using SPSS 20.0. Statistical differences were estimated using one-way ANOVA, followed by Duncan's multiple range tests. The significance level was set to p < 0.05 and p < 0.01.
Results
Mn-NP sequence analysis
The full-length sequences of all three Mn-NP genes were obtained by RACE, and were named Mn-NP1, Mn-NP2, and Mn-NP3.
Mn-NP1 (Genbank accession number MG783403) was 2024 base pairs (bp), including a 300 bp ORF encoding a 99-amino acid protein. The 5′ and 3′ un-translated region (UTR) comprised 363 bp and 1361 bp, respectively. The predicted molecular mass was 10.8 kD, and the calculated isoelectric point (pI) was 7.99. Sequence analyses predicted that Mn-NP1 had a signal peptide of 24 amino acids that yielded a mature peptide of 75 amino acid residues. A transmembrane region was not identified (Fig. 1a).
Fig. 1.
Multiple sequence alignment of the deduced amino acid sequences of three Mn-NP genes using DNAman. Similar residues were shaded, with the highlight homology level ranging from dark black (100% identity), rose (100–75%), and gaps are introduced to maximize the alignment. All proteins have the same structural organization nearly: signal peptide of N-terminal. 12 positionally conserved cysteine residues are marked with red box. Sp, Scylla paramamosain; Cq, Cherax quadricarinatus; Me, Metapenaeus ensis; Jl, Jasus lalandii; Pm, Penaeus monodon; Pt, Portunus trituberculatus
Mn-NP2 (Genbank accession number MG783404) was 2271 bp long, and contained a 303 bp ORF encoding 100 amino acids. The 5′ and 3′ UTR were 129 bp and 1873 bp, respectively. The theoretical pI was 7.43, and the estimated molecular mass was 10.7 kD. It had a signal peptide of 26 amino acids that yielded a mature peptide of 74 amino acids. The transmembrane region was located at amino acid position 7–26 (Fig. 2a).
Fig. 2.
Phylogenetic tree based on the alignment of known amino acid sequences of three Mn-NP proteins. The diagram was generated by the neighbor-joining method using the MEGA 5.0 program. Bootstrapping replications were 1000. The numbers shown at the branches indicate the bootstrap values (%). Genbank accession numbers are in brackets
Mn-NP3 (Genbank accession number MG783405) was 1433 bp long, and contained a 306 bp ORF encoding 101 amino acids. The theoretical pI was 7.43, with an estimated molecular mass of 10.7 kD. The 5′ and 3′ UTR were 227 bp and 900 bp, respectively. Sequence analyses predicted that Mn-NP3 had a signal peptide of 27 amino acids that yielded a mature peptide of 74 amino acids. The transmembrane region was located at amino acid position 10–32 (Fig. 3a).
Fig. 3.
Tissue distribution of Mn-NP1 in male and female M. nipponense of breeding season (BS) and nonbreeding season (NBS) revealed by qPCR. Ey, eyestalk; Br, brain; He, heart; Hep, hepatopancreas; Gi, gill; Mu, muscle; Te, testis; Ov, ovary. NBS, nonbreeding season; BS, breeding season. Data were shown as means ± SD (standard deviation) of three separate individuals in the tissues. Bars with different letters were significantly different (p < 0.05)
Mn-NP sequence alignment and phylogenetic analysis
All three Mn-NP sequences contained 12 cysteine residues at conserved positions, and were involved in disulfide bridge formation (Fig. 1). Amino acid sequence alignments were also performed for all Mn-NPs. Sequence identity between the Mn-NPs was approximately 47.5%. Mn-NP1 was more similar to Mn-NP3 (43.2%), than to Mn-NP2 (33.6%), while Mn-NP2 was 40.4% identical to Mn-NP3. The cysteine regions were highly conserved, with the main differences appearing in N-terminal regions. Mn-NP amino acid sequences were also homology compared to other NPs from crustaceans and insects. Based on BLAST data, Mn-NP1 showed 62% amino acid identity with Sp-NP1 (Scylla paramamosain), and Mn-NP2 shared 55.4% identity with Cq-NP1 (Cherax quadricarinatus). Mn-NP3 showed 54.6% amino acid identity with Me-NP (Metapenaeus ensis).
A phylogenetic tree was constructed using crustacean and insect NPs (Fig. 2). The results showed that Mn-NP1 was clustered with Cq-NP2 from C. quadricarinatus, and then further clustered with Sp-NP1 from S. paramamosain and Pt-NP from Portunus trituberculatus. Mn-NP2 was clustered with Cq-NP1 from C. quadricarinatus and Jl-NP from Jasus lalandii. Mn-NP3 was clustered with Me-NP from M. ensis and Pm-NP from Penaeus monodon. All NP sequences were clearly divided into two distinct clusters, i.e., crustaceans and insects.
Mn-NP tissue distribution
Expression profiles for Mn-NPs in breeding and nonbreeding seasons, and in male and female adults were investigated. All three Mn-NPs displayed different expression patterns across various tissues.
Mn-NP1 (Fig. 3) was distributed in all tissues, in both males and females, in breeding and nonbreeding seasons. The highest expression levels were identified in gonads, and the lowest in hepatopancreas (p < 0.01). Mn-NP1 levels in eyestalks were significantly higher in the breeding season, when compared with the nonbreeding season (p < 0.05). However, the opposite was true for other somatic tissues. Mn-MP expression levels also exhibited sex differences in breeding and nonbreeding seasons. In males, Mn-NP1 was highly expressed in testis in the breeding season, but poorly expressed in the nonbreeding season (p < 0.01). In females, Mn-NP1 had the opposite expression pattern; highly expressed in the ovaries in the nonbreeding season, and poorly expressed in the breeding season.
When compared to Mn-NP1, Mn-NP2 had very different expression levels (Fig. 4). It was detected in all tissues, in both males and females, in breeding and nonbreeding seasons. The highest expression was detected in the heart (p < 0.01), while other tissues exhibited relatively low expression. Mn-NP2 expression in all tissues was higher in the nonbreeding season, when compared to the breeding season. The gonads expressed very low levels, when compared with other somatic tissues.
Fig. 4.
Tissue distribution of Mn-NP2 in male and female M. nipponense of breeding season (BS) and nonbreeding season (NBS) revealed by qPCR. It was normalized to the eukaryotic translation initiation factor 5A (EIF) transcript level. Ey eyestalk; Br brain; He heart; Hep hepatopancreas; Gi gill; Mu muscle; Te testis; Ov ovary. NBS, nonbreeding season; BS, breeding season. Data were shown as means ± SD (standard deviation) of three separate individuals in the tissues. Bars with different letters were significantly different (p < 0.05)
Mn-NP3 also showed different expression patterns in both males and females, in breeding and nonbreeding seasons (Fig. 5). In males, Mn-NP3 was highly expressed in somatic tissues, such as the hepatopancreas, heart, and eyestalk, but was lower in testis, gill, and muscle (p < 0.01). All tissues showed high expression levels in the nonbreeding season, when compared to the breeding season, except for testis (p < 0.05). The heart had the highest expression (p < 0.01). However, in females, the ovary exhibited the highest expression levels, but other somatic tissues had very low expression (p < 0.01). Some tissues, such as muscle and gill, exhibited very poor expression. Mn-NP3 expression in the ovary exhibited seasonal differences; expression levels were significantly higher in the nonbreeding season when compared to the breeding season (p < 0.01).
Fig. 5.
Tissue distribution of Mn-NP3 in male and female M. nipponense of breeding season (NBS) and nonbreeding season (NBS) revealed by qPCR. It was normalized to the eukaryotic translation initiation factor 5A (EIF) transcript level. Ey eyestalk; Br brain; He heart; Hep hepatopancreas; Gi gill; Mu muscle; Te testis; Ov ovary. NBS nonbreeding season; BS breeding season. Data are shown as mean ± SD (n = 5). Statistical analyses were performed with one-way ANOVA analysis. Bars with different letters were considered significant at p < 0.05
Mn-NP expression profiles during development stages
Mn-NP mRNA expression levels were quantified by qPCR at different developmental stages (Fig. 6); all three Mn-NPs showed significant differences in expression levels.
Fig. 6.
Transcriptional patterns of three Mn-NPs during embryonic development revealed by qPCR. It was normalized to the eukaryotic translation initiation factor 5A (EIF) transcript level. CS cleavage stage, BS blastula stage, GS gastrula stage, NS nauplius stage, ZS zoea stage, and L1 the first-day larvae after hatching. Post-larvae were collected every 5 days (d) from 1 to 15 days after the metamorphosis (PL1–PL15). Data are shown as mean ± SD (n = 5). Statistical analyses were performed with one-way ANOVA analysis. Bars with different letters were considered significant at p < 0.05
During embryonic development stages, Mn-NP1 was increasingly expressed with embryonic development, and reached a peak in the zoea stage (p < 0.01). Levels were significantly decreased after hatching, and expression levels fluctuated at relatively low levels during larval stages (p > 0.05), but increased in post larva stages after metamorphosis.
Mn-NP2 showed significantly higher expression levels in the breeding season (p < 0.05). In other embryonic and larva stages, expression levels were relatively low, with no fluctuations (p > 0.05). After metamorphosis, Mn-NP2 expression was significantly increased (p < 0.05).
Mn-NP3 displayed extremely high expression in the cleavage stage (p < 0.01), and then significantly decreased with embryo development, until hatching. Levels were very low in larva and post larva stages (p > 0.05).
Mn-NPs expression in adult ovary cycles
Mn-NP expression patterns in adult ovary cycles were quantified throughout the reproductive cycle (Fig. 7). Mn-NP3 showed significantly higher expression levels than the other two Mn-NPs (p < 0.01). Mn-NP1 and Mn-NP2 expression levels exhibited no differences (p > 0.05). Mn-NP1 was negatively correlated with ovary development. Expression levels decreased significantly from stage I to stage IV, but increased significantly in stage V (p < 0.01). Mn-NP2 exhibited some differences with Mn-NP1; its expression levels decreased significantly from stage I to stage III (p < 0.05). When compared to Mn-NP1, Mn-NP2 expression levels increased more than 35-fold in stage IV and V (p < 0.01). Mn-NP3 exhibited opposite expression patterns to Mn-NP1 and Mn-NP2; its expression levels increased significantly from stage I to stage III, then suddenly decreased in stage IV (p < 0.01). However, levels increased in stage V after ovulation (p < 0.05).
Fig. 7.
Expression profiles of three Mn-NPs in different ovary development stages revealed by qPCR. It was normalized to the eukaryotic translation initiation factor 5A (EIF) transcript level. OI undeveloped stage, OII developing stage, OIII nearly-ripe stage, OIV ripe stage, OV spent stage. Data are shown as mean ± SD (n = 5). Statistical analyses were performed with one-way ANOVA analysis. Bars with different letters were considered significant at p < 0.05
Discussion
In this study, multiple sequence alignments indicated that all three Mn-NPs contained 12 cysteine residues, 11 of which were in conserved positions. Similarly, all three genes revealed high sequence identity with other crustacean genes. Most of these conserved residues were located between Cys2 and Cys1; the region around Cys4 and Cys5 was the most highly conserved. Apart from these Cys residues, there were no other conserved residues at the N-terminus (between Cys1 and Cys2) and the C-terminus (between Cys11 and Cys12). These cysteine residues are also found in other decapoda, such as S. gregaria, N. viridula, and J. lalandii (Janssen et al. 2001; Marco et al. 2014). Although NP gene sequences from different species contained 12 cysteine residues, there were large differences at other sites. Phylogenetic tree analyses showed that Mn-NPs were similar to NPs from other species; Mn-NPs were most closely related to crustacean NPs. Different NP gene subtypes, derived from the same species, were not completely clustered to the same branches. This result suggested differences in gene structures and significant functional differentiation. Insect NP genes were divided into two different orders, further suggesting that NPs may have greater differentiation during development.
Previous insect studies have shown that NPs have different expression patterns. In S. gregaria, NPP1 and NPP2 were predominantly expressed in the brain, whereas NPP3 and NPP4 were expressed in the brain, ventral nerve cord, fat body, and muscle (Claeys et al. 2006, 2005). In recent crustacean research on S. paramamosain, four Sp-NP genes were identified in the central nervous system, which also supported this conclusion (Bao et al. 2015). Furthermore, Sp-NP1 and Sp-NP2 were expressed in the stomach, and Sp-NP3 and Sp-NP4 were expressed in the ovary (Bao et al. 2015). These observations indicated that NP expression profiles differ in various species, and play distinct roles. In our study, the tissue distribution of the three Mn-NP genes was identified in both males and females, in breeding and nonbreeding seasons. Their expression patterns varied greatly. The main organs where Mn-NP genes were expressed included not only the eyestalk and brain, but also the heart and hepatopancreas. In M. rosenbergii, NPs were mainly expressed in gill and eyestalk, with low levels recorded in the ovary (Suwansaard et al. 2015). Mn-NP1 and Mn-NP3 showed significantly higher expression in the gonad, suggesting an involvement in gonad development. This tissue specificity may be related to the multiple physiological functions peptides. Mn-NP1 was highly expressed in breeding season testis, when compared to the nonbreeding season, while conversely, it was strongly expressed in the nonbreeding ovary, and poorly expressed in the breeding season ovary. These results indicated that Mn-NP1 may play roles in reproduction processes, promoting testis development and maintaining ovary immaturity. Mn-NP3 showed a biased female expression pattern in both breeding and nonbreeding seasons, with a dominant expression at the ovary, when compared to other somatic tissue. The difference here is that the testis expression of Mn-NP3 is much lower than other tissues. We speculate that Mn-NP3 is involved in ovary development.
Earlier reports did not identify NP expression during embryo development. For the first time, we monitored changes in Mn-NP expression during all the developmental stages of M. nipponense. The three Mn-NP genes were expressed throughout embryo development, suggesting that these genes may play roles in growth and development. Mn-NP1 expression increased from CS to ZS, indicating an important role in embryonic development. Mn-NP2 was expressed at low levels before metamorphosis except for BS, which showed Mn-NP2 a strong part in early embryo cell division and late larval development. Mn-NP3 expression patterns appeared to reflect maternal inheritance; levels gradually decreased as the embryo developed. Then, later in post-embryo development, it was poorly expressed, suggesting that Mn-NP3 is only associated with ovarian maturation.
Since Mn-NP genes are closely related to ovarian development, we studied NP expression profiles in the ovary at different maturation stages. Mn-NP1 and Mn-NP2 expression profiles were similar. Both were decreased with ovary development, but at stage V, the expression of both significantly increased. This result indicated that Mn-NP1 and Mn-NP2 were negatively correlated with ovarian development, and thus may play an inhibiting role in this development. Mn-NP3 expression profiles were quite different to the other Mn-NPs. Expression showed an upward trend from stage I to III, and exhibited a significant decrease at stage IV. Stages I–III are critical vitellogenesis periods. In S. paramamosain, NP4 is continuously up-regulated during vitellogenesis, however, the expression patterns of the other three NPs, NP1, NP2, and NP3 were not the same (Bao et al. 2015). According to our Mn-NP3 expression data in ovary development and embryo development stages, we hypothesize that Mn-NP3 is involved in vitellogenesis.
In conclusion, we identified three NPs from M. nipponense, Mn-NP1, Mn-NP2, and Mn-NP3. All were involved in reproduction, playing various roles at different tissues, growth development, and ovary development stages. Mn-NP1 and Mn-NP2 may exert inhibitory roles during ovary maturation, but Mn-NP3 may be involved in promoting ovarian development. Further research is required to study NP regulatory mechanisms in reproduction, and apply the data to M. nipponense aquaculture.
Acknowledgements
This research was supported by Central Public interest Scientific Institution Basal Research Fund CAFS (2019JBFM04;2020TD36); Grants from the National Key R&D Progrom of China (2018YFD0901303); Jiangsu Agricultural Industry Technology System (JATS [2020] 461); The New cultivar breeding Major Project of Jiangsu province (PZCZ201745); the China Agriculture Research System-48 (CARS-48).
Appendix
Fig. 8.
Nucleotide and deduced amino acid sequence of M. nipponense Neuroparsin 1 gene (Mn-NP1) cDNA. 3′UTR and 5′ UTR are listed with lowercase letters. ORF are showed by capital letters. The polyadenylation signal (aataa) is marked with double underline. The signal peptide is marked with single underline. Conserved cysteine residues are marked with shadow
Fig. 9.
Nucleotide and deduced amino acid sequence of M. nipponense Neuroparsin 2 gene (Mn-NP2) cDNA. 3′UTR and 5′ UTR are listed with lowercase letters. ORF are showed by capital letters. The polyadenylation signal (aataa) is marked with double underline. The signal peptide is marked with single underline. Conserved cysteine residues are marked with shadow
Fig. 10.
Nucleotide and deduced amino acid sequence of M. nipponense Neuroparsin 3 gene (Mn-NP3) cDNA. 3′UTR and 5′ UTR are listed with lowercase letters. ORF are showed by capital letters. The polyadenylation signal (aataa) is marked with double underline. The signal peptide is marked with single underline. Conserved cysteine residues are marked with shadow
Compliance with ethical standards
Conflicts of interest
The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results
Footnotes
Hui Qiao and Yiwei Xiong have contributed equally to this work and should be considered co-first authors.
References
- Badisco L, Claeys I, Van LT, Van HM, Franssens V, Simonet G, Broeck JV. Neuroparsins, a family of conserved arthropod neuropeptides. Gen Comp Endocrinol. 2007;153(1–3):64–71. doi: 10.1016/j.ygcen.2007.03.008. [DOI] [PubMed] [Google Scholar]
- Badisco L, Marchal E, Van Wielendaele P, Verlinden H, Vleugels R, Broeck JV. RNA interference of insulin-related peptide and neuroparsins affects vitellogenesis in the desert locust. Schistocerca gregaria. 2011;32(3):573–580. doi: 10.1016/j.peptides.2010.11.008. [DOI] [PubMed] [Google Scholar]
- Bao C, Yang Y, Huang H, Ye H. Neuropeptides in the cerebral ganglia of the mud crab, Scylla paramamosain: transcriptomic analysis and expression profiles during vitellogenesis. Scient Rep. 2015;5:17055. doi: 10.1038/srep17055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brown MR, Graf R, Swiderek KM, Fendley D, Stracker TH, Champagne DE, Lea AO. Identification of a steroidogenic neurohormone in female mosquitoes. J Biol Chem. 1998;273(7):3967–3971. doi: 10.1074/jbc.273.7.3967. [DOI] [PubMed] [Google Scholar]
- Claeys I, Simonet G, Van LT, De LA, Vanden Broeck J. cDNA cloning and transcript distribution of two novel members of the neuroparsin family in the desert locust, Schistocerca gregaria. Insect Mol Biol. 2003;12:473–481. doi: 10.1046/j.1365-2583.2003.00431.x. [DOI] [PubMed] [Google Scholar]
- Claeys I, Simonet G, Breugelmans B, Van SS, Franssens V, Sas F, Vanden BJ. Quantitative real-time RT-PCR analysis in desert locusts reveals phase dependent differences in neuroparsin transcript levels. Insect Mol Biol. 2005;14(4):415–422. doi: 10.1111/j.1365-2583.2005.00572.x. [DOI] [PubMed] [Google Scholar]
- Claeys I, Breugelmans B, Simonet G, Van SS, Sas F, De LA, Broeck JV. Neuroparsin transcripts as molecular markers in the process of desert locust (Schistocerca gregaria) phase transition. Biochem Biophys Res Commun. 2006;341(2):599–606. doi: 10.1016/j.bbrc.2006.01.011. [DOI] [PubMed] [Google Scholar]
- Fu H, Jiang S, Xiong Y. Current status and prospects of farming the giant river prawn (Macrobrachium rosenbergii) and the oriental river prawn (Macrobrachium nipponense) in China. Aquac Res. 2012;43(7):993–998. doi: 10.1111/j.1365-2109.2011.03085.x. [DOI] [Google Scholar]
- Girardie J, Girardie A, Huet JC, Pernollet JC. Amino acid sequence of locust neuroparsins. FEBS Lett. 1989;245(1–2):4–8. doi: 10.1016/0014-5793(89)80179-6. [DOI] [PubMed] [Google Scholar]
- Hu Y, Fu H, Qiao H, Sun S, Zhang W, Jin S, Wu Y. Validation and evaluation of reference genes for quantitative real-time PCR in Macrobrachium Nipponense. Int J Mol Sci. 2018;19(8):2258. doi: 10.3390/ijms19082258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Janssen T, Claeys I, Simonet G, De LA, Girardie J, Broeck JV. cDNA cloning and transcript distribution of two different neuroparsin precursors in the desert locust Schistocerca gregaria. Insect Mole Biol. 2001;10(2):183–189. doi: 10.1046/j.1365-2583.2001.00257.x. [DOI] [PubMed] [Google Scholar]
- Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- Marco HG, Anders L, Gäde G. cDNA cloning and transcript distribution of two novel members of the neuroparsin peptide family in a hemipteran insect (Nezara viridula) and a decapod crustacean (Jasus lalandii) Peptides. 2014;53:97–105. doi: 10.1016/j.peptides.2013.10.013. [DOI] [PubMed] [Google Scholar]
- Nagaraju GPC. Reproductive regulators in decapod crustaceans: an overview. J Exp Biol. 2011;214(1):3–16. doi: 10.1242/jeb.047183. [DOI] [PubMed] [Google Scholar]
- Qiao H, Xiong Y, Zhang W, Fu H, Jiang S, Sun S, Gong Y. Characterization, expression, and function analysis of gonad-inhibiting hormone in Oriental River prawn, Macrobrachium nipponense and its induced expression by temperature. Comp Biochem Physiol A Mol Integr Physiol. 2015;185:1–8. doi: 10.1016/j.cbpa.2015.03.005. [DOI] [PubMed] [Google Scholar]
- Qiao H, Fu H, Xiong Y, Jiang S, Sun S, Jin S, Wu Y. Molecular insights into reproduction regulation of female Oriental River prawns Macrobrachium nipponense through comparative transcriptomic analysis. Scient Rep. 2017;7(1):12161. doi: 10.1038/s41598-017-10439-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Suwansaard S, Thongbuakaew T, Wang T, Zhao M, Elizur A, Hanna PJ, Sretarugsa P, Cummins SF, Sobhon P. In silico neuropeptidome of female Macrobrachium rosenbergii based on transcriptome and peptide mining of eyestalk, central nervous system and ovary. PLoS ONE. 2015;10(5):e0123848. doi: 10.1371/journal.pone.0123848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Veenstra JA. what the loss of the hormone neuroparsin in the melanogaster subgroup of Drosophila can tell us about its function. Insect Biochem Mol Biol. 2010;40(4):354–361. doi: 10.1016/j.ibmb.2010.03.001. [DOI] [PubMed] [Google Scholar]
- Xu L, Yang M, Fu H, Sun S, Qiao H, Zhang W. Molecular cloning and expression of MnGST-1 and MnGST-2 from Oriental River Prawn, Macrobrachium nipponense, in response to hypoxia and reoxygenation. Int J Mol Sci. 2018;19(10):3102. doi: 10.3390/ijms19103102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang YP, Qiao H, Zhang WY, Sun SM, Jiang SF, Gong YS, Fu HT. Molecular cloning and expression analysis of two sex-lethal homolog genes during development in the oriental river prawn Macrobrachium nipponense. Gene Mole Res. 2013;12(4):4698–4711. doi: 10.4238/2013.October.18.8. [DOI] [PubMed] [Google Scholar]