Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Nov 19.
Published in final edited form as: Mol Cell. 2020 Oct 12;80(4):726–735.e7. doi: 10.1016/j.molcel.2020.09.028

H3 K27M and EZHIP Impede H3K27-Methylation Spreading by Inhibiting Allosterically Stimulated PRC2

Siddhant U Jain 1, Andrew Q Rashoff 1,5, Samuel D Krabbenhoft 1,5, Dominik Hoelper 1, Truman J Do 1, Tyler J Gibson 1, Stefan M Lundgren 1, Eliana R Bondra 1, Shriya Deshmukh 2, Ashot S Harutyunyan 3,4, Nikoleta Juretic 3,4, Nada Jabado 3,4, Melissa M Harrison 1, Peter W Lewis 1,6,*
PMCID: PMC7680438  NIHMSID: NIHMS1635000  PMID: 33049227

SUMMARY

Diffuse midline gliomas and posterior fossa type A ependymomas contain the recurrent histone H3 lysine 27 (H3 K27M) mutation and express the H3 K27M-mimic EZHIP (CXorf67), respectively. H3 K27M and EZHIP are competitive inhibitors of Polycomb Repressive Complex 2 (PRC2) lysine methyltransferase activity. In vivo, these proteins reduce overall H3 lysine 27 trimethylation (H3K27me3) levels; however, residual peaks of H3K27me3 remain at CpG islands (CGIs) through an unknown mechanism. Here, we report that EZHIP and H3 K27M preferentially interact with PRC2 that is allosterically activated by H3K27me3 at CGIs and impede its spreading. Moreover, H3 K27M oncohistones reduce H3K27me3 in trans, independent of their incorporation into the chromatin. Although EZHIP is not found outside placental mammals, expression of human EZHIP reduces H3K27me3 in Drosophila melanogaster through a conserved mechanism. Our results provide mechanistic insights for the retention of residual H3K27me3 in tumors driven by H3 K27M and EZHIP.

Graphical Abstract

graphic file with name nihms-1635000-f0001.jpg

In Brief

H3 K27M and EZHIP drive pediatric gliomas by inhibiting Polycomb Repressive Complex 2 activity. Jain et al. show that EZHIP and H3 K27M interact with allosterically stimulated PRC2 at its recruitment sites In vivo and impede its spreading. Chromatin deposition of H3 K27M is not necessary for the reduction of H3K27me3 In vivo.

INTRODUCTION

Diffuse midline gliomas (DMGs) are highly aggressive pediatric tumors with poor prognoses. About 80% of DMGs contain the recurrent histone H3 lysine 27 (H3 K27M) mutation in genes en-coding histone H3 proteins that are assembled into nucleosomes through replication-coupled (H3.1/2) and replication-independent mechanisms (H3.3) (Schwartzentruber et al., 2012; Wu et al., 2012). Despite representing a small fraction of total histone H3 (3%–17%), H3 K27M causes a global reduction in levels of H3 lysine 27 trimethylation (H3K27me3) in DMGs (Bender et al., 2013; Chan et al., 2013; Larson et al., 2019; Lewis et al., 2013). Posterior fossa type A ependymomas (PFA ependymomas) display similar gene expression, DNA methylation, and low H3K27me3 profiles as DMGs (Bayliss et al., 2016). Instead of containing the recurrent H3 K27M mutations, PFA ependymomas aberrantly express a newly discovered gene, EZHIP (CXorf67) (Pajtler et al., 2018). EZHIP-expressing ependymomas display a poorer prognosis than other posterior fossa ependymomas.

Polycomb Repressive Complex 2 (PRC2) catalyzes H3K27me3, which is involved in transcriptional silencing. The EZHIP and H3 K27M oncoproteins are competitive inhibitors of PRC2 (Jain et al., 2019). A peptide within EZHIP mimics the H3 K27M sequence and is necessary and sufficient to inhibit PRC2 activity and reduce H3K27me3 levels in cells (Hübner et al., 2019; Jain et al., 2019; Piunti et al., 2019; Ragazzini et al., 2019). However, hundreds of CpG islands (CGIs) that represent high-affinity PRC2-binding sites retain residual H3K27me3 (Jain et al., 2019). Residual PRC2 activity is necessary for the survival of H3K27M-containing gliomas (Harutyunyan et al., 2019; Mohammad et al., 2017; Piunti et al., 2017), and it has been proposed that the retention of H3K27me3 at CGIs is necessary to silence tumor suppressor genes and maintain cell proliferation. Nonetheless, the molecular mechanism by which EZHIP and H3 K27M reduce H3K27me3 specifically from intergenic regions but disproportionately retain H3K27me3 at CGIs remains elusive.

PRC2 interacts with unmethylated CGIs through its auxiliary subunits, Polycomb-like proteins (PCLs) or JARID2, where it catalyzes high levels of H3K27me3 (Healy et al., 2019; Højfeldt et al., 2019; Li et al., 2017; Pasini et al., 2010). H3K27me3, initially catalyzed at CGIs, interacts with its EED subunit of PRC2 and allosterically stimulates its catalytic activity by ~8-fold (Margueron et al., 2009). This “read-write” mechanism triggers PRC2 spread into the intergenic regions and formation of broad H3K27me3 domains. Remarkably, the inhibitory potential of H3 K27M and EZHIP oncoproteins is substantially enhanced by allosteric stimulation of PRC2 in vitro (Diehl et al., 2019; Jain et al., 2019; Justin et al., 2016; Stafford et al., 2018). It is unclear if the preferential inhibition of allosterically stimulated PRC2 by EZHIP and H3 K27M plays a functional role In vivo.

Several studies demonstrated that H3 K27M directly contacts and inhibits PRC2 in vitro (Bender et al., 2013; Brown et al., 2014; Jain et al., 2019; Justin et al., 2016; Lewis et al., 2013; Stafford et al., 2018). However, direct inhibition of PRC2 by H3 K27M oncohistones In vivo is still debated (Delaney et al., 2019; Piunti et al., 2017; Stafford et al., 2018). Instead, it has been proposed that H3 K27M reduces H3K27me3 in cis by altering histone post-translational modifications locally through the formation of heterotypic nucleosomes (Herz et al., 2014; Piunti et al., 2017). These heterotypic nucleosomes, in turn, reduce H3K27me3 in cis by evicting PRC2 from genomic regions where H3 K27M oncohistones are incorporated. Therefore, the molecular mechanism through which H3 K27M reduces H3K27me2/3 in cells remains controversial.

Here, we demonstrate that EZHIP preferentially interacts with allosterically stimulated PRC2. EZHIP impedes PRC2 spreading by stabilizing a high-affinity complex between H3K27me3-PRC2-EZHIP at CGIs containing residual H3K27me3. Using Tandem ChIP (reChIP) experiments, we demonstrate that H3 K27M proteins interact with and stall PRC2 at CGIs. Moreover, supporting the trans mechanism of action, incorporation of H3 K27M proteins into nucleosomes is not necessary for the reduction of H3K27me3 in cells. Finally, despite its absence outside placental mammals, we demonstrate that EZHIP reduces H3K27me3 in Drosophila melanogaster through a conserved molecular mechanism. In summary, we provide evidence that EZHIP and H3 K27M bind PRC2 In vivo and reduce H3K27me2/3 in trans by blocking PRC2 spreading.

RESULTS

EZHIP Preferentially Interacts with Allosterically Stimulated PRC2 In Vitro and In vivo

Expression of EZHIP in cells leads to an overall reduction of H3K27me3; however, residual H3K27me3 is retained at CGIs (Figure S1A; Jain et al., 2019). Using chromatin immunoprecipitation sequencing (ChIP-seq), we found that EZHIP and EZH2 colocalized with residual H3K27me3 at CGIs (Figures 1A, 1B, S1B, and S1C). Depletion of PRC2, through genetic ablation of Eed, abolished the EZHIP ChIP signal suggesting that EZHIP binds to chromatin indirectly through PRC2 (Figures 1A, 1B, S1D, and S1E). A K27M-like peptide (KLP) within the C terminus of EZHIP interacts with the EZH2 active site residues (where M406 is equivalent to H3 K27M) (Jain et al., 2019). Consequently, EZHIP M406E failed to inhibit PRC2 in vitro and did not immunoprecipitate PRC2 subunits from nuclear extract (Figures 1C, 1D, and S1D). Moreover, EZHIP M406E did not colocalize with PRC2 and H3K27me3 at CGIs In vivo (Figures 1E, S1F, and S1G). These data linked in vitro PRC2 inhibition to In vivo interaction between EZHIP and EZH2 at CGIs and reduction of H3K27me3.

Figure 1. EZHIP Preferentially Interreacts with Allosterically Stimulated PRC2 In Vitro and In vivo.

Figure 1.

(A and B) EZH2, H3K27me3, and EZHIP ChIP-seq enrichments in Eedf/f or Eed−/− MEFs expressing FLAG-tagged EZHIP. Heatmap displaying ChIP enrichments at all EZHIP peaks in shown in (B).

(C) PRC2 inhibition assays by EZHIP wild-type (WT) or M406E using oligonucleosome substrates.

(D) FLAG-immunoprecipitation of FLAG-tagged EZHIP WT or M406E from MEFs.

(E) H3K27me3 and FLAG-EZHIP ChIP enrichment in MEFs expressing EZHIP WT or M406E.

(F) The H3K27me3-EED interaction stabilizes a PRC2 conformation that has an increased affinity for EZHIP.

(G) Peptide pull-downs of rPRC2 with EZHIP KLP peptide in the presence or absence of the H3K27me3 stimulatory peptide.

(H) FLAG-immunoprecipitation of FLAG-tagged EZHIP from MEFs in the presence or absence of A-395.

(I) IC50 (Half Maximal Inhibitory Concentration) of PRC2 inhibition by the EZHIP KLP peptide with or without A-395 in the reactions. Error bars represent standard error.

Previously, we showed that the PRC2 inhibitory potential of EZHIP is significantly enhanced in the presence of the H3K27me3 peptide (Jain et al., 2019). The interaction between EED and H3K27me3 is proposed to induce a conformation of EZH2 that has increased affinity toward its substrates and competitive inhibitors, such as EZHIP (Figure 1F). Indeed, EZHIP KLP captured more PRC2 in the presence of H3K27me3 in vitro (Figure 1G). Similarly, EZHIP co-immunoprecipitated substantially lower amounts of PRC2 subunits and displayed lower PRC2 inhibitory potential in the presence of A-395, a small molecule that binds to EED and competes with H3K27me3 (He et al., 2017; Figures 1H and 1I). These data suggest that EZHIP has an increased affinity for allosterically stimulated PRC2 and help explain the paradox that the inhibitor EZHIP interacts with PRC2 at sites containing H3K27me3 In vivo.

Our results indicated that EZHIP interacts with allosterically stimulated PRC2, which is bound to H3K27me3 through EED (Figure S2A). Elimination of residual H3K27me3 using the S-adenosyl methionine analog tazemetostat led to a substantial reduction of EZH2 and, hence, EZHIP at CGIs (Figures S2B and S2C). These results suggest that H3K27me3 helps to stabilize PRC2 on chromatin, likely through an interaction with the EED subunit. To confirm that PRC2 interacts with H3K27me3 at CGIs through EED, we rescued EED−/− cells with EED Y365A, a mutant that does not bind H3K27me3 (Figure S2D; Oksuz et al., 2018). Indeed, PRC2 recruitment was reduced 4-fold by the Y365A mutation (Figures S2E–S2G), suggesting that most PRC2 molecules at CGIs assume the allosterically stimulated conformation. Taken together, our experiments indicate that EZHIP forms a high-affinity complex with allosterically stimulated EZH2 at CGIs (Figure 1F).

EZHIP Reduces PRC2 Spreading by Stalling It at CGIs

We hypothesize that the formation of a catalytically inactive ternary complex, H3K27me3-PRC2-EZHIP, restrains PRC2 from spreading into the intergenic regions. If this is true, we would expect increased PRC2 residency at CGIs in cells expressing Ezhip (Figures 2A and S3A). Indeed, expression of wild-type Ezhip, but not the PRC2-binding-deficient M406E mutant, led to a substantial increase of EZH2 occupancy at residual H3K27me3 sites containing high CpG density (Figures 2B, 2C, and S3B–S3F). Simultaneously, EZH2 enrichment was significantly reduced from CpG-poor domains of H3K27me3 (Figures S3C and S3D). To test our model in human cancers, we used SUZ12 CUT&RUN data from U2OS cells that express endogenous EZHIP (Ragazzini et al., 2019). Mirroring our results in MEFs expressing Ezhip, U2OS cells exhibited sharp SUZ12 peaks, which redistributed to broader intergenic domains upon the loss of EZHIP (Figures 2D, 2E, and S3G–S3I). These results indicate that EZHIP impedes PRC2 spreading.

Figure 2. EZHIP Reduces PRC2 Spreading by Stalling It at CpG Islands.

Figure 2.

(A) EZHIP-mediated re-distribution of PRC2. See Figure S3A for details.

(B) EZH2 ChIP-Rx profiles in MEFs expressing EZHIP WT or M406E.

(C) EZH2 ChIP-Rx enrichment at residual H3K27me3 peaks.

(D) SUZ12 occupancy (RPKM) in EZHIP+/+ or EZHIP−/− U2OS cells.

(E) SUZ12 enrichment (RPKM) at SUZ12 peaks in U2OS cells.

(F) H3K27me3 ChIP-seq profiles in MEFs expressing EZHIP WT or M406E.

(G) Binding of H3K27me3 or Jarid2 K116me3 (red) to EED leads to allosteric stimulation of EZH2 through an interaction between EED R302 and EZH2 H158.

(H) In vitro PRC2 assays using peptide substrates. The H3K27me3 stimulatory peptide (H3 18–37) was titrated into the reaction. The p value of the difference between EED WT and R302S at each concentration of H3K27me3 was determined using a parametric, paired t test (n = 3; *p < 0.05).

(I) H3K27me3 ChIP-seq profiles in Eed−/− MEFs rescued with EED WT or R302S.

(J) Immunoblots of cell extracts from Eed−/− cells overexpressing EED WT, R302S, or Y365A.

(K) Widths of H3K27me3 peaks in MEFs expressing EZHIP WT or M406E (left) or Eed−/− MEFs expressing EED WT or R302S (right).

(L) H3K27me3 RPKM enrichment in MEFs expressing EZHIP WT or M406E and Eed−/− MEFs expressing EED WT or R302S at H3K27me3 peaks found in EED R302S cells.

(M) Expression of silenced genes (FPKM < 20) with residual H3K27me3 at their promoters. The p values in boxplots were calculated using Wilcoxon’s rank-sum test.

To directly test the hypothesis that EZHIP promotes the formation of narrow peaks of H3K27me3 by impeding PRC2 spreading (Figures 2A and 2F), we sought a PRC2 mutant that is defective in allosteric activation and spreading but not in recruitment. Binding of H3K27me3 to EED induces a conformational change of the EZH2 SRM domain to stimulate EZH2 catalytic activity (Figure 2G). An EED mutation found in Weaver syndrome, R302S, maps to a residue that interacts with EZH2 H158 (Figure S3J; Cohen et al., 2015; Justin et al., 2016). PRC2 containing EEDR302S did not respond to H3K27me3 in activity assays but retained its ability to bind H3K27me3 at CGIs (Figures 2H, S3K, and S3L; Lee et al., 2018). Likewise, EZHIP displayed lower binding and inhibition potential for PRC2 containing EEDR302S, further confirming that EZHIP preferentially interacts with allosterically stimulated PRC2 (Figures S3M–S3O). Altogether, EEDR302S provides a “spreading defective” PRC2 mutant to test our hypothesis In vivo.

Expression of EEDR302S in EED−/− cells failed to rescue overall levels of H3K27me3 (Figures 2I and J). Although EEDWT restored the global H3K27me3 profile, EEDR302S exhibited H3K27me3 only at CpG-rich PRC2 recruitment sites (Figures 2I and S3L). Importantly, cells rescued with the spreading defective EEDR302S mutant exhibited a remarkably similar H3K27me3 profile to that of cells expressing Ezhip, i.e., sharp H3K27me3 peaks at CGIs (Figures 2K and 2L). These data support the model that EZHIP blocks PRC2 spreading on chromatin and provide a mechanistic explanation for retention of narrow H3K27me3 in tumors expressing EZHIP. The global loss of H3K27me3 in cells expressing EZHIP from intergenic regions leads to widespread upregulation of genes (Jain et al., 2019). However, the retention of residual H3K27me3 might safeguard some genes against aberrant upregulation, which cannot be achieved by a complete loss of PRC2. Genes containing residual H3K27me3 remained silenced in cells expressing Ezhip, whereas genetic depletion of EED led to their upregulation (Figure 2M). Altogether, we propose that EZHIP specifically blocks PRC2 spreading by stabilizing PRC2 at CGIs, which provides a mechanism for the retention of residual H3K27me3 at developmentally regulated genes.

H3 K27M Interacts with PRC2 In vivo and Impedes Its Spreading

The H3 K27M-mimic EZHIP interacts with allosterically stimulated PRC2 to impede its spreading. However, whether H3 K27M directly interacts with PRC2 In vivo is controversial primarily because H3 K27M and PRC2 occupancies do not correlate positively in cells (Harutyunyan et al., 2019; Piunti et al., 2017; Stafford et al., 2018). The amount of H3 K27M far exceeds that of PRC2 in the nucleus (Stafford et al., 2018). H3 K27M, being histones, are incorporated into nucleosomes and are present throughout the genome. In contrast, PRC2 is detected in relatively narrow peaks at CGIs, which may explain the poor correlation between the enrichment of H3 K27M and PRC2. Previously, we and others showed that H3 K27M preferentially binds and inhibits PRC2 in the presence of H3K27me3, which is similar to EZHIP (Diehl et al., 2019; Jain et al., 2019; Justin et al., 2016; Stafford et al., 2018). Therefore, we hypothesize that H3 K27M also stalls PRC2 at CGIs containing residual H3K27me3 by binding allosterically stimulated PRC2.

To directly map genomic regions where H3 K27M interacts with PRC2 In vivo, we used H3 K27M ChIP followed by EZH2 re-ChIP-seq (Figures 3A, S4A, and S4B). We selected reads with a fragment size smaller than 400 bp for our analyses to selectively capture PRC2 bound to mono- or di-nucleosomes. As predicted, H3 K27M-bound EZH2 was enriched at CGIs containing residual H3K27me3 (Figures 3B–3E, S4C, S4D, and S4E). We did not detect EZH2 reChIP enrichment in control cells that did not express a FLAG-tagged H3 K27M transgene, confirming our detection of only H3 K27M-bound EZH2 instead of a background signal (Figure S4C). These data demonstrate that H3.1 and H3.3 K27M directly interact with PRC2 In vivo.

Figure 3. H3 K27M Reduces H3K27me3 in Trans by Stalling PRC2 at CpG Islands.

Figure 3.

(A) Tandem ChIP-seq to identify genomic locations of H3 K27M-bound EZH2.

(B) H3 K27M-FLAG ChIP, H3K27me3 ChIP, and EZH2 reChIP in cells expressing FLAG-tagged H3.3 K27M.

(C) H3K27me3 and EZH2 reChIP profiles in cells expressing H3.3 K27M at residual H3K27me3 peaks.

(D and E) Same as (B) and (C) but for cells expressing FLAG-tagged H3.1 K27M.

(F) EZH2 ChIP-Rx in cells expressing H3.3 (top) or H3.1 (bottom) K27M or K27R.

(G) EZH2 enrichment in 293T-Rex cells expressing doxycycline-inducible H3.3 K27M at 0, 6, 12, and 72 h after treatment with doxycycline at steady state EZH2 peaks.

(H) SUZ12 enrichment in DMGs containing H3 K27M or H3 WT at common H3K27me3 peaks.

(I) Heatmap displaying SUZ12 enrichment in DMGs containing a H3 K27M mutation or corresponding H3 K27M knockout cells.

(J) Immunoblots of cell extracts from MEFs expressing H3.3 K27M, K27R, K27M;I126A;L130A, or K27R;I126A;L130A.

(K) Immunoblots of eluates from FLAG affinity purification of H3.3 K27M or K27R with I126A;L130A mutations.

(L) H3.3-FLAG and H3K27me3 ChIP-Rx profiles in MEFs expressing H3.3 K27M, K27R, K27M;I126A;L130A, or K27R;I126A;L130A.

Next, we examined changes in PRC2 distribution in cells expressing H3 K27M by mapping the EZH2 binding profile. Similar to Ezhip, expression of H3.1 or H3.3 K27M led to an increase in EZH2 occupancy at CGIs containing residual H3K27me3 (Figures 3F and S4F–S4K). To ascertain a causal relationship between H3 K27M expression and PRC2 redistribution, we used EZH2 ChIP-seq in 293T-Rex cells containing a doxycycline-inducible H3.3 K27M transgene (Stafford et al., 2018). We observed a time-dependent increase of EZH2 occupancy at recruitment sites after expression of H3 K27M, supporting our model that H3 K27M sequesters PRC2 at its recruitment sites (Figures 3G and S4L).

To corroborate our model in gliomas, we profiled the genomic distribution of SUZ12 in patient-derived DMG cell lines with wild-type H3 or H3 K27M mutations (Harutyunyan et al., 2019). DMG lines containing H3.3 K27M had significantly higher SUZ12 enrichment at CGIs containing residual H3K27me3 than H3 wild-type gliomas (Figures 3H and S5A–S5D). Importantly, Cas9-mediated genetic ablation of H3.3 K27M substantially reduced SUZ12 occupancy at these sites (Figures 3I and S5E–S5K). Taken together, our results suggest that H3 K27M directly interacts with PRC2 In vivo and stalls it at CGIs containing residual H3K27me3.

H3 K27M Oncohistones Reduce H3K27me3 Independent of Their Incorporation into Chromatin

The direct interaction between H3 K27M and PRC2 In vivo suggests that the K27M mutant reduces global H3K27 methylation through inhibiting EZH1/2 activity. In favor of this trans mode of PRC2 inhibition, we did not identify any correlation between the genomic enrichment of H3 K27M oncohistones and loss of H3K27me3 (Figures S6A–S6D). In an alternative model, H3 K27M histones have been proposed to reduce local H3K27me3 in cis by evicting PRC2 from genomic regions where these oncohistones are enriched (Herz et al., 2014; Piunti et al., 2017). In this model, a critical step toward a reduction of H3K27me3 by H3 K27M oncohistones is their incorporation into chromatin and deposition of histone modification(s) in cis that are refractory for PRC2 binding. To directly distinguish between these trans versus cis mechanisms, we sought histone H3 mutations that would abrogate its incorporation into chromatin.

Previously, we and others reported that H3 residues L126 and I130 are necessary for H3-H3 dimerization for the formation of nucleosomes (Hoelper et al., 2017; Ramachandran et al., 2011). Recombinant dimerization mutant H3.3 failed to generate H3.3-H4 tetramers in vitro (Figure S6E and S6F). We confirmed that the H3.3 dimerization mutant was absent from chromatin and is only present in the soluble nuclear fraction (Figure S6G and S6H; Hoelper et al., 2017). These experiments demonstrate that H3.3 L126A;I130A is not incorporated into chromatin. To test whether chromatin incorporation of H3 K27M oncohistones is necessary for the reduction of H3K27me3, we expressed a H3.3 K27M;L126A;I130A triple-mutant transgene in mouse embryonic fibroblasts (MEFs). Because cells maintain low levels of unincorporated histone H3 (Kimura and Cook, 2001), we found extremely low levels of the mutant protein relative to H3.3 K27M alone (Figure 3J).

Interestingly, the H3.3 K27M;L126A;I130A mutant reduced global H3K27me2/3, despite its extremely low levels in cells (Figure 3J). H3.3 K27M;L126A;I130A, but not K27R, immunoprecipitated PRC2 subunits from cell lysates, linking the reduction of H3K27me3 to a direct interaction with PRC2 In vivo (Figure 3K). The “depositable” and “non-depositable” H3.3 K27M mutant displayed similar H3K27me3 profiles: reduction from intergenic regions and retention at CGIs (Figures 3L, S6I, and S6J). Altogether, we demonstrate that the H3 K27M oncohistones reduce H3K27 methylation in trans by directly inhibiting PRC2 In vivo, independent of their incorporation into chromatin.

Mammalian EZHIP Inhibits Drosophila PRC2 through a Conserved Mechanism

Our studies demonstrate striking similarities in the mechanism through which EZHIP and H3 K27M directly inhibit PRC2 at its recruitment sites. Although histone H3 is highly conserved among eukaryotes, EZHIP is only present in placental mammals. Previous studies found that the expression of H3 K27M in fruit flies largely phenocopies the loss of PRC2 activity (Herz et al., 2014). Because EZHIP mimics the molecular function of the H3 K27M oncohistone, we hypothesized that human EZHIP inhibits Drosophila PRC2 despite its evolutionary absence in flies. Indeed, we found that the expression of human EZHIP or H3.3 K27M in imaginal wing discs led to a substantial reduction of H3K27me3, relative to EZHIP M406E or H3 K27R controls (Figure 4A). These data further highlight the similarity between the molecular functions of the two oncogenes.

Figure 4. Human EZHIP Reduces H3K27me3 in Drosophila through a Conserved Mechanism.

Figure 4.

(A) H3K27me3 staining (green) of wing imaginal discs from third instar larvae expressing either EZHIP WT, EZHIP M406E, H3 K27M, or H3 K27R driven engrailed-GAL4. RFP (red) indicates the region of engrailed-GAL4 expression.

(B) Immunoblots of S2 cells expressing FLAG-tagged EZHIP induced with 5 μM or 10 μM copper or empty vector as control.

(C) H3K27me3 ChIP-Rx profile in S2 cells as described in (B).

(D) Overlap of H3K27me3 peaks in S2 cells expressing high (10 μM Cu2+) or low (10 μM Cu2+) levels of EZHIP.

(E) Fraction of annotated PREs that retained H3K27me3 in cells expressing EZHIP.

(F) Difference of internally normalized H3K27me3 (EZHIP-control) was used to identify loci that disproportionately retained H3K27me3 upon EZHIP expression. ATAC-seq peak within these loci represent putative PRC2 recruitment sites.

(G) Fraction of putative polycomb-recruitment sites that contain annotated PREs or unannotated Ph peaks.

(H) Baseline H3K27me3 ChIP, ΔH3K27me3 (EZHIP-Control), ATAC-seq, and Ph ChIP-seq profiles Red, previously annotated PREs; purple, unannotated recruitment sites.

(I and J) ATAC-seq and Ph ChIP-seq densities at putative PRC2 recruitment sites.

The cis-regulatory elements involved in PRC2 recruitment that account for the global H3K27 methylation profile have not been identified in mammals. However, in Drosophila melanogaster, PRC2 is recruited to Polycomb Response Elements (PREs) by the DNA-binding protein Pho (Müller and Kassis, 2006; Orsi et al., 2014). Therefore, Drosophila presents an excellent model to study and validate PRC2 recruitment versus spreading defects mediated by EZHIP. Having validated the ability of EZHIP to inhibit H3K27me3 In vivo, we established a copper-inducible system to express EZHIP in Drosophila S2 cells and showed that the expression of EZHIP led to a dose-dependent reduction of H3K27me3, which is consistent with a competitive mode of inhibition (Figures 4B–4D). Despite a global reduction of H3K27me3, most PREs retained residual H3K27me3 in cells expressing EZHIP (Figure 4E).

To distinguish between PRC2 recruitment versus spreading defects, we identified genomic regions that disproportionately retained H3K27me3 in cells expressing EZHIP (Figure 4F). Using Assay for Transposase-Accessible Chromatin (ATAC-seq), we identified accessible regions within residual H3K27me3 sites as potential polycomb-recruitment sites. Consistent with our model that EZHIP preferentially impedes PRC2 spreading, 178/326 (55%) of the regions that retained H3K27me3 contained previously annotated PREs and displayed an enrichment of the polycomb protein Polyhomeotic (Ph) (Figures 4G and 4H). Moreover, an additional 111 (34%) sites also displayed Ph occupancy, designating ~90% of regions that retained H3K27me3 as polycomb-recruitment sites (Figures 4G and 4H). These results further support the model that EZHIP preferentially inhibits PRC2 spreading while sparing its activity at recruitment sites. Notably, the amplitude of Ph enrichment at the additional Ph binding sites was lower than that at annotated PREs (Figures 4I and 4J), which may represent cell-type-specific, weaker PREs (De et al., 2016).

DISCUSSION

Since the discovery of H3 K27M mutations in DMGs, several studies showed that H3 K27M is a competitive inhibitor of PRC2 in vitro. However, it had remained challenging to assess the PRC2-H3 K27M interaction In vivo by using genomic approaches. Here, we show that the non-histone H3-K27M-mimic EZHIP occupies the same sites as PRC2 In vivo. Importantly, we successfully detected the interaction between H3 K27M and PRC2 In vivo by using a tandem ChIP strategy. Our demonstration that H3 K27M directly interacts with and inhibits PRC2 activity In vivo links the numerous studies that characterized the PRC2-K27M interactions in vitro to the In vivo loss of H3K27me3.

Recurrent H3 K27M mutations and aberrant EZHIP expression are preferentially found in distinct gliomas, namely, DMGs and PFA ependymomas, respectively. Remarkably, two recent studies discovered aberrant expression of EZHIP in a subset of DMGs lacking H3 K27M mutations (Castel et al., 2020; Pratt et al., 2020). Similarly, a small fraction of PFA ependymomas contain H3 K27M mutations that are mutually exclusively with EZHIP expression (Pajtler et al., 2018). Our finding that EZHIP and H3 K27M have similar underlying biochemical mechanisms explains the clinical observations that both oncoproteins can drive the same subtype of gliomas. Therefore, pharmacological interventions proposed for H3-K27M-positive gliomas might be promising candidates in gliomas expressing EZHIP (Anastas et al., 2019; Grasso et al., 2015; Krug et al., 2019; Mohammad et al., 2017; Nagaraja et al., 2019; Piunti et al., 2017).

We validated our findings that EZHIP disproportionately blocks PRC2 spreading while sparing residual H3K27me3 at recruitment sites using Drosophila melanogaster S2 cells. Using ectopic expression of EZHIP in S2 cells, we identified >100 new, weak polycomb-binding sites that likely represent tissue-specific PREs. Although previous studies used a combination of H3K27me3 ChIP- and ATAC-seq to identify PREs in Drosophila melanogaster, the expression of EZHIP may provide a tool to filter out most genomic regions containing H3K27me3 and a more sensitive method to detect tissue-specific PREs in future studies.

STAR★METHODS

RESOURCE AVAILABILITY

Lead contact

Further request to Peter W. Lewis (peter.lewis@wisc.edu)

Materials availability

Fly lines expressing EZHIP generated in this study are available upon request from the lead contact.

Data and Code Availability

The accession number for the Next-generation sequencing data generated and reported in this paper is GEO: GSE151983. Original data have been deposited to Mendeley Data, https://doi.org/10.17632/xtp4xytd2c.1. Code used to analyze data are described in the STAR methods.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Fly stocks

All stocks were grown on molasses food at 22°C (room temperature). N-terminally FLAG-tagged EZHIP WT and M406E, H3K27M or H3K27R were cloned into pUASt-attB (DGRC#1419) and integrated into ZH-86Fb on the third chromosome using PhiC31 integrase-mediated recombination into BDSC#24749 with fluorescence marker removed (Best Gene). en-Gal4, UAS-RFP/CyO (II) (BDSC#30557) was used to drive expression in the larval wing disc.

Transgenic cell lines and culture

Mouse embryonic fibroblasts (sex:F, derived from embryonic state E13.5) used in this study containing loxP sites flanking exon 3–6 of EED were described previously (Jain et al., 2019). MEFs were previously verified through their gene expression signature (RNA-Seq). Cells were cultured in DMEM supplemented with 10% FBS, 1x glutamax and 1x penicillin-streptomycin. S2 cells in this study were cultured at 25°C in Schneider’s Media (Thermo Fisher) containing 10% FBS (Omega Scientific), and 1% antibiotic/antimycotic (Thermo Fisher).

METHOD DETAILS

Immunohistochemistry

Crawling third instar larvae were harvested and dissected in pre-chilled (4°C) 1X PBS. Wing imaginal discs were removed from larvae and placed into 1X PBS on ice and fixed in 4% formaldehyde for 30 min. Fixed wing imaginal discs were washed in 1X PBS + 0.1% Triton X-100, (PBST) and blocked in PBST + 1% BSA (PAT). After removal of PAT, wing discs were resuspended in PAT + anti-H3K27me3 (1:1600) (Cell Signaling Technology #9733S) and incubated overnight at 4°C, washed in PBST, incubated in PBST + 2% normal goat serum for 10 min, followed by incubation with PBST + 2% normal goat serum and goat anti-rabbit DyLight 488 conjugated secondary antibody (1:2000) (Fisher Scientific #35552). Larvae were imaged at 10X using a Nikon Ti2-E epifluorescent microscope.

Production of stable S2 cell lines

FLAG-tagged human EZHIP was cloned into the pMT-puro vector (Addgene #17923). Transfections were performed with 2 μg plasmid DNA, using Effectene Transfection Reagent (QIAGEN), and cells were selected using 2 μg/ml puromycin for approximately three weeks. For induction, 5 μM or 10 μM copper sulfate was added to cells at one million cells/ ml density. Cells were incubated for 72 h and harvested for immunoblot or ChIP.

Production of mammalian cell lines

Lentiviruses were produces by co-transfecting packaging vectors (psPAX2 and pMD2.G) and transfer vector (pCDH-EF1a-MCS-PuroR) in HEK293T cells (ATCC CRL-3216) using GenJet in vitro DNA transfection reagent (SignaGen Laboratories SL100488). Media containing lentiviruses were collected 48 and 72 h after transfection. MEFs were transduced with lentiviruses for 2 days and selected using 1.5 μg/μl puromycin for 4 days. Mouse and human EZHIP DNA sequences were used in mouse and human cell lines respectively; however, only human amino acid numbers were used in the figures to avoid confusion.

Peptide pulldown

25 μl of high capacity streptavidin agarose beads (Thermo Scientific Pierce PI20359) saturated with biotinylated EZHIP peptides were incubated with 1 μg recombinant PRC2 purified from SF9 cells for 2 hs at 4°C in the presence or absence of 20 μM H3K27me3 stimulatory peptides in 500 μL of binding buffer (20 mM Tris-HCl pH 8, 125 mM NaCl, 0.01% NP-40, 0.4 mM PMSF, 1 mM β-mercaptoethanol), and 100 nM of oligonucleosomes. Following binding, beads were washed four times in 1 mL of binding buffer. Bound proteins were eluted with 2x SDS sample buffer (10% glycerol, 50 mM Tris-HCl pH 6.8, 4% SDS, 0.04% bromophenol blue, 143 mM β-mercaptoethanol) and analyzed by immunoblotting.

FLAG affinity purification

~80 million cells were homogenized in hypotonic lysis buffer (15 mM HEPES pH 7.9, 4 mM MgCl2, 10 mM KCl, 1 mM EDTA, 8 mM PMSF) to isolate nuclei. Nuclei were resuspended in Buffer-M (15 mM HEPES pH 7.9, 1 mM CaCl2, 30 mM KCl, 1X protease inhibitor cocktail, 8 mM PMSF, 1 mM beta-mercaptoethanol) and treated with 750 units of Micrococcal Nuclease, MNase (Worthington Biochemical Corporation, LS004798) for 20 min at 37°C. MNase digestion was quenched and nuclear extract was prepared by adding 10 mM EDTA, 5 mM EGTA, 270 mM KCl, 0.05% Triton X-100). Nuclear extract was incubated with 75 μl of M2 anti-FLAG affinity gel (Sigma A2220) for 2 h. Beads were washed 5-times with wash buffer (15 mM HEPES pH 7.9, 500 mM KCl, 1 mM EDTA, 0.05% Triton X-100, 8 mM PMSF) and captured proteins were eluted using 300 μg/ml of 3x FLAG peptides. For FLAG affinity purification in the presence of A-395, 1 μM A-395 (or DMSO control) was added to cultured cells for 6 h before cells were harvested and nuclear extract was prepared. 1 μM A-395 (or DMSO) was added to all buffers throughout the protocol.

Immunoprecipitation of pre-deposition complexes

Lysate from 40 × 106 HEK293T cells transduced with H3.3-FLAG-HA transgenes was prepared by resuspension in 3.0 mL lysis buffer [20 mM HEPES pH 7.9, 200 mM KCl, 0.5 mM EDTA, 2 mM MgCl2, 0.2% Triton X-100, 2 × Protease Inhibitor Cocktail (Roche), 2 mM 2-mercaptoethanol, 1 mM benzamidine, 0.4 mM PMSF, 300 μM S-adenosyl methionine), followed by douncing and separation of the insoluble fraction by centrifugation. Per sample, 30 μL of packed anti-FLAG M2 beads (Sigma) were added to the lysate and incubated rotating at 4°C for 2 h. Beads were transferred onto microspin columns (Enzymax) and washed three times with wash buffer (20 mM HEPES pH 7.9, 300 mM KCl, 1 mM EDTA, 0.12% Triton X-100, 0.4 mM PMSF, 1 mM benzamidine, 150 μM S-adenosyl methionine) for 5 min. Finally, samples were eluted with 2 × 25 μL elution buffer [wash buffer supplemented with 500 ng μl−1 3 × FLAG peptide (Tufts University Peptide Core Facility)] via incubation for 5 min on ice and centrifugation at 300 g.

Analysis of deposition of histones into chromatin

100 × 106 HEK293T cells expressing H3.3-FLAG-HA transgenes were harvested via trypsinization and the trypsin reaction was quenched by addition of growth media. Cells were pelleted via centrifugation for 2 min at 1,000 g and cell pellets were resuspended in 20 mL of growth media. Paraformaldehyde (Electron Microscopy Sciences) was added at a final concentration of 0.5%, followed by incubation for 5 min at room temperature. The crosslinking reaction was quenched by the addition of glycine at 200 mM final and incubation for 5 min at room temperature. Cells were pelleted by centrifugation at 1,000 g for 2 min and pellets were resuspended in phosphate-buffered saline supplemented with 200 mM glycine. Cells were then pelleted again and washed with cold phosphate-buffered saline. For cells to be analyzed under native condition, all steps were performed equally with the omission of paraformaldehyde. For separation of soluble nuclear proteins from chromatin, 1/10th volume of saturated solution of ammonium sulfate was added to nuclei resuspended in 15 mM HEPES pH 7.9, 1 mM EDTA, 0.4 mM PMSF, 4 mM MgCl2. Chromatin was separated from nuclear extract by ultracentrifugation for 90 min at 85,000 g. Chromatin pellets were subsequently washed three times with 1 mL chromatin wash buffer (20 mM HEPES, 500 mM KCl, 1 mM EDTA, 0.01% Nonidet P-40, 5% glycerol, 0.4 mM PMSF, 2 mM 2-mercaptoethanol) and subjected to acid histone extraction. Briefly, chromatin pellets were dissolved in 0.4 N H2SO4 by overnight rotation at room temperature. After centrifugation, proteins from the collected supernatants were precipitated by addition of 1/3 volume 100% trichloroacetic acid with 0.1% sodium deoxycholate on ice, washed twice with ice cold acetone, and resuspended in distilled water.

Reconstitution of recombinant tetramers

Recombinant 6X-His-tagged H3.3 histones (C110A background; with or without L126A-I130A mutation) and H4 histones were expressed in E. coli Rosetta cells. For purification, inclusion bodies were solubilized in D500 buffer (6.3 M Guanidine-HCl, 500 mM NaCl, 50 mM Tris pH 8, and 10 mM 2-mercaptoethanol), followed by purification via Ni-NTA batch chromatography. For the removal of guanidine, eluates were desalted using PD10 columns into buffer containing 100 mM trimethylamine acetate pH5 and 5 mM 2-mercaptoethanol and subsequently lyophilized. For tetramer reconstitution, equimolar amounts of H3.3 and H4 histones were mixed und denaturing conditions and dialyzed against HDB Buffer (20 mM Tris pH 8, 1 mM EDTA, 5% (v/v) glycerol, 10mM 2-mercaptoethanol, 1mM PMSF) supplemented with different concentrations of 2M NaCl. Dialyzed samples were run on a Superdex 200 column in buffer containing 20 mM HEPES, 1 mM EDTA, 0.01% NP40, 10% glycerol supplemented with KCl at the concentrations given in the figure legend. This gel filtration step was performed with 50 μL injection volume, a flow rate of 50 μL/min and 40 μL fractions were collected for further analysis by SDS-PAGE.

Purification of native oligonucleosomes

Native oligonucleosomes were purified from EED−/− MEFs. Nuclei were prepared by resuspending 100 million cells in hypotonic lysis buffer and centrifugation at 2100Å~g for 5 min Nuclei were resuspended in buffer-AP (15 mM HEPES pH 8, 15 mM NaCl, 60 mM KCl, 5% Sucrose, 0.5 mM Sperimine, 0.15 mM Spermidine, 0.4 mM PMSF, 1 mM β-mercaptoethanol) and treated with 0.2 units μl–1 MNase for 20 min at 37 oC. After quenching with 5 mM EDTA, nuclei were centrifuged at 2100Å~g for 5 min. Nuclei were lysed by resuspension in 10 mM EDTA and 500 mM NaCl. Oligonucleosomes were purified over a sucrose gradient (5%–30% sucrose, 15 mM HEPES pH7.9, 1 mM EDTA, 500 mM NaCl, 0.5 mM PMSF). Oligonucleosomes in fractions 15–21 mL were concentrated and dialyzed against 15 mM Tris pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.4 mM PMSF, 10% glycerol.

Histone methyltransferase assays

200 nM oligonucleosome arrays or 25 μM H3 peptide (18–32) substrates were incubated with 20 nM recombinant PRC2 complex, 4 μM S-adenosyl Methionine (1 μM 3H-SAM; 3 μM cold SAM) and 20 μM H3K27me3 stimulatory peptide in 25 mM Tris pH 8.0, 2 mM MgSO4, 5 mM DTT, 0.4 mM PMSF for 90 min. Reaction was spotted on phosphocellulose membrane (Whatman p81) and dried for 10 min. Filters were washed 3-times with 100 mM NaHCO3 for 5 min each, rinsed in acetone and dried for 10 min. Scintillation counting was performed using Tri-Carb 2910 TR liquid Scintillation analyzer (Perkin Elmer). For fluorography, reaction was resolved on 15% SDS-PAGE gel, stained with Coomassie, incubated in Amersham Amplify Fluorography reagent (GE healthcare) for 10 min and dried under vacuum. Films capturing fluorography signal were developed after 24–48 h. Experiment specific details are in figure legend.

Chromatin immunoprecipitation

~20 million mammalian cells or ~80 million S2 cells were crosslinked with 0.8% Paraformaldehyde (Electron Microscopy Sciences) for 8 min at room temperature and quenched with 0.2 M glycine. Cells were lysed by resuspending in lysis buffer (50 mM HEPES pH 7.9, 140 mL NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP40, 0.25% Triton X-100, 0.8 mM PMSF). Nuclei were washed once and resuspended in digestion buffer (50 mM HEPES pH 7.9, 1 mM CaCl2, 20 mM NaCl, 1x protease inhibitor cocktail, and 0.8 mM PMSF), and treated with 200 units of MNase (Worthington Biochemical Corporation, LS004798) for 10 min. Reaction was quenched by adding 10 mM EDTA, 5 mM EGTA, 80 mM NaCl, 0.1% sodium deoxycholate, 0.5% N-lauroyl sarcosine. Mono-nucleosomes were solubilized by sonication using covaries S220 (160 peak incidental power, 5% duty factor, 200 cycles/burst, 45” ON-30” OFF) 3-times. 1% Triton X-100 was added to the chromatin and insoluble chromatin was removed using centrifugation. Chromatin was dialyzed against RIPA buffer (10 mM Tris pH 7.6, 1 mM EDTA, 0.1% SDS, 0.1% sodium deoxycholate, 1% Triton X-100) for 2 h. Chromatin concentration was measured using qubit and spike-in chromatin was added at 1:40 ratio. Chromatin was incubated with primary antibodies overnight. Antibodies was captured using Dynabeads for 4 h and washed 3x using RIPA buffer, 2x using RIPA+300 mM NaCl and 2x with LiCl buffer. Chromatin was eluted in 10 mM Tris, 1 mM EDTA, and 1% SDS, incubated with proteinase K, and RNase A and DNA was purified using PCR purification columns. For reChIP, chromatin after the first ChIP was eluted using a competing 3x-FLAG peptide for 30 min at 10°C. Eluate was diluted 10-times with RIPA buffer and incubated with EZH2 antibody overnight. Final washes and elution were carried out as described for conventional one-step ChIPs. Eluted DNA was diluted 1:50 for qPCR analysis. Sequencing libraries were prepared using NEB Next Ultra kit. ChIPs were performed in at least two independent replicates with similar results, at least one replicate was sequenced using NGS, data in the qPCR figures are from technical replicates; ChIP-qPCR results are displayed as barchart (mean ± SD), p values were determined by paired, non-parametric t test.

ChIP-Sequencing analysis

Reads that passed quality score were aligned to mouse (mm9) or human (hg19) or Drosophila (dm6) genomes using bowtie1 (parameters: -q -v 2 -m 2 -a –best –strata) (Langmead et al., 2009). Sample normalization factor was determined as ChIP-Rx = 10^6 / (total reads aligned to exogenous reference genome) or RPKM = 10^6 / (total aligned reads). Sam files were converted to bam files using samtools (Li et al., 2009). Bigwig files were generated using deeptools (-bs 50 –smoothLength 600) (Ramírez et al., 2016). Peaks were called using mosaics-HMM (typically using FDR = 0.01, maxgap = 2–10K, minsize = 1K) (Sun et al., 2013). Residual H3K27me3 sites in cells expressing EZHIP or H3 K27M were determined as peaks found in two independent ChIP-Seq experiments. Spreading sites were determined by subtracting EZH2 peaks from broad H3K27me3 peaks present in control samples (EZHIP M406E or H3 K27R). Heatmaps were generated using deeptools. H3K27me3 for MEFs expressing EZHIP was normalized by RPKM to be able to visualize residual H3K27me3 profiles; however, ChIP-Rx normalization factor was used in boxplot quantification everywhere. Statistical analysis was performed using R.

For EZH2 reChIP-Seq analyses, aligned paired-end sequencing reads were filtered by fragment length < 400 bp. Samples were normalized by RPKM and corresponding FLAG ChIP (H3 K27M ChIP). EZH2 reChIP in MEFs not expressing H3 K27M transgene was used as negative control and normalized using RPKM only. No conclusion about the amplitude of reChIP signals were drawn in the manuscript. Deeptools was used for data visualization.

For generation of correlation plots, genome was divided into 10 kb bins and normalized ChIP enrichment was determined within each bin (RPKM for FLAG-H3 K27M ChIPs; Rx for H3K27me3 ChIPs). Spearman correlation coefficient was determined using R. For identification of potential PRC2 binding sites in S2 cells, regions containing disproportionate retention of H3K27me3 were determined as the difference in H3K27me3 RPKM enrichment in control and cells expressing EZHIP. Bins with change in H3K27me3 < 10 within 5KB were merged and regions with delH3K27me3 < 500 were removed. Finally, ATAC-Seq peaks within these regions with residual H3K27me3 were defined as potential PRC2 recruitment sites. Annotations of PREs in dm6 genome were obtained from a recent report (Alecki et al., 2020). Ph ChIP-Seq data from S2 cells were downloaded from GEO (GSE60686).

ATAC-Sequencing

2 × 105 Drosophila S2 cells were washed once with 1X PBS and then resuspended in 100 μL ATAC lysis buffer (10mM Tris 7.5, 10mM NaCl, 3mM MgCl2, 0.1% NP-40). Cells were centrifuged at 600 × g for 10 min at 4°C. The resulting pellet was resuspended in 47.5 μL buffer TD (Illumina 15027866) before adding 2.5 μL Tn5 transposase (Tagment DNA Enzyme, Illumina 15027865) and incubating in 37°C water bath for 30 min. The tagmented DNA was immediately purified using MinElute Cleanup Kit (QIAGEN 28204) and eluted in 10 μL buffer EB. Tagmented DNA was amplified with 12 cycles of PCR using the NEBNext Hi-Fi 2X PCR Master Mix (NEB M0541) and unique dual index primers. Libraries were purified using a 1.2X ratio of Axygen magnetic beads. 150bp, paire-end sequencing was performed at the University of Wisconsin-Madison Biotechnology Center on the Illumina Nova Seq 6000 platform.

ATAC-Sequencing analysis

Raw reads were trimmed to remove adaptor sequences using NGmerge (Gaspar, 2018). Trimmed reads were aligned to the Drosophila (dm6) genome using bowtie2 with the following parameters:–very-sensitive,–no-mixed,–no-discordant, -X 5000, -k 2. Only reads with a mapping quality score >30 that aligned to major chromosomes (2, 3, 4, X, Y) were retained for downstream analysis. In order to enrich for fragments originating from nucleosome-free regions, only fragments < 100 bp were retained. Peak calling was performed on accessible fragments using MACS2 with the following parameters: -f BAMPE–keep-dup all -g 1.2e8–call-summits.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analysis for ChIP-Seq was performed using R. Wilcoxon rank sum test was used to calculate p values in boxplots. p value for bar chart representing ChIP-qPCR data were calculated using paired, parametric t test. n values are provided in the figures. n in boxplots represents total number of elements such as peaks or genes for which boxplot is generated. Outliers in the boxplot are not shown (“outline= F” in R). None of the data points in any analyses were excluded.

Supplementary Material

Supplementary Figures

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
H3K27me3 Cell Signaling Cat#9733, RRID: AB_2616029
H3K27me2 Cell Signaling Cat#4499, RRID: AB_10544537
EZH2 Cell Signaling Cat#5246, RRID: AB_10694683
SUZ12 Cell Signaling Cat#3737, RRID: AB_2196850
FLAG-tag Sigma Aldrich Cat#F3165, RRID: AB_259529
FLAG-tag Cell Signaling Cat#2368, RRID: AB_2217020
EZHIP Millipore Cat#ABC1378
HA-tag MSKCC (Purified in lab) n/a
goat anti-rabbit DyLight 488 conjugated secondary antibody Fisher Scientific Cat#35552
Chemicals, Peptides, and Recombinant Proteins
EZHIP KLP Peptide
Jain et al., 2019. n/a
EZHIP M406E Peptide Jain et al., 2019. n/a
H3 18–32 peptide Jain et al., 2019.
rPRC2 Jain et al., 2019, This study. n/a
Micrococcal Nuclease (MNase) (Worthington Biochemical Corporation) Cat# LS004798
Tri-Carb 2910 TR liquid Scintillation analyzer Perkin Elmer
Amersham Amplify Fluorography reagent GE healthcare
A-395 Sigma-Aldrich Cat# SML1923–25MG
Tazemetostat (EPZ-6438) AdipoGen Cat# SYN3045M010
Paraformaldehyde Electron Microscopy Sciences Cat#15710
Tn5 transposase Illumina Cat#15027865
NEBNext Hi-Fi 2X PCR Master Mix NEB Cat#NEB M0541
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England Biolabs (NEB) Cat#E7645L
NEBNext Multiplex Oligos for Illumina (96 Index Primers) New England Biolabs (NEB) Cat#E6609S
S-Adeno-L Met 3H PerkinElmer Cat#NET155250UCI
High capacity streptavidin agarose resin Thermo Scientific Cat#PI20359
Deposited Data
ChIP-Sequencing datasets in MEFs expressing EZHIP, H3 K27M or H3 K27R. This study. GSE151983
ChIP-Sequencing in human DIPGs Harutyunyan et al., 2019 https://datahub-jv6f4mbl.udes.genap.ca/
ChIP-Sequencing in U2OS cells Ragazzini et al., 2019 GSE130231
ChIP-Sequencing in 293T-Rex cells expressing inducible H3.3WT or H3.3K27M Stafford et al., 2018. GSE118954
ChIP-Seq of Ph in S2 cells Wani et al., 2015 GSE60686
Genome build, mm9 UCSC genome browser https://hgdownload.soe.ucsc.edu/goldenPath/mm9/bigZips/
Genome build, dm6 UCSC genome browser https://hgdownload.soe.ucsc.edu/goldenPath/dm6/bigZips/
Genome build, hg19 UCSC genome browser https://hgdownload.soe.ucsc.edu/goldenPath/hg19/bigZips/
Gel images, IHC images. This Study, Mendeley data. https://data.mendeley.com/datasets/xtp4xytd2c/draft?a=e3b809da-e54a-47f0-a43f-ecc3f93aed2e
Experimental Models: Cell Lines
Mouse Embryonic Fibroblasts Jain et al., 2019. n/a
Drosophila Melanogaster, S2 cells Don Rio Lab n/a
Human HEK293T cells ATCC CRL-3216
Experimental Models: Organisms/Strains
D. melanogaster: w1118; P{w[+mW.hs]=en2.4-GAL4}e16E, P{w[+mC]=UAS-RFP.W}2/CyO Bloomington stock center BDSC 30557
D. melanogaster: UASt-EZHIP(M406E) This study. n/a
D. melanogaster: UASt-EZHIP This study. n/a
D. melanogaster: UASt-H3.3K27M This study. n/a
D. melanogaster: UASt-H3.3K27R This study. n/a
Oligonucleotides
Gapdh Forward (chr6:125,114,599–125,114,799) : TATGCCCGAGGACAATAAGG This study. n/a
Gapdh Reverse (chr6:125,114,599–125,114,799) : ATCCTGTAGGCCAGGTGATG This study. n/a
Rpl3 Forward (chr15:79,908,912–79,909,010) : CAGGGCTGTTCTCAGAAGGA This study. n/a
Rpl3 Reverse (chr15:79,908,912–79,909,010) : TGTGATGAGGCTCTGGAATG This study. n/a
Hoxb8 Intergenic Forward (chr11:96,139,860–96,140,041) : ACATAAGGGAGAGTAGCCTCTTG This study. n/a
Hoxb8 Intergenic Reverse (chr11:96,139,860–96,140,041) : GGCTTTTTGTGAGGGATGAG This study. n/a
Crhr1 Intergenic Forward (chr11:104,059,022–104,059,179) : GTGCCTCCCATTTCCTCCAC This study. n/a
Crhr1 Intergenic Reverse (chr11:104,059,022–104,059,179) : GATTTGGGCAGGCACTGAAG This study. n/a
Crhr1 Residual Forward (chr11:103,994,631–103,994,788) : GAATGGGTGATGGTGAAACCG This study. n/a
Crhr1 Residual Reverse (chr11:103,994,631–103,994,788) : CCCCAAAGATTGCAGCGATTC This study. n/a
Wnt3 Residual Forward (chr11:103,634,249–103,634,406) : CCCCAAAGATTGCAGCGATTC This study. n/a
Wnt3 Residual Reverse (chr11:103,634,249–103,634,406) : CCCCAAAGATTGCAGCGATTC This study. n/a
Wnt9b Residual Forward (chr11:103,612,148–103,612,463) : GCAAGGCCCAACATAGGCTT This study. n/a
Wnt9b Residual Reverse (chr11:103,612,148–103,612,463) : GCAAGGCCCAACATAGGCTT This study. n/a
Onecut3 Residual Forward (chr10:79,960,211–79,960,308) : GCACACACACAGACCCACTT This study. n/a
Onecut3 Residual Reverse (chr10:79,960,211–79,960,308) : CCAAAAGCCCAAAGACAGG This study. n/a
RFX4 Residual Forward (chr10:84,219,642–84,219,837) : GCTTAGGATCTGGGGTGAG This study. n/a
RFX4 Residual Reverse (chr10:84,219,642–84,219,837) : CAGAAGCAAGAGCCTCCAGT This study. n/a
Recombinant DNA
pCDH-EF1a-mEZHIP-PuroR Jain et al., 2019. n/a
pMT-PuroR-hEZHIP This study. n/a
pUASt-EZHIPattB This study. n/a
pUASt-EZHIP(M406E) This study. n/a
pUASt-H3.3K27M This study. n/a
pUASt-H3.3K17R This study. n/a
Software and Algorithms
Bowtie1 Langmead B et al., 2009 http://bowtie-bio.sourceforge.net/index.shtml
Samtools Li H et al., 2009 http://samtools.sourceforge.net/
Bedtools Quinlan et al., 2010 https://bedtools.readthedocs.io/en/latest/content/bedtools-suite.html
Deeptools Fidel et al., 2016 https://deeptools.readthedocs.io/en/develop/content/list_of_tools.html
Mosaics-HMM Chung et al., 2020 https://www.bioconductor.org/packages/release/bioc/html/mosaics.html
RSEM Li et al., 2011 https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-12-323
IGV Genome Browser Robinson et al., 2017 http://software.broadinstitute.org/software/igv/
R Studio v1.1.456 RStudio https://rstudio.com/
Pymol Schrodinger
https://pymol.org/2/
NGmerge Gaspar JM, 2018 https://github.com/jsh58/NGmerge
Other

Highlights.

  • H3 K27M and EZHIP interact with allosterically stimulated PRC2 In vivo

  • H3 K27M oncohistones reduce H3K27me3 independent of deposition into chromatin

  • H3 K27M and EZHIP impede PRC2 spreading from CpG islands containing H3K27me3

  • Human EZHIP reduces H3K27me3 spreading from PREs in Drosophila

ACKNOWLEDGMENTS

We thank Dr. Tom W. Muir and Sara K. Daley for key discussions. We thank MilliporeSigma for generating the EZHIP antibody. This research was supported by funding from National Institues of Health, P01CA196539 (to P.W.L. and N. Jabado.); the Greater Milwaukee Foundation (to P.W.L.); the Sidney Kimmel Foundation (Kimmel Scholar Award to P.W.L.); the Childhood Brain Tumor Foundation (to P.W.L.); the Rally Foundation for Childhood Cancer Research (to P.W.L.); the Vallee Foundation (to M.M.H.); and a pilot grant from University of Wisconsin Carbone Cancer Center (to P.W.L. and M.M.H.). T.J.G. is supported by National Research Service Award T32 GM007215. P.W.L. is a Pew Scholar in the Biomedical Sciences. This work was performed within the context of the I-CHANGE consortium and supported by funding from Genome Canada, Genome Quebec, The Institute for Cancer Research of the Canadian Institutes for Health Research (CIHR), McGill University, and the Montreal Children’s Hospital Foundation. N. Jabado. is a member of the Penny Cole lab and the recipient of a Chercheur Clinician Senior Award.

Footnotes

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at https://doi.org/10.1016/j.molcel.2020.09.028.

DECLARATION OF INTERESTS

Authors declare no competing interests.

REFERENCES

  1. Alecki C, Chiwara V, Sanz LA, Grau D, Arias Pérez O, Boulier EL, Armache K-J, Chédin F, and Francis NJ (2020). RNA-DNA strand exchange by the Drosophila Polycomb complex PRC2. Nat. Commun 11, 1781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anastas JN, Zee BM, Kalin JH, Kim M, Guo R, Alexandrescu S, Blanco MA, Giera S, Gillespie SM, Das J, et al. (2019). Re-programing Chromatin with a Bifunctional LSD1/HDAC Inhibitor Induces Therapeutic Differentiation in DIPG. Cancer Cell 36, 528–544.e10. [DOI] [PubMed] [Google Scholar]
  3. Bayliss J, Mukherjee P, Lu C, Jain SU, Chung C, Martinez D, Sabari B, Margol AS, Panwalkar P, Parolia A, Pekmezci M, McEachin RC, Cieslik M, Tamrazi B, Garcia BA, La Rocca G, Santi M, Lewis PW, Hawkins C, Melnick A, David Allis C, Thompson CB, Chinnaiyan AM, Judkins AR, and Venneti S (2016). Lowered H3K27me3 and DNA hypomethylation define poorly prognostic pediatric posterior fossa ependymomas. Sci. Transl. Med 8, 366ra161–366ra161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bender S, Tang Y, Lindroth AM, Hovestadt V, Jones DTW, Kool M, Zapatka M, Northcott PA, Sturm D, Wang W, et al. (2013). Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell 24, 660–672. [DOI] [PubMed] [Google Scholar]
  5. Brown ZZ, Müller MM, Jain SU, Allis CD, Lewis PW, and Muir TW (2014). Strategy for “detoxification” of a cancer-derived histone mutant based on mapping its interaction with the methyltransferase PRC2. J. Am. Chem. Soc 136, 13498–13501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Castel D, Kergrohen T, Tauziède-Espariat A, Mackay A, Ghermaoui S, Lechapt E, Pfister SM, Kramm CM, Boddaert N, Blauwblomme T, et al. (2020). Histone H3 wild-type DIPG/DMG overexpressing EZHIP extend the spectrum diffuse midline gliomas with PRC2 inhibition beyond H3-K27M mutation. Acta Neuropathol. 139, 1109–1113. [DOI] [PubMed] [Google Scholar]
  7. Chan K-M, Fang D, Gan H, Hashizume R, Yu C, Schroeder M, Gupta N, Mueller S, James CD, Jenkins R, et al. (2013). The histone H3.3K27M mutation in pediatric glioma reprograms H3K27 methylation and gene expression. Genes Dev. 27, 985–990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chung D, Zhang Q, and Keles S (2014). MOSAiCS-HMM: A Model-Based Approach for Detecting Regions of Histone Modifications from ChIP-Seq Data In Statistical Analysis of Next Generation Sequencing Data. Frontiers in Probability and the Statistical Sciences, Datta S and Nettleton D, eds. (Springer, Cham: ) 10.1007/978-3-319-07212-8_14. [DOI] [Google Scholar]
  9. Cohen ASA, Tuysuz B, Shen Y, Bhalla SK, Jones SJM, and Gibson WT (2015). A novel mutation in EED associated with overgrowth. J. Hum. Genet 60, 339–342. [DOI] [PubMed] [Google Scholar]
  10. De S, Mitra A, Cheng Y, Pfeifer K, and Kassis JA (2016). Formation of a Polycomb-Domain in the Absence of Strong Polycomb Response Elements. PLoS Genet. 12, e1006200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Delaney K, Strobino M, Wenda JM, Pankowski A, and Steiner FA (2019). H3.3K27M-induced chromatin changes drive ectopic replication through misregulation of the JNK pathway in C. elegans. Nat. Commun 10, 2529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Diehl KL, Ge EJ, Weinberg DN, Jani KS, Allis CD, and Muir TW (2019). PRC2 engages a bivalent H3K27M-H3K27me3 dinucleosome inhibitor. Proc. Natl. Acad. Sci. USA 116, 22152–22157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gaspar JM (2018). NGmerge: merging paired-end reads via novel empirically-derived models of sequencing errors. BMC Bioinformatics 19, 536–539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Grasso CS, Tang Y, Truffaux N, Berlow NE, Liu L, Debily M-A, Quist MJ, Davis LE, Huang EC, Woo PJ, et al. (2015). Functionally defined therapeutic targets in diffuse intrinsic pontine glioma. Nat. Med 21, 555–559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Harutyunyan AS, Krug B, Chen H, Papillon-Cavanagh S, Zeinieh M, De Jay N, Deshmukh S, Chen CCL, Belle J, Mikael LG, et al. (2019). H3K27M induces defective chromatin spread of PRC2-mediated repressive H3K27me2/me3 and is essential for glioma tumorigenesis. Nat. Commun 10, 1262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. He Y, Selvaraju S, Curtin ML, Jakob CG, Zhu H, Comess KM, Shaw B, The J, Lima-Fernandes E, Szewczyk MM, et al. (2017). The EED protein-protein interaction inhibitor A-395 inactivates the PRC2 complex. Nat. Chem. Biol 13, 389–395. [DOI] [PubMed] [Google Scholar]
  17. Healy E, Mucha M, Glancy E, Fitzpatrick DJ, Conway E, Neikes HK, Monger C, Van Mierlo G, Baltissen MP, Koseki Y, et al. (2019). PRC2.1 and PRC2.2 Synergize to Coordinate H3K27 Trimethylation. Mol. Cell 76, 437–452.e6. [DOI] [PubMed] [Google Scholar]
  18. Herz H-M, Morgan M, Gao X, Jackson J, Rickels R, Swanson SK, Florens L, Washburn MP, Eissenberg JC, and Shilatifard A (2014). Histone H3 lysine-to-methionine mutants as a paradigm to study chromatin signaling. Science 345, 1065–1070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hoelper D, Huang H, Jain AY, Patel DJ, and Lewis PW (2017). Structural and mechanistic insights into ATRX-dependent and -independent functions of the histone chaperone DAXX. Nat. Commun 8, 1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Højfeldt JW, Hedehus L, Laugesen A, Tatar T, Wiehle L, and Helin K (2019). Non-core Subunits of the PRC2 Complex Are Collectively Required for Its Target-Site Specificity. Mol. Cell 76, 423–436.e3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hübner J-M, Müller T, Papageorgiou DN, Mauermann M, Krijgsveld J, Russell RB, Ellison DW, Pfister SM, Pajtler KW, and Kool M (2019). EZHIP/CXorf67 mimics K27M mutated oncohistones and functions as an intrinsic inhibitor of PRC2 function in aggressive posterior fossa ependymoma. Neuro-oncol. 21, 878–889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jain SU, Do TJ, Lund PJ, Rashoff AQ, Diehl KL, Cieslik M, Bajic A, Juretic N, Deshmukh S, Venneti S, et al. (2019). PFA ependymoma-associated protein EZHIP inhibits PRC2 activity through a H3 K27M-like mechanism. Nat. Commun 10, 2146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Justin N, Zhang Y, Tarricone C, Martin SR, Chen S, Underwood E, De Marco V, Haire LF, Walker PA, Reinberg D, et al. (2016). Structural basis of oncogenic histone H3K27M inhibition of human polycomb repressive complex 2. Nat. Commun 7, 11316. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Kimura H, and Cook PR (2001). Kinetics of core histones in living human cells: little exchange of H3 and H4 and some rapid exchange of H2B. J. Cell Biol 153, 1341–1353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Krug B, De Jay N, Harutyunyan AS, Deshmukh S, Marchione DM, Guilhamon P, Bertrand KC, Mikael LG, McConechy MK, Chen CCL, et al. (2019). Pervasive H3K27 Acetylation Leads to ERV Expression and a Therapeutic Vulnerability in H3K27 M Gliomas. Cancer Cell 35, 782–797.e8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Langmead B, Trapnell C, Pop M, and Salzberg SL (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Larson JD, Kasper LH, Paugh BS, Jin H, Wu G, Kwon C-H, Fan Y, Shaw TI, Silveira AB, Qu C, et al. (2019). Histone H3.3 K27M Accelerates Spontaneous Brainstem Glioma and Drives Restricted Changes in Bivalent Gene Expression. Cancer Cell 35, 140–155.e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lee C-H, Yu J-R, Kumar S, Jin Y, LeRoy G, Bhanu N, Kaneko S, Garcia BA, Hamilton AD, and Reinberg D (2018). Allosteric Activation Dictates PRC2 Activity Independent of Its Recruitment to Chromatin. Mol. Cell 70, 422–434.e6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lewis PW, Müller MM, Koletsky MS, Cordero F, Lin S, Banaszynski LA, Garcia BA, Muir TW, Becher OJ, and Allis CD (2013). Inhibition of PRC2 activity by a gain-of-function H3 mutation found in pediatric glioblastoma. Science 340, 857–861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Li B, and Dewey CN (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 323, 10.1186/1471-2105-12-323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, and Durbin R; 1000 Genome Project Data Processing Subgroup (2009). The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Li H, Liefke R, Jiang J, Kurland JV, Tian W, Deng P, Zhang W, He Q, Patel DJ, Bulyk ML, et al. (2017). Polycomb-like proteins link the PRC2 complex to CpG islands. Nature 549, 287–291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Margueron R, Justin N, Ohno K, Sharpe ML, Son J, Drury WJ 3rd, Voigt P, Martin SR, Taylor WR, De Marco V, et al. (2009). Role of the polycomb protein EED in the propagation of repressive histone marks. Nature 461, 762–767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mohammad F, Weissmann S, Leblanc B, Pandey DP, Højfeldt JW, Comet I, Zheng C, Johansen JV, Rapin N, Porse BT, et al. (2017). EZH2 is a potential therapeutic target for H3K27M-mutant pediatric gliomas. Nat. Med 23, 483–492. [DOI] [PubMed] [Google Scholar]
  35. Müller J, and Kassis JA (2006). Polycomb response elements and targeting of Polycomb group proteins in Drosophila. Curr. Opin. Genet. Dev 16, 476–484. [DOI] [PubMed] [Google Scholar]
  36. Nagaraja S, Quezada MA, Gillespie SM, Arzt M, Lennon JJ, Woo PJ, Hovestadt V, Kambhampati M, Filbin MG, Suvà ML, et al. (2019). Histone Variant and Cell Context Determine H3K27M Reprogramming of the Enhancer Landscape and Oncogenic State. Mol. Cell 76, 965–980.e12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Oksuz O, Narendra V, Lee C-H, Descostes N, LeRoy G, Raviram R, Blumenberg L, Karch K, Rocha PP, Garcia BA, et al. (2018). Capturing the Onset of PRC2-Mediated Repressive Domain Formation. Mol. Cell 70, 1149–1162.e5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Orsi GA, Kasinathan S, Hughes KT, Saminadin-Peter S, Henikoff S, and Ahmad K (2014). High-resolution mapping defines the cooperative architecture of Polycomb response elements. Genome Res. 24, 809–820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Pajtler KW, Wen J, Sill M, Lin T, Orisme W, Tang B, Hübner J-M, Ramaswamy V, Jia S, Dalton JD, et al. (2018). Molecular heterogeneity and CXorf67 alterations in posterior fossa group A (PFA) ependymomas. Acta Neuropathol. 136, 211–226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Pasini D, Cloos PAC, Walfridsson J, Olsson L, Bukowski J-P, Johansen JV, Bak M, Tommerup N, Rappsilber J, and Helin K (2010). JARID2 regulates binding of the Polycomb repressive complex 2 to target genes in ES cells. Nature 464, 306–310. [DOI] [PubMed] [Google Scholar]
  41. Piunti A, Hashizume R, Morgan MA, Bartom ET, Horbinski CM, Marshall SA, Rendleman EJ, Ma Q, Takahashi Y-H, Woodfin AR, et al. (2017). Therapeutic targeting of polycomb and BET bromodomain proteins in diffuse intrinsic pontine gliomas. Nat. Med 23, 493–500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Piunti A, Smith ER, Morgan MAJ, Ugarenko M, Khaltyan N, Helmin KA, Ryan CA, Murray DC, Rickels RA, Yilmaz BD, et al. (2019). CATACOMB: An endogenous inducible gene that antagonizes H3K27 methylation activity of Polycomb repressive complex 2 via an H3K27M-like mechanism. Sci. Adv 5, eaax2887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Pratt D, Quezado M, Abdullaev Z, Hawes D, Yang F, Garton HJL, Judkins AR, Mody R, Chinnaiyan A, Aldape K, et al. (2020). Diffuse intrinsic pontine glioma-like tumor with EZHIP expression and molecular features of PFA ependymoma. Acta Neuropathol. Commun 8, 37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Quinlan AR, and Hall IM (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Ragazzini R, Pérez-Palacios R, Baymaz IH, Diop S, Ancelin K, Zielinski D, Michaud A, Givelet M, Borsos M, Aflaki S, et al. (2019). EZHIP constrains Polycomb Repressive Complex 2 activity in germ cells. Nat. Commun 10, 3858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ramachandran S, Vogel L, Strahl BD, and Dokholyan NV (2011). Thermodynamic stability of histone H3 is a necessary but not sufficient driving force for its evolutionary conservation. PLoS Comput. Biol 7, e1001042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ramírez F, Ryan DP, Grüning B, Bhardwaj V, Kilpert F, Richter AS, Heyne S, Dündar F, and Manke T (2016). deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 44, W160–W165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Robinson JT, Thorvaldsdóttir H, Wenger AM, Zehir A, and Mesirov JP (2017). Variant Review with the Integrative Genomics Viewer. Cancer Res. 77, e31–e34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Schwartzentruber J, Korshunov A, Liu X-Y, Jones DTW, Pfaff E, Jacob K, Sturm D, Fontebasso AM, Quang D-AK, Tönjes M, et al. (2012). Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature 482, 226–231. [DOI] [PubMed] [Google Scholar]
  50. Stafford JM, Lee C-H, Voigt P, Descostes N, Saldaña-Meyer R, Yu J-R, Leroy G, Oksuz O, Chapman JR, Suarez F, et al. (2018). Multiple modes of PRC2 inhibition elicit global chromatin alterations in H3K27M pediatric glioma . Sci. Adv 4, eaau5935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Sun G, Chung D, Liang K, and Keles S (2013). Statistical analysis of ChIP-seq data with MOSAiCS. Methods Mol. Biol 1038, 193–212. [DOI] [PubMed] [Google Scholar]
  52. Wani AH, Boettiger AN, Schorderet P, Ergun A, Münger C, Sadreyev RI, Zhuang X, Kingston RE, and Francis NJ (2016). Chromatin topology is coupled to Polycomb group protein subnuclear organization. Nat Commun 7, 10291–10313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wu G, Broniscer A, McEachron TA, Lu C, Paugh BS, Becksfort J, Qu C, Ding L, Huether R, Parker M, et al. (2012). Somatic histone H3 alterations in pediatric diffuse intrinsic pontine gliomas and non-brainstem glio-blastomas. Nat. Genet 44, 251–253. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures

Data Availability Statement

The accession number for the Next-generation sequencing data generated and reported in this paper is GEO: GSE151983. Original data have been deposited to Mendeley Data, https://doi.org/10.17632/xtp4xytd2c.1. Code used to analyze data are described in the STAR methods.

RESOURCES