Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Apr 1.
Published in final edited form as: J Periodontal Res. 2019 Sep 21;55(2):191–198. doi: 10.1111/jre.12701

Potential Roles of miR-335-5p on Pathogenesis of Experimental Periodontitis

Junxiang Lian 1,2, Xingwen Wu 2, Yao Liu 2, Wei Qiu 2, Xiaofang Zhu 2, Xiaoxuan Wang 2, Shu Meng 3, Paloma Valverde 2, Bjorn Steffensen 4, Qisheng Tu 2,*, Jian Pan 1,*, Jake Chen 2,5,*
PMCID: PMC7680696  NIHMSID: NIHMS1049418  PMID: 31541471

Abstract

Background and Objective

Periodontitis is a prevalent oral disease responsible for tooth loss. MicroRNAs have been proven crucial in bone disorders over the past decades. Promotive effect on osteogenic activities by microRNA-335–5p (miR-335–5p) has been well demonstrated, but its role involved in the pathogenesis of periodontitis remains elusive. In this study, we established experimental periodontitis (EP) on transgenic mice overexpressing miR-335–5p (335-Tg) to investigate the novel effects of miR-335–5p on periodontal inflammation and bone loss.

Methods

EP was established via ligation. The expression of inflammatory and osteoclastic genes was examined by quantitative real-time PCR (qPCR). Morphology of alveolar bone was analyzed by microcomputed tomography (μCT). Hematoxylin and eosin (H&E), tartrate-resistant acid phosphatase (TRAP) and Toll-like receptor 4 (TLR4) immunohistochemistry (IHC) staining were conducted for histological analysis.

Results

The expression of miR-335–5p decreased significantly in the periodontal tissues of EP. Compared to the WT-EP group, μCT analysis showed less bone loss in the 335-Tg-EP group accompanying with a decreased number of TRAP-positive osteoclasts. H&E and IHC staining exhibited attenuated inflammation and TLR4 expression in the 335-Tg-EP group. Furthermore, reduced expressions of IL-1β, IL-6, TNF-α, and TLR4 were also detected in the 335-Tg-EP group. Overexpression of miR-335–5p in vivo weakened the periodontal bone destruction and inflammation compared with the WT-EP group.

Conclusions

Our data exhibit novel roles of miR-335–5p in preventing bone loss and inflammation in experimental periodontitis.

Keywords: miR-335-5p, transgenic mice, experimental periodontitis, bone destruction

1. INTRODUCTION

Periodontitis, a prevalent chronic oral disease responsible for tooth loss, is featured by periodontal inflammation and progressive alveolar bone destruction. During the past decades, preventing the occurrence of periodontitis remains a great challenge for clinicians, despite various mechanisms underlying periodontitis extensively explained. However, since accumulating studies have confirmed that the epigenetic regulators, especially for microRNAs,1–5 are crucial in the development of various diseases, exploring the roles of specific microRNA linked to periodontitis could contribute to our understandings on the pathogenesis of periodontitis.

MicroRNAs (miRNAs), small noncoding RNAs rarely translated into peptides or protein, are of great importance in multiple biological processes and various kinds of disease6,7. Several studies have proved that miRNAs could be critical regulators in bone remodeling and inflammatory response such as periodontitis8–10. The aberrant miRNA expression reacting to pathologic products, in turn, affects periodontitis9–11. In our previous studies, it has been shown that microRNA-335–5p (miR-335–5p) could promote osteoblast differentiation and bone regeneration in vitro and in miR-335–5p transgenic (335-Tg) mice via inhibiting DKK1, a Wnt pathway antagonist, which have been well-characterized3–5. Besides, several studies have reported the inhibitive effects of miR-335–5p on bone-related disorders. For instance, in the samples of non-traumatic osteonecrosis of femoral head (ONFH), the microarray and real-time quantitative PCR (qPCR) data verified that miR-335–5p was one of the three significantly downregulated miRNAs12. Furthermore, miR-335 could be secreted into conditional medium as exosomes to repress osteoclastic bone metastases of small cell lung cancer13. Additionally, in the serum of rats subjected to experimental periodontitis (EP), miR-335–5p was also found remarkably decreased14. Also, in the septic mouse model, upregulated miR-335–5p alleviated inflammatory responses via negatively regulating fatty acid synthase15.

Considering these distinctive expressions and functions of miR-335–5p in bone and inflammatory disorders as well as its limited understandings in periodontitis, in the current study, we established experimental periodontitis on 335-Tg mice and wild type (WT) littermates to investigate the effects of miR-335–5p on periodontal inflammatory response and bone destruction.

2. MATERIALS AND METHODS

2.1. 335-Tg mice identification and EP establishment

The 335-Tg mice, as described in our previous study3, overexpress miR-335–5p driven by osterix promoter. To identify the plasmid integration of mice, gDNA was extracted from tails of 3-week mice by DNeasy Blood & Tissue Kits (QIAGEN, MD, USA), then amplified to perform genotyping. Then 8-week male 335-Tg mice (n=12) and WT mice (n=14) of the same age and gender were subjected to establish EP model via ligation on the unilateral maxillary second molars with 5–0 silk suture as we described previously16, the opposite sides were regarded as a sham control. The ethical approval of this study was approved by the IACUC of UCSD and the care and use of laboratory animals and Animal Research in accordance with the NIH guidelines.

2.2. Quantification of RNA

After a 2-week suture placement, the mice were sacrificed to obtain alveolar bone and gingivae. For qPCR assay, total RNA was extracted with the miRNeasy Mini Kit (QIAGEN, MD, USA). Reverse transcription reaction of miRNAs and mRNAs were performed by the miRCURY LNA RT Kit and M-MLV Transcriptase (Promega, WI, USA), respectively. qPCR assays were carried out by miRCURY LNA SYBR Green PCR Kit (QIAGEN, MD, USA) to evaluate the expression of miR-335–5p in alveolar bone and gingivae. The expressions of mRNAs were examined by PowerUp SYBR Green Master Mix kit (Thermo Fisher, MA, USA). Each experiment was conducted by the iQ5 instrument at least three times (Bio-Rad, CA, USA). U6 snRNA and GAPDH were used as endogenous controls for miRNA and mRNA normalization, respectively. Primers were listed in (Table 1).

Table 1.

Primer sequences for qPCR analysis

Gene Forward Primer Reverse Primer
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
TRAP GGGAAATGGCCAATGCCAAAGAGA TCGCACAGAGGGATCCATGAAGTT
Cathepsin K GAAGAAGACTCACCAGAAGCAG TCCAGGTTATGGGCAGAGATT
MMP9 GCAGAGGCATACTTGTACCG TGATGTTATGATGGTCCCACTTG
NFATc1 GGAGAGTCCGAGAATCGAGAT TTGCAGCTAGGAAGTACGTCT
IL-1β GTCAACGTGTGGGGGATGAA AAGCAATGTGCTGGTGCTTC
IL-6 TCCAGTTGCCTTGGGAC AGTCTCCTCTCCGGACTTGT
TNF-α TGTCCCTTTCACTCACTGGC CATCTTTTGGGGGAGTGCCT
TLR4 ACTTGATACTGACAGGAAACCC TTCCCTGAAAGGCTTGGTCT
RANKL CAGCATCGCTCTGTTCCTGTA CTGCGTTTTCATGGAGTCTCA
U6 CGCTTCGGCAGCACATATAC TTCACGAATTTGCGTGTCAT
miR-335–5p (genotyping) CCAGGGATTTCAGTCGATGT AATCTCACGCAGGCAGTTCT

Primer of miR-335–5p for qPCR was purchased from Qiagen (Cat. No. YP02119293)

2.3. Morphological analysis of alveolar bone by microcomputed tomography (μCT)

The morphology of alveolar bone was captured and reconstructed by μCT (Bruker, MA, USA) to evaluate the periodontal bone loss. The alveolar bone loss was described as the distance from the cementoenamel junction to the alveolar bone crest (CEJ-ABC) and the values were measured at 6 periodontal sites (mesiobuccal, midbuccal, distobuccal, mesiopalatal, midpalatal, and distopalatal) of the second molars by CTAn software (Bruker, MA, USA).

For measurement of residual volume of alveolar bone, we selected a region of interest (ROI) around the second molar with a fixed size of 1100×1000×400μm3 (shown in FigS1). The bone volume/total volume (BV/TV) was measured from ROI for each sample and comparisons were made between EP groups.

2.4. Tartrate resistant acid phosphatase (TRAP) staining

Specimens of alveolar bone were fixed by 10% formalin, decalcified by 10% EDTA for 3 weeks and then embedded in paraffin, slides of 5μm were prepared for TRAP staining by Acid Phosphatase, Leukocyte (TRAP) Kit (Sigma-Aldrich, MO, USA) following the instructions provided by the manufacturer. The numbers of TRAP-positive multinucleated cells on the linear surface of alveolar bone were counted. Three tissue sections per mice were measured and each sample was counted three times for averaging. Data are expressed as the mean number of cells/bone surface.

2.5. Histological analysis of alveolar bone

Alveolar tissue sections were also prepared for hematoxylin and eosin (H&E) staining as previously described17. Inflammatory cells were counted from 5 separate fields of each sample at 200× magnification on H&E-stained sections. Data were reported as cells/mm2 18. Immunohistochemical staining (IHC) to examine TLR4 (Santa Cruz Biotechnology, TX, USA) expression in gingival tissues was also conducted by Histostain Kit (Life Technologies, CA, USA) according to the manufacture’s instruction. TLR4 positive cells were counted under 200× magnification, three sections per sample. The result was described as the number of positive cells/200×. Furthermore, Image J software has been used to quantify the positive area of TLR4 in each EP group (shown in FigS2). Photographs of slides stained by H&E and IHC were taken under OLYMPUS BX53 microscope (OLYMPUS, Japan).

2.6. Statistical Analysis

All quantification statistical analysis of 2 groups was performed with t-test or 4 groups with two-way ANOVA by Graphpad Prism 7.0 software. Data were obtained from experiments performed at least 3 separate times. The expression levels of RNA were calculated with the comparative cycle threshold method using GAPDH or U6 (for miRNA) for normalization. Thresholds for significance were set at *P < 0.05, **P < 0.01 and ***P < 0.001. All data are shown as mean ± SD.

3. RESULTS

3.1. The expression of miR-335–5p decreased significantly in experimental periodontitis (EP)

The MiR-335–5p transgenic mice (335-Tg) were identified as described previously3, littermates without miR-335–5p plasmid integration were used as wild type (WT) control (Fig 1A). To assess the effects of miR-335–5p on periodontitis, initially, we evaluated the expression of miR-335–5p in alveolar bone and gingivae of the WT-EP group. Analysis of qPCR showed that the level of miR-335–5p decreased in the alveolar bone of EP sides compared to the opposite sides of the sham controls. Similar results were also observed in corresponding gingival tissues (Fig 1B). Then, we introduced EP to the 335-Tg mice as well. Two-way ANOVA analysis of qPCR results showed that the basic levels of miR-335–5p in the alveolar bone and gingivae of the 335-Tg-Healthy group were higher than in the WT-Healthy group, varying in degrees, while periodontitis introduction remarkably decreased the expression of miR-335–5p in both the alveolar bone and gingivae (Fig 1C and 1D). These data indicate that miR-335–5p was downregulated in response to periodontitis.

Figure 1.

Figure 1

The expression of miR-335–5p decreased in periodontitis. A. To identify miR-335–5p transgenic (335-Tg) mice, PCR products of genomic DNA were added to run in 1.5% agarose gel. PC: positive control, 335-Tg: miR-335–5p transgenic mice, NC: negative control, WT: wild type (littermates without miR-335–5p plasmid integration) B. The results of qPCR indicated that experimental periodontitis (EP) decreased the level of miR-335–5p in both alveolar bone and gingivae of WT mice C. Two-way ANOVA analysis of qPCR results among WT-Healthy, WT-EP, 335-Tg, and 335-Tg-EP groups showed that the basic expression of miR-335–5p in alveolar bone of 335-Tg-Healthy group was higher than in their WT-Healthy littermates, while EP establishment downregulated miR-335–5p expression in both EP groups. D. Higher level of miR-335–5p in gingivae of the 335-Tg-Healthy group was also detected by qPCR and the expression of miR-335–5p in the gingivae of WT-EP and 335-Tg-EP were downregulated groups as well. (WT: n=8, 335-Tg: n=6; Data are shown as mean ± SD. *P < 0.05. **P < 0.01. ***P < 0.001)

3.2. Transgenic miR-335–5p in vivo reduced alveolar bone loss caused by periodontitis

Morphology analysis of alveolar bone destructions at 6 sites exhibited that there was 14% less bone loss on buccal sides of the 335-Tg-EP group than on that of the WT-EP group, accomplished with average values of 0.50±0.48 mm and 0.57±0.65 mm in the 335-Tg-EP and WT-EP group, respectively (Fig 2A and 2B). Palatal bone loss also decreased by 18% in the 335-Tg-EP sides and the average values were 0.41±0.59 mm in 335-Tg-EP and 0.49±0.41 mm in the WT-EP group, respectively (Fig 2C and 2D). We then conducted TRAP staining and found fewer osteoclasts on the alveolar bone surface of the 335-Tg-EP group than in the WT-EP group (Fig 2E and 2F). Further analysis of μCT also showed that the residual bone value (shown as BV/TV) of the 335-Tg-EP group was higher than that of the WT-EP group (Fig 2G). In addition, qPCR data also confirmed the decreased expression of osteoclastic marker genes such as cathepsin K (CTSK), MMP9 and NFATc1 (Fig 2H).

Figure 2.

Figure 2

Transgenic overexpression of miR-335–5p in vivo reduced alveolar bone loss in experimental periodontitis. A and B. Morphology analysis showed that the distance from alveolar bone crest (ABC) to the cementoenamel junction (CEJ) on the buccal sides of mice decreased 14% in 335-Tg-EP mice, accomplished with an average value of 0.57±0.65 mm in WT-EP mice, (n=6) and 0.50±0.48 mm in 335-Tg-EP mice (n=6). C and D. On the palatal sides, the average bone loss was 0.49±0.41 mm and 0.41±0.59 mm in WT-EP and 335-Tg-EP mice, respectively. E and F. TRAP staining of EP groups. The number of TRAP-positive cells (indicated by black arrows attached on the alveolar bone surface) was 11.17±1.46 (WT-EP) and 6.83±2.11 (335-Tg-EP), respectively. G. The residual volume of alveolar bone of WT-EP group was statistically less than in the 335-Tg-EP group, shown as bone volume/total volume (BV/TV). H. Analysis of qPCR also showed that the decreased expression of CTSK, MMP9, and NFATc1 in the alveolar bone of 335-Tg-EP group. (Data are shown as mean ± SD. *P < 0.05. **P < 0.01. ***P < 0.001; scale bar = 500μm)

3.3. MiR-335–5p Attenuated Periodontal Inflammation

To further explore if periodontal inflammation could be affected by overexpression of miR-335–5p in vivo, we performed H&E staining and discovered that the boundary of the gingival epithelium was more intact and distinguishable with less inflammatory cells infiltrated in the 335-Tg-EP group compared with the WT-EP group (Fig 3A and 3B). Since TLR4 is an important marker in periodontal inflammation, we initially examined its expression by TLR4 specific IHC staining. The number of TLR4-stained positive cells showed attenuated TLR4 expression in periodontal soft tissues in the 335-Tg-EP group contrasted within the WT-EP group, especially the periodontal epithelium (Fig 3C and 3D), which were also confirmed by analysis of grey value (Fig S2). In addition, higher level of TLR4 mRNA in gingival tissue was detected in the WT-EP group, while the 335-Tg-EP group exhibited decreased TLR4 expression (Fig 3E). Furthermore, we evaluated the levels of genes stimulated by periodontitis by qPCR, the expressions of IL-1β, IL-6, TNF-α, and Receptor Activator of Nuclear Factor-κB Ligand (RANKL) were found be significantly declined in the alveolar bone and gingivae of the 335-Tg-EP group compared to the corresponding WT-EP group (Fig 3F). These data indicate that enhanced miR-335–5p expression negatively regulate periodontal inflammation.

Figure 3.

Figure 3

MiR-335–5p attenuated periodontal inflammation. A. The morphology of gingivae in 335-Tg-EP mice was more intact with clear distinguishable boundary and fewer bone destructions than WT-EP mice. B. The number of inflammatory cells of WT-EP group was less than in samples of the 335-Tg-EP group (shown as black arrows). C and D. In the 335-Tg-EP group, TLR4 positive cells (shown as black arrows) were statistically less than WT-EP group. E. Compared with WT-EP group, the expression of inflammatory genes IL-1β, IL-6, TNF-α, and RANKL in alveolar bone and gingivae were also declined in 335-Tg-EP group detected by qPCR. F. The result of qPCR further verified the expression of TLR4 mRNA decreased in gingivae of the 335-Tg-EP group. (Data are shown as mean ± SD. *P < 0.05. **P < 0.01. ***P < 0.001; scale bar = 500μm).

4. DISCUSSION

MiR-335–5p, a crucial post-transcriptional regulator in Wnt signaling, has been proven positive for bone formation in our lab3–5. In addition, miR-335–5p has also been emerging negatively coordinated with inflammatory diseases14,19. Periodontitis is a chronic oral disease characterized by periodontal inflammation and bone loss. Previous study has reported a significant decrease of the miR-335–5p in serum of the rats with periodontitis14, while the role of miR-335–5p in periodontitis remains largely unclear. Thus, to explore the effects of miR-335–5p on periodontitis, we established experimental periodontitis on the 335-Tg mice and their WT littermates, respectively. In consequence, we are the first to find that transgenic overexpression of miR-335–5p in vivo could alleviate bone loss and inflammation of periodontitis.

To explore if the expression of miR-335–5p changed in periodontitis, we initially evaluated the level of miR-335–5p in the periodontal tissue of the WT-EP group. We found that the expression of miR-335–5p significantly decreased in both the alveolar bone and gingivae of EP sides compared to sham control. Then we introduced EP to 335-Tg mice, consistent with results of our previous data3, specific overexpression of miR-335–5p was easily found in the alveolar bone (bone tissue) of the 335-Tg-Healthy group and miR-335–5p also increased 2~3 folds in gingivae compared with the WT-Healthy control, while EP establishment downregulated the expression of miR-335–5p in the 335-Tg-EP group as well. These data indicated that miR-335–5p could be an active responder to periodontitis.

We then scanned the alveolar bone and reconstructed their morphology in each group by μCT. The 3D images exhibited less bone loss around the subjected molars in the 335-Tg-EP group than in WT-EP group and BV/TV also proved more residual alveolar bone in the 335-Tg-EP group. Moreover, TRAP staining also showed decreased TRAP-positive cells in the 335-Tg-EP samples attached to the alveolar bone surface, meanwhile, lower expression of osteoclast-related genes including CTSK, MMP9 and NFATc1 were detected as well. Although in the previous study of 335-Tg mice, the number of osteoclasts barely reduced when the bone was under normal healthy condition3. In our current study, periodontitis interference might invoke some signals resulting in decreased osteoclasts in the alveolar bone of the 335-Tg mice. Since the existing results indicate that miR-335–5p can activate the Wnt canonical pathway to promote osteogenesis and inhibit bone loss in periodontitis and the Wnt signaling has been divided as canonical and non-canonical pathway, both of which are pivotal in the periodontal homeostasis20–23, whether miR-335–5p can regulate bone metabolism through the non-canonical Wnt pathway has potential deserving further investigation. Consequently, in addition to the inhibitive effects of exosome miR-335 on osteoclast-related bone-metastasis via repressing RANKL13, our study is the first to find that overexpression of miR-335–5p in vivo negatively involves in periodontal bone destruction.

Furthermore, to evaluate the role of miR-335–5p in periodontal inflammation, H&E staining of the alveolar bone and qPCR of the gingivae were conducted. Similarly, more bone mass and intact gingival epithelium with less inflammatory cells and clearer boundary around the teeth of the 335-Tg-EP group were observed compared to the WT-EP group. Besides, TLR4, as the main receptor in response to offensive products, have been showed crucial in periodontitis by several lines of evidence24,25. Increased expression of TLR4 in periodontal tissue has been demonstrated to favor the development of periodontitis26–28. In our study, qPCR data proved that enhancing miR-335–5p expression in vivo decreased classical inflammatory genes of periodontitis, such as IL-1β, IL-6, TNF-α, and TLR4. Specific TLR4 IHC assay further proved that less TLR4 protein expressed in periodontal soft tissues of 335-Tg-EP sides compared with that of the WT-EP group. Inhibitive role of miR-335–5p in TLR4 signaling was previously reported in prevention of lower extremity deep venous thrombosis19, while in periodontitis, the suppressing effect of miR-335–5p on TLR4 was newly found.

In conclusion, it is the first time that we found the novel effects of miR-335–5p in periodontitis. Transgenic overexpression of miR-335–5p could alleviate bone loss and osteoclastic genes as well as inflammatory products of periodontitis, including TLR4. Collectively, our findings suggested that miR-335–5p could be a novel potential preventative agent for periodontal disease in the future.

Supplementary Material

Supp figS1-2

ACKNOWLEDGEMENTS

This work was supported by National Institutes of Health (NIH) grants R01 DE21464, RO1DE25681, and RO1DE26507; an Innovation in Oral Care Award through the International Association for Dental Research and GlaxoSmithKline Consumer Healthcare; and an award through the International Team of Implantology to J.C.

Footnotes

CONFLICT OF INTEREST

The authors declare no conflicts of interests with respect to the authorship and/or publication of this article.

REFERENCES

  • 1.Wang X, Guo B, Li Q, et al. miR-214 targets ATF4 to inhibit bone formation. Nat Med. 2013;19(1):93–100. [DOI] [PubMed] [Google Scholar]
  • 2.Bertoli G, Cava C, Castiglioni I. MicroRNAs: New Biomarkers for Diagnosis, Prognosis, Therapy Prediction and Therapeutic Tools for Breast Cancer. Theranostics. 2015;5(10):1122–1143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zhang L, Tang Y, Zhu X, et al. Overexpression of MiR-335–5p Promotes Bone Formation and Regeneration in Mice. J Bone Miner Res. 2017;32(12):2466–2475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sui L, Wang M, Han Q, et al. A novel Lipidoid-MicroRNA formulation promotes calvarial bone regeneration. Biomaterials. 2018;177:88–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhang J, Tu Q, Bonewald LF, et al. Effects of miR-335–5p in modulating osteogenic differentiation by specifically downregulating Wnt antagonist DKK1. J Bone Miner Res. 2011;26(8):1953–1963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lian JB, Stein GS, van Wijnen AJ, et al. MicroRNA control of bone formation and homeostasis. Nat Rev Endocrinol. 2012;8(4):212–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kloosterman WP, Plasterk RH. The diverse functions of microRNAs in animal development and disease. Dev Cell. 2006;11(4):441–450. [DOI] [PubMed] [Google Scholar]
  • 8.Luan X, Zhou X, Naqvi A, et al. MicroRNAs and immunity in periodontal health and disease. Int J Oral Sci. 2018;10(3):24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Larsson L, Castilho RM, Giannobile WV. Epigenetics and Its Role in Periodontal Diseases: A State-of-the-Art Review. J Periodontol. 2015;86(4):556–568. [DOI] [PubMed] [Google Scholar]
  • 10.Guo J, Zeng X, Miao J, et al. MiRNA-218 regulates osteoclast differentiation and inflammation response in periodontitis rats through Mmp9. Cell Microbiol. 2018:e12979. [DOI] [PubMed] [Google Scholar]
  • 11.Zhou X, Luan X, Chen Z, et al. MicroRNA-138 Inhibits Periodontal Progenitor Differentiation under Inflammatory Conditions. J Dent Res. 2016;95(2):230–237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wu XJ, Zhang YT, Guo X, et al. Identification of differentially expressed microRNAs involved in non-traumatic osteonecrosis through microRNA expression profiling. Gene. 2015;565(1):22–29. [DOI] [PubMed] [Google Scholar]
  • 13.Gong M, Ma J, Guillemette R, et al. miR-335 inhibits small cell lung cancer bone metastases via IGF-IR and RANKL pathways. Mol Cancer Res. 2014;12(1):101–110. [DOI] [PubMed] [Google Scholar]
  • 14.Tomofuji T, Yoneda T, Machida T, et al. MicroRNAs as serum biomarkers for periodontitis. J Clin Periodontol. 2016;43(5):418–425. [DOI] [PubMed] [Google Scholar]
  • 15.Gao XL, Li JQ, Dong YT, et al. Upregulation of microRNA-335–5p reduces inflammatory responses by inhibiting FASN through the activation of AMPK/ULK1 signaling pathway in a septic mouse model. Cytokine. 2018;110:466–478. [DOI] [PubMed] [Google Scholar]
  • 16.Wu X, Qiu W, Hu Z, et al. An Adiponectin Receptor Agonist Reduces Type 2 Diabetic Periodontitis. J Dent Res. 2019:22034518818449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Meng S, Zhang L, Tang Y, et al. BET Inhibitor JQ1 Blocks Inflammation and Bone Destruction. J Dent Res. 2014;93(7):657–662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zhang L, Meng S, Tu Q, et al. Adiponectin ameliorates experimental periodontitis in diet-induced obesity mice. PLoS One. 2014;9(5):e97824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Bao CX, Zhang DX, Wang NN, Zhu XK, Zhao Q, Sun XL. MicroRNA-335–5p suppresses lower extremity deep venous thrombosis by targeted inhibition of PAI-1 via the TLR4 signalingpathway. J Cell Biochem. 2018;119(6):4692–4710. [DOI] [PubMed] [Google Scholar]
  • 20.Chatzopoulos GS, Mansky KC, Lunos S, Costalonga M, Wolff LF. Sclerostin and WNT-5a gingival protein levels in chronic periodontitis and health. J Periodontal Res. 2019. [DOI] [PubMed] [Google Scholar]
  • 21.Miranda TS, Napimoga MH, Feres M, et al. Antagonists of Wnt/beta-catenin signalling in the periodontitis associated with type 2 diabetes and smoking. J Clin Periodontol. 2018;45(3):293–302. [DOI] [PubMed] [Google Scholar]
  • 22.Liu X, Zhang Z, Pan S, Shang S, Li C. Interaction between the Wnt/beta-catenin signaling pathway and the EMMPRIN/MMP-2, 9 route in periodontitis. J Periodontal Res. 2018;53(5):842–852. [DOI] [PubMed] [Google Scholar]
  • 23.Lim WH, Liu B, Cheng D, Williams BO, Mah SJ, Helms JA. Wnt signaling regulates homeostasis of the periodontal ligament. J Periodontal Res. 2014;49(6):751–759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Poltorak A, He X, Smirnova I, et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 1998;282(5396):2085–2088. [DOI] [PubMed] [Google Scholar]
  • 25.Hoshino K, Takeuchi O, Kawai T, et al. Cutting Edge: Toll-Like Receptor 4 (TLR4)-Deficient Mice Are Hyporesponsive to Lipopolysaccharide: Evidence for TLR4 as the Lps Gene Product. J Immunol. 2016;197(7):3749–3752. [PubMed] [Google Scholar]
  • 26.Wang PL, Ohura K, Fujii T, et al. DNA microarray analysis of human gingival fibroblasts from healthy and inflammatory gingival tissues. Biochem Biophys Res Commun. 2003;305(4):970–973. [DOI] [PubMed] [Google Scholar]
  • 27.Ozturk A, Vieira AR. TLR4 as a risk factor for periodontal disease: a reappraisal. J Clin Periodontol. 2009;36(4):279–286. [DOI] [PubMed] [Google Scholar]
  • 28.Ren L, Leung WK, Darveau RP, Jin L. The expression profile of lipopolysaccharide-binding protein, membrane-bound CD14, and toll-like receptors 2 and 4 in chronic periodontitis. J Periodontol. 2005;76(11):1950–1959. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp figS1-2

RESOURCES