Summary
Herpes simplex virus type 1 (HSV-1) infected corneas can develop a blinding immunoinflammatory condition called herpes stromal keratitis (HSK), which involves the loss of corneal sensitivity due to retraction of sensory nerves and subsequent hyperinnervation with sympathetic nerves. Increased concentrations of the cytokine VEGF-A in the cornea are associated with HSK severity. Here, we examined the impact of VEGF-A on neurologic changes that underly HSK using a mouse model of HSV-1 corneal infection. Both CD4+ T cells and myeloid cells produced pathogenic levels of VEGF-A within HSV-1 infected corneas, and CD4+ cell depletion promoted reinnervation of HSK corneas with sensory nerves. In vitro, VEGF-A from infected corneas repressed sensory nerve growth and promoted sympathetic nerve growth. Neutralizing VEGF-A in vivo using bevacizumab inhibited sympathetic innervation, promoted sensory nerve regeneration and alleviated disease. Thus, VEGF-A can shape the sensory and sympathetic nerve landscape within the cornea, with implications for the treatment of blinding corneal disease.
Graphical Abstract

Introduction
The cornea is a clear avascular tissue in the front of the eye. Herpes simplex virus type 1 (HSV-1) infected corneas can develop an immunoinflammatory process called herpes stromal keratitis (HSK) that is characterized by neovascularization, leukocytic infiltration, edema and progressive scarring. HSK is potentially blinding and has a complex pathogenesis. In mouse models, HSK is promoted by CD4+ T cells through elaboration of a variety of Th1 and Th17 cytokines (Bouley et al., 1995; Doymaz and Rouse, 1992; Hendricks et al., 1992; Lepisto et al., 2006; Molesworth-Kenyon et al., 2008; Newell et al., 1989a; Newell et al., 1989b; Suryawanshi et al., 2011b; Tang et al., 1997; Thomas et al., 1997; Verjans et al., 1998). It is widely assumed that these cytokines are produced by CD4+ T cells in response to specific HSV antigens, though proof of this concept has remains elusive. A key feature of HSK in both humans and mouse models is loss of corneal sensation, which reduces blink reflex in response to tactile or mechanical stimulation (Chucair-Elliott et al., 2015; Gallar et al., 2010; Norn, 1970; Rosenberg et al., 2002; Yun et al., 2014).
In HSK, loss of sensation and blink reflex are associated with reduced or complete loss of corneal sensory nerve endings that innervate normal corneas from the trigeminal ganglion (TG) (Hamrah et al., 2010; Muller et al., 2003; Yun et al., 2014). Blinking, among other functions, spreads tear film over the surface of the cornea, protecting it from exposure and desiccation stress (Nishida and Yanai, 2009; Oliveira-Soto and Efron, 2001; Wang et al., 2018). Desiccation stress can then lead to dry eye phenotypes, which can compromise the corneal barrier integrity resulting in microtraumas and increased susceptibility to infection. As inflammation associated with desiccation builds, blood vessels form, which deliver tissue disrupting monocytes, neutrophils, and eventually innate and adaptive T cells (Reyes et al., 2018). Inflammatory processes associated with these infiltrating leukocytes cause disruption of the corneal collagen network that contributes to the clarity of normal corneas and promotes corneal scarring. Recurrent reactivation of HSV-1 from a latent state and shedding into the cornea can cause progressive scarring and permanent loss of visual acuity. The only recourse at this stage is corneal transplantation.
The desiccating effects of reduced blink reflex can be circumvented by a surgical procedure called tarsorrhaphy, forming adhesion between the upper and lower lid margins. Performing tarsorrhaphy on mice with HSV-infected corneas significantly reduces, but does not eliminate corneal inflammation and the accompanying opacity associated with HSK (Yun et al., 2014), showing that the loss of corneal sensation and resulting desiccation stress contributes to HSK in the murine model. Notably, tarsorrhaphy does not prevent the loss of corneal sensory nerves but prevents the exacerbating inflammation associated with corneal desiccation. Thus, infected corneas exhibit mild HSK when protected from desiccation by tarsorrhaphy, but rapidly develop severe HSK when the eyelids are re-opened (Yun et al., 2014).
The cornea is the most densely innervated tissue in the body (Bonini et al., 2003) and is hundreds of times more sensitive to sensory stimuli than other tissues, such as the skin (Zander and Weddell, 1951). Unlike other tissues, the cornea is primarily innervated with sensory nociceptor afferents that respond with sensations of pain to various stimuli (Acosta et al., 2001; Belmonte and Giraldez, 1981; Tanelian and Beuerman, 1984). A temporary or permanent loss of corneal sensory nerves is relatively common during corneal inflammation associated with infections (Bonini et al., 2003; Cruzat et al., 2010; Cruzat et al., 2011; Hamrah et al., 2010; Kurbanyan et al., 2012; Muller et al., 2015), as well as autoimmunity (Tuominen et al., 2003) and graft versus host disease (GvHD)(Royer et al., 2019). During HSV infection, sensory nerves completely retract from infected mouse corneas by 10 days post infection (dpi) (Chucair-Elliott et al., 2015; Yun et al., 2014). Recently, CD4+ T cell-dependent complement activation was reported to participate in the initial loss of sensory nerves in a model of corneal HSV-1 infection and ocular allergy (Royer et al., 2019). Rather than the cornea remaining de-innervated, sympathetic nerves eventually invade the numb cornea around 10 dpi and branch extensively to hyperinnervate the HSK cornea by 28 dpi (Yun et al., 2016). Superior cervical ganglion (SCG)-derived sympathetic hyperinnervation of the cornea represents an important mechanism of HSK pathogenesis. In fact, SCG excision prevents sympathetic hyperinnervation of infected corneas, promotes reinnervation with sensory nerves, and reduces the severity of HSK. The above findings demonstrate that change in the neuroimmune axis of the cornea is an important part of the underlying mechanism of the pathogenesis of HSK(Muller et al., 2003; Yun et al., 2016).
In addition to sensing stimuli, sensory afferents can be directly activated through multiple stimuli that are either host- or microbe- derived. In cutaneous tissue, direct sensing of microbes or cytokines like interleukin (IL)-1β, IL-17, or IL-4 can result in pain or itch (Chiu et al., 2016; Ferreira et al., 1988; McNamee et al., 2011; Oetjen et al., 2017; Pinto et al., 2010). Furthermore, activation of TRPV1+ neurons at specific sites in the skin can initiate a cascade of events resulting in the development of “anticipatory” immunity, which augments the host’s ability to resist fungal and bacterial infections (Cohen et al., 2019). In enteric tissue, microbe-induced inflammation and the activation of the NLRP6 inflammasome can lead to a loss of sensory enteric-associated neurons (EANs), which can impair proper intestinal function for weeks after infection (Matheis et al., 2020). Moreover, loss of EANs is coincidentally followed by an expansion of sympathetic nerves within the intestine, suggesting a dynamic relationship between the sensory and sympathetic nervous systems within the intestine. In lungs, sensory afferents, through production of calcitonin gene-related peptide (CGRP), suppress protective immunity during Staphylococcus aureus pneumonia (Baral et al., 2018a, b).
In this study, we sought to identify factors associated with the disrupted balance between sensory and sympathetic corneal nerves that contributes to corneal pathology, focusing on the context of HSK. Our findings point to a critical role for vascular endothelial growth factor-A (VEGF-A) in preventing the re-establishment of sensory nerves in the cornea after HSK induced de-innervation and in promoting the growth/innervation of non-sensing sympathetic nerves, with therapeutic implications.
Results
VEGF-A is produced by infiltrating leukocytes in HSV-1 infected corneas and levels correlate with HSK severity.
Murine corneas infected with HSV-1 were assessed for HSK severity (based on corneal opacity) at various dpi under conditions in which corneas were protected from desiccation by performing tarsorrhaphy at day 4 (closed eye) or not (open eye). Consistent with previously reported results (Yun et al., 2014), HSK severity measured at 7, 10, 14, and 28 dpi was reduced in corneas protected by tarsorrhaphy (Figure 1A). VEGF-A possesses both angiogenic and neurotrophic activity (Carmeliet and Tessier-Lavigne, 2005; Storkebaum et al., 2005; Tovar et al., 2007) and is produced in corneas with HSK, where it contributes to HSK severity by inducing vascularization of the normally avascular cornea (Ambati et al., 2006; Suryawanshi et al., 2011a; Suryawanshi et al., 2012; Zheng et al., 2002). We therefore measured VEGF-A in infected corneas with mild HSK due to tarsorrhaphy and in those with severe HSK that were not protected by tarsorrhaphy. There was a direct correlation between the levels of VEGF-A in HSV infected corneas and the degree of HSK severity at all times (Figure 1B). These findings were consistent with the notion that desiccation stress increased VEGF-A production in HSV-1 infected corneas, and that VEGF-A contributed to or regulated HSK severity.
Figure 1. VEGF is produced by infiltrating leukocytes in HSV-1 infected corneas and VEGF levels correlate with HSK severity.
Mice were infected with 1 × 105 PFU of HSV-1 (strain RE) and either received tarsorrhaphy at 4 dpi or were left untreated. (A) Mice were examined at 7, 10, 14 and 28 dpi for the severity of HSK and the corneal opacity was monitored in a blinded manner and recorded. (B) At each time point, 5 mice from each group were sacrificed, and corneas were excised and dispersed into single-cell suspensions and cultured in Neural basal A medium (with NGF and GDNF) for 24 hours. Cultures were then harvested and analyzed by sandwich ELISA for VEGF. (C) At each time point, corneas were digested, dispersed into single-cell suspensions and were stained with fluorescently conjugated antibodies to detect corneal leukocytes (CD45+) by flow cytometry. Immune cell populations that produced VEGF-A were quantified as CD11b+F4/80+Ly6G− myeloid cells, CD11b+F4/80−Ly6G+ myeloid cells CD11b+F4/80+Ly6G+ myeloid cells, and CD4+ T cells (CD4+). Flow plots are from 14 dpi. (D) At 14 dpi, HSK corneas were excised, flat mounted, and labeled with antibodies against CD4, F4/80, VEGF, and anti βIII Tubulin antibody. (Top row—high magnification) Arrows point to CD4+ cells in close proximity with VEGF producing F4/80+ cells. (Bottom row—low magnification) Arrows point to CD4+ cells and F4/80+ myeloid cells that were positive for anti-VEGF antibody staining. Data are pooled from 2–3 independent experiments and symbols represent individual mice. Bars represent the mean ± SEM. Significance was calculated using Student’s t test, *p < 0.05, **p < 0.01, ***p < 0.001,****p < 0.0001.
VEGF-A is produced by CD4+ T cells and myeloid cells in HSV-1 infected corneas
We next determined the source of VEGF-A in the corneas of infected mice. Using immunohistochemistry (IHC) and flow cytometric analysis of infected corneas, we established that CD4+ cells and CD11b+ monocytic cells produced VEGF-A (Figure 1 C&D). CD4+ T cells were in close proximity to F4/80+ cells throughout the cornea (Figure1D & Figure S1A). Knowing that dendritic cells and thymus-derived cells express CD4, we determined if VEGF+CD4+ cells were thymus-derived using FACS to isolate CD4+TCRβ+ cells from 14 dpi corneas and performed RT-PCR to assess their levels of VEGF mRNA. Notably, greater than 95% of CD4+ cornea cells co-stained with TCRβ. Furthermore, IHC illustrated the co-expression of CD4 and CD3 on VEGF+ cells in the 14 dpi cornea (Figure S1 B&C). Together, these data supported the conclusion that in addition to myeloid cells, CD4+ T produced VEGF during HSV-1 pathogenesis.
Among the CD11b+ cells, VEGF-A production was restricted to F4/80+Ly6G− myeloid cells, with lesser contributions from F4/80+Ly6G+ myeloid cells and F4/80−Ly6G+ myeloid cells (Figure 1 C&D). By 14 dpi, nearing the peak of HSK severity, VEGF-A-producing myeloid cells were seen in close proximity to nerve fibers (FigureS1D), and in many cases, wrapped cellular projections around the nerve endings (Figure S1E). These findings suggested a possible role for VEGF-A+ myeloid cells in guiding sympathetic nerves into corneas that are rendered devoid of sensory nerve by 7 dpi (Chucair-Elliott et al., 2015; Yun et al., 2014).
Protecting the corneal surface by tarsorrhaphy reduces VEGF-A production by myeloid cells and inhibits sympathetic innervation of infected corneas.
Since protecting corneas from desiccation stress by tarsorrhaphy reduced overall VEGF-A production, it was of interest to determine if tarsorrhaphy uniformly reduced VEGF-A production by infiltrating leukocytes or selectively inhibited production by certain specific populations. In comparing eyes undergoing tarsorrhaphy to open eyes, we found fewer numbers of VEGF-A producing myeloid cells (Figure 2 A–C). Conversely, CD4+ T cells remained unchanged between the groups (Figure 2D). In CD4+ T cells, we found equivalent levels of VEGF mRNA (Figure S1B) and frequency of VEGF-A+ CD4+ T cells (Figure 2E) between the eyes open and tarsorrhaphy groups leading to the conclusion that VEGF-A is likely regulated at the level of transcription in this population. Together, these data suggested that desiccation stress is at least partially responsible for elevated VEGF-A due to the increased recruitment of VEGF-A producing myeloid cells in HSV-infected corneas. Moreover, the tarsorrhaphy-induced reduction of VEGF-A production by these infiltrating leukocytes was most apparent at 14 dpi, when sympathetic nerves were starting to invade the cornea. Indeed, corneas that were protected from desiccation stress by tarsorrhaphy showed a reduction in corneal innervation by sympathetic nerves, which was associated with reduced HSK severity (Figure 2F). Although sympathetic innervation was significantly reduced, sensory innervation was not re-established in the corneas that were protected by tarsorrhaphy.
Figure 2. Protecting the corneal surface by tarsorrhaphy reduces VEGF-A production by leukocytes and inhibits sympathetic innervation of infected corneas.
Mice were infected with 1 × 105 PFU of HSV-1 (strain RE) and either received tarsorrhaphy at 4 dpi or were left untreated. Five mice from each group were sacrificed at 7, 14 and 28 dpi, and the corneas were excised and dispersed into single-cell suspensions that were stained with fluorescently conjugated antibodies to detect corneal immune cells. Numbers represent (A) CD11b+ cells, (B) VEGF-A+ CD11b+ Cells, (C) VEGF-A+CD11b+F4/80+Ly6G− myeloid cells,VEGF-A+CD11b+F4/80+Ly6G+ myeloid cells, VEGF-A+CD11b+F4/80− Ly6G+ myeloid cells, (D) CD4+ T cells, and (E) VEGF-A+ CD4+ T cells. (F) 28 dpi corneas with (Closed eye) or without (Open eye) tarsorrhaphy were excised, flat mounted and labeled with anti βIII Tubulin antibody which labels all the nerves, anti-Tyrosine Hydroxylase (TH) antibody which recognizes sympathetic nerves, anti-substance P (SP) antibody which recognizes sensory nerves, the arrows point to βIII +TH+ sympathetic nerves in the corneas. Results in all panels are represented as mean number of cells ± SEM from 2–3 independent experiments. Symbols represent individual mice. Significance was calculated using Student’s t test, *p < 0.05, **p < 0.01, ***p < 0.001,****p < 0.0001.
Depletion of CD4+ T cells combined with tarsorrhaphy reduces local VEGF-A production and promotes reinnervation of HSK corneas with sensory nerves.
HSV-1 infected corneas that were protected by tarsorrhaphy still exhibited more VEGF-A production, sympathetic innervation, and inflammation than non-infected corneas. Moreover, infiltrating CD4+ T cell numbers (Figure 2 D&E) and the production of VEGF mRNA (Figure S1B) and protein (Figure 1B) were equivalent between the groups. In fact by 28 dpi, a higher frequency of CD4+ T cells were positive for VEGF by flow cytometry in the tarsorrhaphy group (Figure 2E). Therefore, we assessed whether depleting CD4+ T cells from infected corneas would further reduce VEGF-A production by infiltrating leukocytes in eyes that were protected by tarsorrhaphy. Our depletion protocol effectively depleted CD4+ T cells, which we showed were VEGF-A producers, from infected corneas (Figure 3A&B). CD4-depletion also significantly reduced the corneal infiltration of F4/80+Ly6G− VEGF-A-producing myeloid cells (Figure 3C&D), but did not change the numbers of F4/80+Ly6G+ or F4/80−Ly6G+ VEGF-A-producing myeloid cells, possibly due to the low frequency in mock depleted corneas (Figure 3D). Indeed, CD4+ T cell depletion reduced overall VEGF-A levels in infected corneas to those observed in non-infected corneas (Figure 3E). Moreover, reducing VEGF-A levels in CD4+ T cell-depleted corneas almost completely eliminated ingrowth of sympathetic nerves, and promoted re-innervation by sensory nerves (Figure 3F&G). These changes were associated with virtual elimination of HSK in infected corneas (Figure 3H). It should be noted that CD4+ T cell depletion of eyes that did not undergo tarsorrhaphy had no reduction in VEGF-A nor in monocyte infiltration of the cornea, which illustrated the effect desiccation stress has on the corneal microenvironment (Figure S2). Therefore, in an HSK cornea without obvious desiccation stress, CD4+ T cells not only produced VEGF-A but also controlled VEGF-A production by myeloid cells. Moreover, when VEGF-A production by these two cell types was abrogated, there was an associated elimination of sympathetic innervation, reinnervation by sensory nerves, and reduction in HSK.
Figure 3. Depletion of CD4+ T cells combined with tarsorrhaphy reduces local VEGF-A production and promotes reinnervation of HSK corneas with sensory nerves.
Starting two days prior to infection, mice were given a subconjunctival injection of either anti-CD4 antibody or an isotype control antibody every other day until 28 dpi. Mice were then infected with HSV-1 (RE) and eyes from both groups were protected from desiccation by tarsorrhaphy at 4 dpi. Mice were sacrificed at 7, 14, and 28 dpi and corneas from each group were excised, digested with collagenase, dispersed and analyzed by flow cytometry. Leukocyte (CD45+) subpopulations were quantified as (A) CD4+ T cells, (B) VEGF-A+CD4+ T cells, and (C) CD11b+ cells. (D) CD11b+ cells which were further characterized as VEGF-A+F4/80+Ly6G− myeloid cells, VEGF-A+F4/80+Ly6G+ myeloid cells, and VEGF-A+F4/80−Ly6G+ myeloid cells. (E) In parallel, corneas from each group were excised and dispersed into single-cell suspensions and were then cultured in Neurobasal A medium (with NGF, GDNF) for 24 hours. Cells and supernatants were harvested and analyzed by sandwich ELISA for VEGF-A. For the apparent outlier, we performed a statistical outlier test offered by GraphPad; however, this point was not determined to be a statistical outlier. Omitting this point still achieves a p value of < 0.0001 for the cell number analysis and < 0.05 for the ELISA data analysis. (F) At 28 dpi, corneas from both groups were excised, flat mounted and labeled with anti βIII Tubulin antibody, anti-Tyrosine Hydroxylase (TH) antibody, and anti-substance P (SP) antibody. Arrows point to βIII +TH+ sympathetic nerves or βIII +SP+ sensory nerves. (G) Sympathetic nerve length in the corneas with mock or CD4 depletion at 28 dpi were quantified as the cumulative length of nerve fibers in the cornea. (H) The severity of HSK was monitored through 28dpi and the opacity scores (28dpi) were analyzed. Results in all panels are represented as mean ± SEM pooled from 2 independent experiments. Symbols represent individual mice. Significance was calculated using Student’s t test, *p < 0.05, **p < 0.01, ***p < 0.001,****p < 0.0001.
VEGF-A production by cells from corneas with HSK encouraged growth of sympathetic neurites while causing retraction of sensory neurites.
Knowing that VEGF-A levels correlated with disease and the degree of sympathetic innervation within the cornea, we asked if the VEGF-A produced in HSK corneas was able to induce sensory nerve retraction and promote the growth of sympathetic nerves. For this, we cultured sympathetic neurons from dissociated SCG or sensory neurons from dissociated TG in microfluidic chambers for 7 days. This allowed neurons to extend neurites from the neuron soma chamber up to the point of entering the second chamber (Figure 4A). Dissociated cells from infected 14 dpi corneas were then added to the second chamber in the presence or absence of either the clinically approved and widely used human anti-VEGF therapy, bevacizumab (Avastin), or anti-mouse VEGF (R&D Systems). Both bevacizumab and anti-mouse VEGF are antibodies that inhibit VEGF-A signaling in mice. We noted stark differences in axonal growth into the terminal chamber of different treatment groups, allowing us to assign a “yes” (growth) or “no” (no growth) to each well. Using this system we assessed the ability of VEGF-A from a single cornea to modulate the activities of sensory or sympathetic nerves. We then collated those responses to generate a frequency of retraction or extension for either sensory or sympathetic nerves. Corneal cell cultures in which VEGF-A was not neutralized caused retraction of sensory nerve termini in 8 of 9 of cultures (88.9%), while promoting extension of sympathetic neurites in 100% of cultures (Figure 4B–D). Conversely, neutralizing VEGF-A in corneal cell cultures with bevacizumab or anti-mouse VEGF permitted sensory neurite extension in 100% of cultures, while causing sympathetic neurite retraction in 85.7% and 83.3% of cultures, respectively (Figs. 4B–D). Addition of only anti-VEGF antibodies did not affect sensory or sympathetic neurites, suggesting that neither bevacizumab nor anti-mouse VEGF antibody was toxic to these neurons (Figure S3). In these experiments corneal cells were dissociated from 14 dpi corneas, a time when sensory nerves were retracted and sympathetic nerves were actively extending neurites. Since replicating virus is eliminated from the cornea by 6 dpi (Martin et al., 1991) and because the neutralizing antibodies used in vitro were specific for VEGF protein, we concluded from these data that VEGF produced in infected corneas throughout disease was necessary to both maintain sensory nerve retraction and promote sympathetic neurite extension.
Figure 4. VEGF-A production by cells from corneas with HSK promotes growth of sympathetic neurites and retraction of sensory neurites.
Sensory (TG-derived) or sympathetic (SCG-derived) neurons were cultured in a microfluidic chamber (soma chamber) and allowed to extend neurites to grow through the microtubes to the axon chamber. (A) Images represent neuronal growth prior to addition of stimuli. (B-D) Single-cell suspensions of corneas from 14 dpi were added into the axon chamber and incubated for three days in the presence or absence of anti-VEGF antibody or bevacizumab. Each chamber was used to measure the ability of a single cornea to promote or inhibit the growth of sensory or sympathetic nerves. Images in section (B) represents sympathetic nerve growth three days after corneal cells addition. Images in section (C) represent sensory nerve growth three days after corneal cells addition. (D) Data represent the pooled imaging results from two independent experiments. Retraction was determined by the fragmentation of the neurites (arrows) in the axonal chamber. Non-retractions was determined by the elongation of the neurites (arrows) in the axonal chamber. Due to the clear growth or absence of growth of axons in the microfluidic chambers, a “yes” (axonal growth) or “no” (absence of axonal growth) was given for each chamber (cornea). Each experiment consisted of assessing four or five separate corneas resulting in an n value of four or five. To generate the pie charts, we pooled yes/no results and calculated the defined frequency in the pie charts. Significance was calculated using Fisher’s exact test of the yes/no results, and n values were biological replicates of wells that had or had not retracted.
Neutralizing VEGF in vivo during HSK inhibits sympathetic innervation, promotes reinnervation by sensory nerves, and reduces HSK severity.
Our findings demonstrated that the change involving retraction of corneal sensory nerves and hyperinnervation of sympathetic nerves was a major contributor to HSK severity. We further showed in vitro that this neurologic change was regulated by VEGF-A. Therefore, we proposed that neutralizing VEGF-A in corneas with HSK would inhibit the change in the neurologic architecture and reduce HSK severity. To explore these potential therapeutic effects, we treated HSV-1 infected corneas with three different VEGF-A inhibitors.
Bevacizumab is a widely used and clinically approved drug for treating pathogenic vascularization in many diseases, including ocular diseases like age-related macular degeneration and uveitis (Group et al., 2011; Julian et al., 2011). While the assumption would be that bevacizumab would largely act on corneal blood vessels, here we assessed the effects of bevacizumab on corneal nerves and sensitivity. Our treatment strategy began at 9 dpi, after blood vessels had already infiltrated the central cornea (Suryawanshi et al., 2012), and continued every other day until 28 dpi. Unlike beginning treatment at the onset of infection, our treatment began after blood vessels were established, and there was only a marginal effect of bevacizumab on vessel ingrowth after treatment in a fraction of treated mice (Figure 5A & Figure S4). It is worth noting that the blood vessels in treated eyes did appear to be less patent. Despite a lack of effect on vascularization, bevacizumab significantly alleviated corneal opacity and HSK scores in mice that were exposed to desiccation stress and in mice that received tarsorrhaphy (Figure 5B). Next, we showed that bevacizumab prevented most sympathetic innervation of the cornea after HSV-1 infection (Figure 5C–E). Finally, we demonstrated a reinnervation by corneal sensory nerves, which correlated with a recovery of cornea blink reflex (Figure 5 C&F). To ensure that these effects were not limited to this specific VEGF-A inhibitor, we repeated the same experiments using anti-mouse VEGF and soluble VEGF-A receptor 1 (sVR1). Both treatments alleviated HSK in the same manner that was observed with bevacizumab treatment (Figure S5 & Figure 6). Together, these results supported our in vitro results that implicated VEGF as a critical factor in the establishment of pathogenic sympathetic nerves and prevention of sensory nerve regeneration in HSK corneas.
Figure 5. Neutralizing VEGF in vivo during HSK inhibits sympathetic innervation, promotes reinnervation by sensory nerves, and reduces HSK severity.
Four groups of mice were infected with HSV-1 and were given subconjunctival injections of 500μg bevacizumab or isotype every other day starting from 9 dpi through 28dpi. Two groups of mice (bevacizumab and isotype) were protected by tarsorrhaphy. The severity of HSK was monitored and (A) corneal neovascularization and (B) corneal opacity at 28 dpi were recorded and analyzed. (C) At 28dpi, mice were sacrificed, and corneas were excised, flat mounted and labeled with antibodies to βIII Tubulin, Tyrosine Hydroxylase (TH), and substance P (SP). Arrows point to βIII +TH+ sympathetic nerves or βIII +SP+ sensory nerves. (D & E) Sympathetic nerves in the corneas protected by tarsorrhaphy were traced using the Simple Neurite Tracer (Longair et al., 2011) in the segmentation package in FIJI and was followed by analysis using the 3D Skeletonize (Arganda-Carreras et al., 2010) FIJI plugin. The z projection of the traced neurons from one cornea is shown. (F) The mice without tarsorrhaphy were assessed for corneal reflex at 28dpi. Results in all panels are represented as mean ± SEM pooled from 2 to 3 independent experiments. Significance was calculated using Student’s t test, *p < 0.05, **p < 0.01, ****p < 0.0001.
Figure 6. Soluble VEGF receptor 1 treatment prevents sympathetic nerve innervation and regenerates corneal sensitivity.
Mice were infected with HSV-1 (RE) and beginning at 9 dpi were given subconjunctival injections of soluble VEGF receptor 1 or isotype antibody every other day through 23dpi. (A-D) HSK severity was monitored as corneal opacity, neovascularization, and corneal reflex. Arrows point to the blood vessels in the corneas. (E) The corneas were excised, flat mounted and labeled with antibodies to βIII Tubulin, Tyrosine Hydroxylase (TH), and substance P (SP). Arrows point to βIII +TH+ sympathetic nerves or βIII +SP+ sensory nerves. Images in all panels represented the nerve staining from 2 independent experiments. Results in all panels are represented as mean ± SEM pooled from 2 independent experiments. Significance was calculated using Student’s t test,**p < 0.01.
These data unveiled a role for VEGF-A in the neuro-immune interactions that mediated blinding pathology in HSV-1 infected corneas. We demonstrated that VEGF-A both promoted hyperinnervation of the cornea by sympathetic nerves and prevented reinnervation by sensory nerves. These changes in the neurologic architecture of the cornea were necessary components of pathology in corneas infected with HSV-1 and likely other infectious and non-infectious corneal diseases that are associated with a loss of corneal sensation. By showing that interrupting VEGF-A signaling during disease alleviated corneal opacity and restored sensitivity, we have identified a potential strategy for treating this blinding ocular surface disease.
Discussion
Given the significant contributions of sensory nerve retraction and sympathetic nerve ingrowth to HSK severity, we sought to identify factor(s) that mediate these neurologic changes in infected corneas. Our initial observation that levels of VEGF-A (a known neurotrophic factor) correlated with HSK severity suggested VEGF-A might be of interest. Therefore, we investigated the cellular sources of VEGF-A. Since HSK is associated with a heavy leukocytic infiltration, it was of particular interest to define leukocytic sources of VEGF-A. We found that VEGF-A was produced by a variety of leukocytes in corneas with HSK, including F4/80−Ly6G+, F4/80+Ly6G+, and F4/80+Ly6G− myeloid cells as well as CD4+, TCRβ+, CD3+ T cells, with the latter two cell types being the most abundant VEGF-A producers. Notably, VEGF-A from these cells directly acted upon corneal nerves to retract sensory afferents while simultaneously encouraging the ingrowth of sympathetic nerves resulting in blinding ocular pathology.
Normal corneas are heavily innervated by sensory nerves with few if any sympathetic nerve fibers (Muller et al., 2003). In mice and humans, microbial infections are associated with loss of corneal sensory nerves (Bonini et al., 2003; Cruzat et al., 2010; Cruzat et al., 2011; Hamrah et al., 2010; Kurbanyan et al., 2012; Muller et al., 2015), and we have demonstrated that the resulting loss of corneal sensation and blink reflex contributes to HSK severity in mice. Humans, unlike mice, exhibit a phenomenon called consensual blink reflex in which both eyelids blink when one cornea is stimulated (Alexander G. Reeves; Kaplan and Kaplan, 1980; Yun et al., 2014). Therefore, in humans, even if the infected cornea is rendered numb by loss of sensory nerves, the eyelids of the infected eye can still blink when the contralateral cornea is stimulated, thus providing a level of protection from desiccation stress to the infected cornea. For this reason, we believe that reducing desiccation stress in HSV-1 infected mouse corneas by performing tarsorrhaphy created a better model of human HSK.
It is unclear if retraction of sensory nerve fibers during HSV-1 infection is advantageous to infected corneas. However, it is possible to posit that this mechanism might exist to reduce access of neurons harboring latent virus to the cornea, thus reducing viral shedding to the cornea following reactivation stimuli. In the C57BL/6 model used in this study, latent HSV-1 is harbored in TG but does not reliably reactivate despite being exposed to environmental stressors that have been linked to reactivation in humans (Huang et al., 2011). Thus, it is not possible to assess an effect of sensory nerve retraction on viral shedding at the cornea following a reactivation event. However, ongoing studies are aimed at refining our mouse model of viral reactivation from latency to address this important issue.
Previously, we and other have shown that HSK and desiccation stress begin to develop concurently around 7 dpi, which is after the clearance of live virus from the cornea (Jeon et al., 2018). Thus, by performing tarsorrhaphy to prevent corneal desiccation at 7 dpi we avoided any possible contribution of corneal live virus to HSK development. Protecting the infected cornea from desiccation stress reduced, but did not eliminate VEGF-A production, sympathetic innervation, and HSK, and these corneas did not exhibit re-innervation with sensory nerves. The sources of the residual VEGF-A in these corneas remained CD4+ T cells and F4/80+Ly6G− myeloid cells. Depleting CD4+ T cells systemically not only eliminated VEGF-A-producing CD4+ T cells from infected corneas protected by tarsorrhaphy, but also eliminated VEGF-A production by F4/80+Ly6G− myeloid cells, reducing overall VEGF-A production to levels observed in non-infected corneas. The reduced VEGF-A levels in infected corneas of CD4+ T cell depleted mice were associated with prevention of sympathetic hyperinnervation, recovery of lost sensory nerves, and virtual elimination of HSK.
It remains unclear exactly how CD4+ T cells are stimulated to produce VEGF-A within the context of infection. Recently, the activation of complement was linked to CD4+ T cell-dependent loss of corneal sensitivity in models of HSV-1 keratitis and allergic eye disease (Royer et al., 2019) suggesting a potential intrinsic (Arbore et al., 2016; Cardone et al., 2010) or extrinsic role of complement in CD4+ T cell-dependent VEGF-A production. Additional evidence that complement might regulate VEGF-A production by CD4+ T cells comes from the observation that complement factor H (CFH) can interfere with CD47 binding with thrombospondin-1 (TSP-1), and that CD47 deficiency in T cells results in elevated production of VEGF (Calippe et al., 2017).
VEGF-A is a known neurotrophic factor (Jin et al., 2006; Nishijima et al., 2007; Sondell et al., 2000), but we wished to provide a more direct demonstration of a potential role in selectively regulating extension and contraction of sympathetic and sensory nerves respectively in the infected cornea. Corneal sensory nerves derive from cell bodies in the TG, whereas sympathetic nerve fibers found in the peripheral area of normal corneas derive from neuronal cell bodies in the SCG. We cultured sensory neurons derived from dissociated TG or sympathetic neurons derived from dissociated SCG in microfluidic chambers comprised of two cell chambers separated by micro channels until neurites started to extend through the channels into the opposite chamber. Dissociated cells from infected corneas obtained at 14 dpi—more than a week after infectious virus is cleared from the cornea—were then added to the neurite chambers with or without VEGF-specific antibodies. Results showed that corneal cells caused retraction of sensory neurites and promoted the extension of sympathetic neurites into the corneal cell chamber. However, when VEGF was neutralized in corneal cultures by specific antibodies, the opposite effect was observed: sensory neurites extended into corneal chambers, while sympathetic neurites retracted. These findings suggested that VEGF created an environment within HSV-1 infected corneas that favors sympathetic hyperinnervation while discouraging reinnervation by sensory nerves.
Previous studies established that VEGF-A inhibition reduces HSK severity in association with reducing neovascularization of the infected cornea. Neovascularization of the normally avascular cornea places the cornea in direct contact with inflammatory mediators carried in the blood stream, and inhibiting that exposure would be expected to reduce inflammation within the infected cornea. It is possible that VEGF inhibitors could disrupt the patterns of HSV-1 entry into and exit from viral latency; however, the stability of viral latency in C57BL/6 mice and timing the administration of treatments after cessation of active viral replication would suggest that these inhibitors do not affect viral latency. Thus, VEGF-A has a continuing role in HSK beyond vascularization by promoting hyperinnervation by sympathetic nerves that contributes to HSK severity, and repressing sensory innervation that is required for normal corneal homeostasis (Labetoulle et al., 2019; Okada et al., 2019). While it is known from previous studies that VEGF-A can stimulate cellular processes in both sympathetic and sensory nerves, here, we illustrated that during the peak inflammatory response of HSK, sympathetic nerves are preferentially stimulated and sensory nerves are repelled or their growth inhibited. Whether the differential effect on sympathetic and sensory neurons reflects such variables as VEGF-A concentration or a supplemental contribution of other neurotrophic factors present in infected corneas remains to be clarified.
The cornea is uniquely innervated in that sensory nerves are the most prominent nerves found within the healthy tissue, while sympathetic and parasympathetic nerves are largely or completely absent. Here, our data revealed that VEGF-A was largely responsible for maintaining the disruption of the normal nerve architecture after viral infection where corneal sensory nerves were replaced by sympathetic nerves. We observed this not only through a quantifiable reduction in blink reflex but also a significant shift in the expression of SP in nerves to TH in nerves going from the healthy to diseased state, respectively. This shift in protein expression was not a simple change in phenotype of existing nerves, but a replacement of sensory nerves with sympathetic nerves. Data to support this comes from the observation that excising the superior cervical ganglion (SCG)—considered a sympathetic ganglion—does not affect corneal nerve architecture during steady state but does eliminate sympathetic innervation during the diseased state (Yun et al., 2016). The mechanisms governing why parasympathetic nerves are absent in the cornea during health and disease remain unknown. Together, these results may aid interpretation of disease in other tissues like the skin where sensory nerves and sympathetic nerves are intermingled.
A recent study investigated the therapeutic benefit of adding the isoform of VEGF, VEGF188, topically to the ocular surface to enhance corneal nerve regeneration and improve wound healing (Brash et al., 2019). While that study failed to distinguish sympathetic from sensory nerves, the results suggest that further resolution of the effects of different isoforms of VEGF might be warranted. Our study revealed a profound neuro-immune contribution to HSK and suggested that VEGF inhibitors, which are currently clinically approved to prevent pathogenic vascularization might be useful in preventing changes in the neural architecture that contribute to HSK severity and, potentially, other neuronal disorders. In VEGF-A, we have identified a potentially promising target where a neutralizing antibody, bevacizumab, is FDA-approved and has been used in humans for other diseases.
Limitations of Study
Despite the numerous similarities between mice and humans, our study uses a C57BL/6 mouse model of HSV-1 infection, which imperfectly models human disease. In this model, disease is severe and occurs relatively soon after primary infection; however, human disease is progressive and takes years to develop. This is likely due to the dramatic role desiccation stress plays in murine disease, which may not be recapitulated in humans due to consensual blink reflex mentioned above. Further, studies from our lab and others have demonstrated the lack of consistency in measuarable reactivation of HSV-1 in mouse models of disease. In collaboration with the Patrick Stuart Laboratory (St. Louis University), we are currently investigating the effects of measurable viral reactivation on the corneal nerve landscape using a more efficient mouse model of HSV-1 reactivation. An unexpected observation in our study was the maintenance of VEGF protein expression during tarsorrhaphy despite the dramatic loss of VEGF from the myeloid population. This would suggest that the stimulant that triggers CD4+ T cells to produce VEGF is not associated with desiccation stress. Because the specificities of pathogenic CD4+ T cells that infiltrate the cornea remain unknown, it has been difficult identify the mechanisms governing the induction of VEGF production within the cornea. In our study, we highlight the close proximity of CD4+ T cells, myeloid cells, and sympathetic nerves and suggest that these three cell types actively interact to promote VEGF production and pathology. Future studies are aimed at identifying how CD4+ T cells are stimulated and how VEGF production may be regulated within these cells and the myeloid cells that infiltrate the cornea during infection. Finally, it is likely that VEGF-A is not the only neurotrophic factor that regulates the neuronal landscape within the cornea, and ongoing studies are aimed at identifying other factors that may play a role.
STAR METHODS
RESOURCE AVAILABILITY
Lead Contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Anthony St. Leger (Anthony.stleger@pitt.edu).
Materials Availability
This study did not generate new unique reagents.
Data and Cod Availability
This study did not generate/analyze any datasets or code.
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Animal Studies
Wild-type female C57BL/6 mice purchased from Jackson Laboratories (Bar Harbor, ME, USA) were housed in the Animal Resource Facility at the University of Pittsburgh Medical Center (Pittsburgh, PA, USA) and used at 6–8 weeks of age in all experiments. Experimental procedures were reviewed and approved by the University of Pittsburgh Institutional Animal Care and Use Committee and the use of animals was in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.
Primary neurons
Sensory neurons of Trigeminal ganglia (TG) and sympathetic neurons of superior cervical ganglions (SCG) were isolated frm wild-type C57BL/6 mice.
HSV-1 strain RE
The RE strain of HSV-1 was grown to high titer in Vero cells after a low multiplicity of infection (0.001) and intact virions obtained from the infected cell surface were purified on OptiPrep density gradients (Accurate Chemical and Scientific Corp., Westbury, NY, USA) and stored at −80 °C, as previously described (Treat et al., 2020). Concentration of HSV-1 was determined in a standard virus plaque assay.
METHOD DETAILS
Mouse infections
Mice were anesthetized by intraperitoneal injection of ketamine hydrochloride (100 mg/kg body weight) and xylazine(0.1 mg/ kg body weight) in Hanks’ balanced salt solution. Topical corneal infection was performed by scarification of the central cornea with a sterile 30-gauge needle in a crisscross pattern and applying 3 μl RPMI containing 1×105 pfu of HSV-1.
Scoring HSK severity
HSK severity was monitored using a Zeiss microscope (Stemin 305) and scored as described previously (Yun et al., 2014). Briefly, the corneal opacity was scored on a four-point scale protocol as follows: 0.5, any corneal imperfection; 1, mild corneal haze; 2, moderate opacity; 2.5, moderate opacity with regional dense opacity; 3, diffuse dense opacity obscuring the iris; 3.5, diffuse dense opacity with corneal ulcer; or 4, corneal perforation. The corneal neovascularization was scored by dividing each cornea into 4 quadrants and each quadrant was scored as 0 (no vessels visible), 2 (vessels extending into the paracentral cornea), or 4 (vessels extending to the central cornea). The total score of the 4 quadrants was then divided by 16 (360°vascularization to the central cornea) and multiplying by 100 which represents the percentage of each cornea that was vascularized.
Corneal blink reflex was tested by loosely holding the mouse and touching the cornea with the blunt tips of a surgical forceps without touching the eyelashes and whiskers. The cornea was divided into 5 areas (4 quadrants and center area), loss of blink reflex referred to the inability of the mouse to blink when an area was touched and was recorded as 0. Positive blink reflex referred to the ability to blink when an area of the cornea was touched and was recorded as 1. The total score of the 5 areas would be the final score of corneal blink reflex for a mouse. A score of 0 indicated a complete loss of corneal sensation such that the mouse failed to blink when any area of the cornea was touched. A score of 5 indicated retention of some degree of sensation such that the mouse blinked when any area of the cornea was touched.
Tarsorrhaphy
Tarsorrhaphy is one of the safest and most effective surgical procedures to protect a neuropathic cornea from exposure (www.aao.org, American Academy of Ophthalmology) in which the closure of the eyelids is formed via an adhesion between the upper and lower lid margins.
Tarsorrhaphy was performed on mice 4 days post HSV-1 infection under a surgical microscope. First, the upper and low eyelids of a mouse were mildly cut with scissors so that the margins were rough, and then the two margins were stitched together with 9–0 Black Nylon monofilaments through the interstitial part of the eyelids. The sutures were removed 7 days after the surgery. Tarsorrhaphy was removed at the end points of the experiments to permit examination of the corneas.
CD4 depletion
Mice were depleted of CD4+ T cells with an intraperitoneal injection of 0.15 mg rat anti-mouse CD4 Ab clone GK1.5 (InVivoMAb anti-mouse CD4, BioXcell, West Lebanon, NH) or mock depleted with an intraperitoneal injection of 0.15mg anti-keyhole limpet hemocyanin (LTF, InVivoMAb rat IgG2b isotype control). Injections were given 2 days before infection, one day after infection and then every 6 days through 28 days post infection (dpi). The efficacy of CD4 depletion was confirmed by a lack of CD4+T cells in corneas of depleted mice as assessed by both confocal microscopy and flow cytometry (not shown).
Anti VEGF treatments to the mice
Mice received anti VEGF treatment or mock treatment at 9 dpi. To block VEGF pathway by anti VEGF antibodies, mice were given 500μg bevacizumab (Avastin) or 10μg rat anti mouse VEGF antibody by subconjunctival injection every two days through 28 days. To sequester VEGF by soluble VEGF receptor 1 (sVEGFR1, sVR1), mice were given 5μg (Suryawanshi et al., 2011a) of soluble VEGF receptor 1 by subconjunctival injections every two days through 28 days. The same amount of Recombinant Mouse IgG2A Fc Protein was given as mock treatment.
Primary culture of neurons in microfluidic chambers
Microfluidic chambers were manufactured with two compartments connected by micro channels. The silicon-based master was fabricated in cleanroom conditions. In brief, silicon wafers (University Wafer; Boston, MA) were spin-coated with SU-8 2002 Photoresist (Microchem; Westborough, MA) in a 2-step process and soft baked. An array of microchannels (10 μm width; 450 μm length; 2–2.5 μm height) was defined by UV light exposure and development of SU-8. Standard soft lithography was performed using Sylgard 184 polydimethylsiloxane (PDMS) (Dow Corning). Because of the restrictive height (2.5 μm) in the channels, cells are unable to migrate through the channels, but diffusion of small molecules is not impeded. PDMS microfluidics devices were permanently bonded to glass substrates using a PE-25 plasma cleaner (Plasma Etch). PDMS and glass substrate were exposed to plasma for 2 minutes at a flow rate of 5 cc/min under 200 mTorr vacuum pressure and then the plasma-exposed surfaces immediately brought together. The chambers of the devices were coated with poly-D lysine (PDL) and laminin before the addition of cells. One chamber of the device was designated as the “Soma” side and the other “Axon”.
Sensory neurons of Trigeminal ganglia (TG) and sympathetic neurons of superior cervical ganglions (SCG) were cultured according to a protocol obtained from Dr. Todd Margolis, University of Washington at St Louis MO (Bertke et al., 2011). Briefly, TGs and SCGs were removed after 6–8 week old female C57BL/6 mice were euthanized and incubated at 37°C for 20 minutes in papain (5mg/ml in Neurobasal A medium), followed by an additional incubation at 37°C for 20 minutes in Hanks balanced salt solution containing dispase (4.67 mg/ml) and collagenase (4 mg/ml), and then were mechanically dissociated by triturating with a 1000-μl pipette. Cell suspension of TG was layered on a 5-step OptiPrep (Sigma-Aldrich) gradient and centrifuged for 20 minutes at 800xg. The lower end of the centrifuged gradient was then transferred to a new tube and washed twice with Neurobasal A medium supplemented with 2% B27 supplement and 1% penicillin streptomycin. The neurons were cultured in complete neuronal medium, consisting of Neurobasal A medium supplemented with 2% B27 supplement, 1% penicillin streptomycin, L-glutamine (500μM), nerve growth factor (NGF, 50ng/ml), glial-cell-derived neurotrophic factor(GDNF, 50ng/ml). Fluorodeoxyuridine (40μM) was added for the first day. The neurons were then maintained in complete neuronal medium without mitotic inhibitor.
Sympathetic neurons were cultured using the same methods without the step of gradient centrifugation.
Suspended HSK corneal cells (14 dpi) were isolated using the same methods without the step of gradient centrifugation.
Each Soma chamber were seeded with sensory neurons isolated from one TG or sympathetic neurons isolated from two SCGs. The same neuronal culture medium was added to the axon chamber to a higher level that creates a hydrostatic pressure. When axonal projections were observed to extend through the micro channels and into the Axon chamber (usually in 7 days), the suspended HSK corneal cells in complete neuronal medium with or without anti VEGF antibodies (rat anti mouse VEGF antibody, 10μg/ml; bevacizumab, 1.25mg/ml) were added into the axon chamber side.
The growth of neurites in the axon chamber was observed and imaged using a Zeiss Axi0 microscope. The images were analyzed using ZEN 2 (blue edition) software (ZEISS, USA).
ELISA
For each experiment, suspended corneal cells were obtained as described in the method of “Microfluidics Devices and neuron culture”, and then were cultured in complete neuronal culture medium for one day. The supernatants and the cells were harvested and analyzed by sandwich ELISA for VEGF (Mouse VEGF DuoSet ELISA, R&D SYSTEMS, DY493) using DuoSet Ancillary Reagent Kit 2 (R&D SYSTEMS, DY008), and the samples were processed according to the Research and Development protocol. Absorbance was read at 450 nm using a SpectraMax M3 plate reader and analyzed using SoftMax Pro 7.0 software (Molecular Devices).
Flow Cytometry
HSK was scored at the end point of each experiment (28 dpi or 21 dpi) and the mice were euthanized, and eyes were collected for flow cytometry. Individual corneas were excised, rinsed and quartered for preparation of single cell suspensions, made by treating the corneas with collagenase type I (84 U/cornea; Sigma-Aldrich, St. Louis, MO) for 60 min at 37°C, and triturated until no apparent tissue fragments remained. The single-cell suspension of each cornea was then filtered through a 40μm cell strainer cap (BD Labware, Bedford, MA) and washed with FACS buffer. Corneal cells were treated with anti-mouse CD16/CD32 (Fc III/II receptor; 2.4G2; BD Pharmingen, San Diego, CA) to prevent nonspecific antibody binding and then stained for various leukocyte surface markers and Ghost UV 450 Viability Dye for 30 min at 4°C. The cells were then washed with FACS buffer and incubated in BD Cytofix/Cytoperm (Fixation and permeabilization solution) for 20 min at 4°C followed by wash with BD Perm/Wash buffer twice. The cells were then stained with goat anti mouse VEGF antibody and followed by a Alexa Fluor 633 conjugated-donkey anti-goat IgG(H+L) antibody staining. After two washes with BD Perm/Wash buffer, the cells weretransferred into FACS buffer for the assessment with a CytoFLEX LX Cytometer (Beckman Coulter) and were analyzed using FlowJo software (TreeStarInc., Ashland, OR). Gates were set based on staining with the appropriate single antibody and a cocktail lacking that particular antibody. Data are listed as total numbers of cells per cornea.
CD4+TCRβ+ cells and CD11b+ myeloid cells Sorting
Mice were infected with 1 × 105 PFU of HSV-1 (strain RE) and either received tarsorrhaphy at 4 dpi or were left untreated. At 14 dpi,10 mouse eyes from each group were collected, and corneas were excised, digested with collagenase, and dispersed into single-cell suspensions, and then cells from 5 eyes were pooled into one tube for antibodies staining. Corneal cells were treated with anti-mouse CD16/CD32 (1:500, Fc III/II receptor; 2.4G2; BD Pharmingen, San Diego, CA) to prevent nonspecific antibody binding. The final dilution of various leukocyte surface markers was 1:500, and the Aqua viability dye was added at 1:1000 final concentration. FACS was used to isolate CD4+TCRβ+ cells and CD11b+ myeloid cells for the assessment of their levels of VEGF mRNA by performing RT-PCR. Two independent experiments were performed and 500 CD4+TCRβ+ cells and CD11b+ myeloid cells were collected from each sample.
RT-PCR
TaqMam Gene Expression Cells-to-Ct Kit was used to isolate mRNA from the cells according to the manufacturer’s protocol. Briefly, the isolated CD4+ cells and CD11b+ myeloid cells were washed with 1XPBS, mixed with Lysis Solution, and incubated at room temperature for 5 min, and then Stop Solution was mixed into the lysate to inactivate the lysis reagents. After that, cell lysates were reverse transcribed to synthesize cDNA.
As the quantities of cDNA from each sample were small, TaqMan PreAmp Kit was used for the preamplification of cDNA samples. Equal volume of 20X mouse vegfa and beta-actin TaqMan Gene Expression Assay were combined and diluted using 1X TE Buffer to make each assay for a final concentration of 0.2X. The amplification reaction was performed in 50ul volume according to the protocol for 14 preamplification cycles.
The preamplification products were 1:20 diluted using 1XTE Buffer and prepareed real-time PCR reaction in a 20ul volume system. Three replicates of each PCR reaction were performed. The data was analyzed using StepOne Software v2.3 and absolute CT of vegfa was used to indicate the existence of gene expression. The expression of beta-actin was used as the quality control for each sample.
Immunohistochemistry
Corneas were dissected and fixed at room temperature for 1 hour in 1.3% paraformaldehyde in PBS, and radial incisions were made to facilitate flat-mounting of the corneal tissues. Corneas were washed in PBS five times, permeabilized in 1% Triton-X100 in PBS at room temperature for 60 minutes and blocked with either 20% goat serum or donkey serum (Cedarlane, Burlington, NC, USA) in blocking buffer (0.3% Triton-X-100/0.1% Tween-20 in PBS) for 1 hour. The corneas were then incubated in a 100μl cocktail of primary antibodies at room temperature for 2 hours, followed by an additional incubation overnight at 4 °C. After five 5-minute washes in wash buffer (0.1% Tween-20 in PBS), the corneas were incubated in a 100μl cocktail of secondary antibodies in blocking buffer at room temperature for 2 hours. Following five 10-minute washes with wash buffer, the corneas were mounted on slides and dried at 4°C for at least 12 hours before imaging.
Confocal Microscopy
Stitched Z-stacks spanning entire corneal whole mounts were acquired with an OLYMPUS BX61 motorized upright Fluoview 1200 laser scanning confocal microscope equipped with a x20 or a 60x oil (numerical aperture, 0.85) objective lens and an automated stage. The Z-stack images were saved in the native Olympus Image Binary (OIB) format and stitched together using FV10-ASW 2.0 software (Olympus Life Science, Tokyo, Japan). Brightness levels in the figures were adjusted for display.
The evaluation of sympathetic nerves in each cornea was processed using Simple Neurite Tracer (Longair et al., 2011) in the segmentation package in FIJI programs and then analyzed by the 3D Skeletonize (Arganda-Carreras et al., 2010) FIJI plugin. The total length of sympathetic nerves in each cornea was calculated from the data provided.
QUANTIFICATION AND STATISTICAL ANALYSIS
All values are presented as mean ± SEM. The normality of each set of data were checked by D’Agostino & Pearson normality test with GraphPad Prism 7.03. Outliers were detected by Outlier calculator in GraphPad (https://www.graphpad.com/quickcalcs/grubbs1/). If the data were normally distributed, the significance of differences between groups were determined by unpaired parametric t-test; If the data were not normally distributed, the significance of differences between groups were determined by unpaired nonparametric t-test (Mann-Whitney test). Fisher’s exact test was used to analyze in vitro neuron culture data. Differences were considered to be statistically significant at P < 0.05.
Supplementary Material
KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Brilliant Violet 785 anti-muse CD4 | BioLegend | Cat#100551; Lot# B259957; RRID AB_11218992 |
| Alexa Fluor 700 anti-mouse CD11b | BioLegend | Cat#101222; Lot#B259438; RRID AB_493705 |
| PerCP Rat Anti-Mouse CD45 | BD Pharmingen | Cat#557235; Lot# 8179968; RRID AB_396609 |
| Brilliant Violet 650 anti-mouse Ly-6G | BioLegend | Cat#127641; Lot#B268950; RRID AB_2565881 |
| PE/Cy7 anti-mouse F4/80 | BioLegend | Cat#123114; Lot#b265636; RRID AB_893478 |
| Anti-mouse-VEGF | R&D Systems | Cat#AF-493-NA; Lot#YU1417041; RRID AB_354506 |
| Donkey anti-goat IgG (H+L) Alexa Fluor 633 | Molecular Probes | Cat#99E1-1 |
| Ghost UV 450 Viability Dye | TONBO Biosciences | Cat#13-0868-T100; Lot#D0868083018133 |
| PE Rat Anti-Mouse CD4 | BD Pharmingen | Cat#553049; Lot#7194731; RRID AB_394585 |
| APC Rat-Mouse CD31 | BD Pharmingen | Cat#561814; Lot#6168667; RRID AB_10893351 |
| eFluor 450 Anti-Mouse CD45 | eBioscience | Cat#48-0451-82; Lot#4295770; RRID AB_1518806 |
| APC Rat-Mouse F4/80 | eBioscience | Cat#17-4801-82; Lot#E07285-1631; RRID AB_2784648 |
| Goat anti-chicken IgG(H+L) Alexa Fluor 546 | Life Technologies | Cat#A11040, Lot#1618409; RRID AB_1500590 |
| Goat anti-rat IgG(H+L) Alexa Fluor 633 | Invitrogen | Cat#1889312; Lot#1889312 |
| Goat anti-rabbit IgG(H+L) Alexa Fluor 488 | Abcam | Cat#Ab15007; Lot#GR23372; RRID AB_301568 |
| Rat Anti-Substance P | BD Pharmingen | Cat#556312; Lot#7032604; RRID AB_396357 |
| Anti-Beta III Tubulin | Abcam | Cat#Ab18207; Lot#GR220660-1; RRID AB_444319 |
| Anti-Tyrosine Hydroxylase | Abam | Cat#Ab76442; Lot#GR214411-3; RRID AB_1524535 |
| InVivoMAb anti-mouse CD4 | BioXCell | Cat#BE0003-1; Lot#699918O1; RRID AB_1107636 |
| InVivoMAb rat IgG2b isotype Control | BioXCell | Cat#BE0090; Lot#695618J2; RRID AB_1107780 |
| Bevacizumab | Genentech | Cat#NDC50242-060-01 |
| Recombinant Mouse VEGFR1/Flt-1 FC Chimera Protein | R&D Systems | Cat# 471-F1-100; Lot#DCPJ041 |
| Recombinant Mouse IgG2A | R&D Systems | Cat#4460-MG, Lot#PBV0416101; RRID AB_884569 |
| FITC Rat Anti-Mouse Ly6C | BD Pharmingen | Cat#553104; RRID AB_394628 |
| PE Rat Anti-Mouse CD3 | BD Pharmingen | Cat#555275; RRID AB_395699 |
| Aqua Viability Kit | Thermo Fisher Scientific | Cat#L34966; Lot#2069643 |
| APC-Cy7 Rat Anti-Mouse CD4 | BD Pharmingen | Cat#100526; Lot#B282355; RRID AB_312727 |
| BV421 Hamster anti-mouse TCR β Chain | BD Pharmingen | Cat#562839; Lot# 8311947; RRID AB_2737830 |
| Bacterial and Virus Strains | ||
| Herpes Simplex Virus Type 1 (Strain RE) | In-house Virus Stock | PMID: 1401927 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| 4’,6-Diamidino-2-phenyindole,dilactate | Sigma-Aldrich | Cat#08168-100EA |
| Recombinant Human β-NGF | Shenandoah Biotechnology | Cat#100-38; Lot#116-100-38 |
| Recombinant Rat GDNF | R&D Systems | Cat#512-GF-010; Lot#UH3116051 |
| Laminin | Sigma-Aldrich | Cat#11495-81-9; Lot#127M4092V |
| Poly-D-lysine hydrobromide | Sigma-Aldrich | Cat#27964-99-4; Lot#SLBX7897 |
| Papain | Worthington Biochemical Corporation | Cat#38D18191; Lot#38D18191 |
| Neurobasal-A Medium | Thermo Fisher Scientific | Cat#10888022 |
| Optiprep Density Gradient Medium | Sigma-Aldrich | Cat#D1556 SIGMA; Lot#MKCG1091 |
| Collagenase Type I | Stemcell Technologies | Cat#7416 |
| Gibco Dispase II | Fisher Scientific | Cat#17-105-041; Lot#1970805 |
| GlutaMAX | Life Technologies | Cat#35050-061; Lot#2085465 |
| B-27 Supplement | Life Technologies | Cat#17504-044; Lot#2077007 |
| Penicillin Streptomycin | Life Technologies | Cat#15140-122; Lot#1924797 |
| Ketamine Hydrochloride Injection | Henry Schein | Cat#NDC11695-0702-1; Lot#AH02P6J |
| Xylazine Injection | Henry Scein | Cat#NDC11695-4022-1; Lot#8L022 |
| Antisedan | Orion Pharma | Cat#107204-6; Lot#1776061 |
| Hanks Balanced Salt Solution (HBSS) | Life Technologies | Cat#24020; Lot#2048597 |
| RPMI | BioWhittaker | Cat#12-167Q; Lot#696504 |
| Critical Commercial Assays | ||
| BD Cytofix/Cytoperm | BD Pharmingen | Cat#554722; Lot#9064590 |
| BD Perm/Wash | BD Pharmingen | Cat#554723; Lot#8263982 |
| Mouse VEGF DuoSet ELISA | R&D Systems | Cat#DY493; Lot#P210213 |
| DuoSet Ancillary Reagent Kit 2 | R&D Systems | Cat#DY008 |
| TaqMan® Gene Expression Cells-to-CT™ Kit | Ambion by Life Technology | Cat#4399002; Lot#00905842 |
| TaqMan® PreAmp Master Mix | Applied Biosystems | Cat#4384266; Lot#00885329 |
| TaqMan Gene Assay-Vegfa | Thermo Fisher | Cat#4331182 Mm00437306_m1 |
| TaqMan Gene Assay-Actb | Thermo Fisher | Cat#4387430 |
| Experimental Models: Organisms/Strains | ||
| C57BL/6 mouse | The Jackson Laboratory | JAX: 000664; RRID IMSR_JAX:000664 |
| Software and Algorithms | ||
| FV10-ASW 4.1 | Olympus Life Sciences | https://www.olympus-lifescience.com/en/support/downloads/ RRID SCR_014215 |
| SoftMax Pro 7.0 | Molecular Devices | https://www.moleculardevices.com/ RRID SCR_014240 |
| Flowjo V.10 | BD | https://www.flowjo.com/ RRID SCR_008520 |
| Other | ||
| Axio Microscope | Zeiss | www.zeiss.com/us/microscopy |
| Stemin 305 Microscope | Zeiss | www.zeiss.com/us/microscopy |
| BX61 motorized upright microscope | Olympus | https://www.olympus-ims.com/en/microscope/bx61-2/ |
| 9-0 Black Nylon Monofilament | AROSurgical Instruments Corporation | Cat#TK-091038; Lot#PG467301 |
TABLE WITH EXAMPLES FOR AUTHOR REFERENCE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit monoclonal anti-Snail | Cell Signaling Technology | Cat#3879S; RRID: AB_2255011 |
| Mouse monoclonal anti-Tubulin (clone DM1A) | Sigma-Aldrich | Cat#T9026; RRID: AB_477593 |
| Rabbit polyclonal anti-BMAL1 | This paper | N/A |
| Bacterial and Virus Strains | ||
| pAAV-hSyn-DIO-hM3D(Gq)-mCherry | Krashes et al., 2011 | Addgene AAV5; 44361-AAV5 |
| AAV5-EF1a-DIO-hChR2(H134R)-EYFP | Hope Center Viral Vectors Core | N/A |
| Cowpox virus Brighton Red | BEI Resources | NR-88 |
| Zika-SMGC-1, GENBANK: KX266255 | Isolated from patient (Wang et al., 2016) | N/A |
| Staphylococcus aureus | ATCC | ATCC 29213 |
| Streptococcus pyogenes: M1 serotype strain: strain SF370; M1 GAS | ATCC | ATCC 700294 |
| Biological Samples | ||
| Healthy adult BA9 brain tissue | University of Maryland Brain & Tissue Bank; http://medschool.umaryland.edu/btbank/ | Cat#UMB1455 |
| Human hippocampal brain blocks | New York Brain Bank | http://nybb.hs.columbia.edu/ |
| Patient-derived xenografts (PDX) | Children’s Oncology Group Cell Culture and Xenograft Repository | http://cogcell.org/ |
| Chemicals, Peptides, and Recombinant Proteins | ||
| MK-2206 AKT inhibitor | Selleck Chemicals | S1078; CAS: 1032350-13-2 |
| SB-505124 | Sigma-Aldrich | S4696; CAS: 694433-59-5 (free base) |
| Picrotoxin | Sigma-Aldrich | P1675; CAS: 124-87-8 |
| Human TGF-β | R&D | 240-B; GenPept: P01137 |
| Activated S6K1 | Millipore | Cat#14-486 |
| GST-BMAL1 | Novus | Cat#H00000406-P01 |
| Critical Commercial Assays | ||
| EasyTag EXPRESS 35S Protein Labeling Kit | Perkin-Elmer | NEG772014MC |
| CaspaseGlo 3/7 | Promega | G8090 |
| TruSeq ChIP Sample Prep Kit | Illumina | IP-202-1012 |
| Deposited Data | ||
| Raw and analyzed data | This paper | GEO: GSE63473 |
| B-RAF RBD (apo) structure | This paper | PDB: 5J17 |
| Human reference genome NCBI build 37, GRCh37 | Genome Reference Consortium | http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/ |
| Nanog STILT inference | This paper; Mendeley Data | http://dx.doi.org/10.17632/wx6s4mj7s8.2 |
| Affinity-based mass spectrometry performed with 57 genes | This paper; and Mendeley Data | Table S8; http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Experimental Models: Cell Lines | ||
| Hamster: CHO cells | ATCC | CRL-11268 |
| D. melanogaster: Cell line S2: S2-DRSC | Laboratory of Norbert Perrimon | FlyBase: FBtc0000181 |
| Human: Passage 40 H9 ES cells | MSKCC stem cell core facility | N/A |
| Human: HUES 8 hESC line (NIH approval number NIHhESC-09-0021) | HSCI iPS Core | hES Cell Line: HUES-8 |
| Experimental Models: Organisms/Strains | ||
| C. elegans: Strain BC4011: srl-1(s2500) II; dpy-18(e364) III; unc-46(e177)rol-3(s1040) V. | Caenorhabditis Genetics Center | WB Strain: BC4011; WormBase: WBVar00241916 |
| D. melanogaster: RNAi of Sxl: y[1] sc[*] v[1]; P{TRiP.HMS00609}attP2 | Bloomington Drosophila Stock Center | BDSC:34393; FlyBase: FBtp0064874 |
| S. cerevisiae: Strain background: W303 | ATCC | ATTC: 208353 |
| Mouse: R6/2: B6CBA-Tg(HDexon1)62Gpb/3J | The Jackson Laboratory | JAX: 006494 |
| Mouse: OXTRfl/fl: B6.129(SJL)-Oxtrtm1.1Wsy/J | The Jackson Laboratory | RRID: IMSR_JAX:008471 |
| Zebrafish: Tg(Shha:GFP)t10: t10Tg | Neumann and Nuesslein-Volhard, 2000 | ZFIN: ZDB-GENO-060207-1 |
| Arabidopsis: 35S::PIF4-YFP, BZR1-CFP | Wang et al., 2012 | N/A |
| Arabidopsis: JYB1021.2: pS24(AT5G58010)::cS24:GFP(-G):NOS #1 | NASC | NASC ID: N70450 |
| Oligonucleotides | ||
| siRNA targeting sequence: PIP5K I alpha #1: ACACAGUACUCAGUUGAUA | This paper | N/A |
| Primers for XX, see Table SX | This paper | N/A |
| Primer: GFP/YFP/CFP Forward: GCACGACTTCTTCAAGTCCGCCATGCC | This paper | N/A |
| Morpholino: MO-pax2a GGTCTGCTTTGCAGTGAATATCCAT | Gene Tools | ZFIN: ZDB-MRPHLNO-061106-5 |
| ACTB (hs01060665_g1) | Life Technologies | Cat#4331182 |
| RNA sequence: hnRNPA1_ligand: UAGGGACUUAGGGUUCUCUCUAGGGACUUAGGGUUCUCUCUAGGGA | This paper | N/A |
| Recombinant DNA | ||
| pLVX-Tight-Puro (TetOn) | Clonetech | Cat#632162 |
| Plasmid: GFP-Nito | This paper | N/A |
| cDNA GH111110 | Drosophila Genomics Resource Center | DGRC:5666; FlyBase:FBcl0130415 |
| AAV2/1-hsyn-GCaMP6- WPRE | Chen et al., 2013 | N/A |
| Mouse raptor: pLKO mouse shRNA 1 raptor | Thoreen et al., 2009 | Addgene Plasmid #21339 |
| Software and Algorithms | ||
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Bowtie2 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Samtools | Li et al., 2009 | http://samtools.sourceforge.net/ |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al., 2013 | https://github.com/ChristophRau/wMICA |
| ICS algorithm | This paper; Mendeley Data | http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Other | ||
| Sequence data, analyses, and resources related to the ultra-deep sequencing of the AML31 tumor, relapse, and matched normal. | This paper | http://aml31.genome.wustl.edu |
| Resource website for the AML31 publication | This paper | https://github.com/chrisamiller/aml31SuppSite |
Acknowledgements
The authors would like to thank Nancy Zurowski for assistance with operating the flow cytometer during experiments. We thank Dr. Esta Albelev and the Pittsburgh Nanofabrication Facility for assistance in generating the silicon templates for generating microfluidic channeled platforms. The graphical abstract was created with Biorender.com. The work was supported by NIH grants R01 EY026891 (RLH/AJS), R00 EY025761 (AJS), R01 EY 015291 and AI122640 (PRK) and core grant P30 EY0898. In addition, work acknowledges support from the Eye & Ear Foundation of Pittsburgh and unrestricted grants from Research to Prevent Blindness Inc, New York, NY.
Footnotes
DECLARATIONS OF INTERESTS
The authors declare no competing interests.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
REFERENCES
- Acosta MC, Tan ME, Belmonte C, and Gallar J (2001). Sensations evoked by selective mechanical, chemical, and thermal stimulation of the conjunctiva and cornea. Invest Ophthalmol Vis Sci 42, 2063–2067. [PubMed] [Google Scholar]
- Reeves Alexander G., R.S.S., Cohen Jeffrey, Fadul Camilo, Jenkyn Lawrence, Ward Thomas Facial sensations & movements In Disorders of the nervous system, Swenson RS, ed. (Dartmouth Medical School; ). [Google Scholar]
- Ambati BK, Nozaki M, Singh N, Takeda A, Jani PD, Suthar T, Albuquerque RJ, Richter E, Sakurai E, Newcomb MT, et al. (2006). Corneal avascularity is due to soluble VEGF receptor-1. Nature 443, 993–997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arbore G, West EE, Spolski R, Robertson AAB, Klos A, Rheinheimer C, Dutow P, Woodruff TM, Yu ZX, O’Neill LA, et al. (2016). T helper 1 immunity requires complement-driven NLRP3 inflammasome activity in CD4(+) T cells. Science 352, aad1210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arganda-Carreras I, Fernandez-Gonzalez R, Munoz-Barrutia A, and Ortiz-De-Solorzano C (2010). 3D reconstruction of histological sections: Application to mammary gland tissue. Microsc Res Tech 73, 1019–1029. [DOI] [PubMed] [Google Scholar]
- Baral P, Umans BD, Li L, Wallrapp A, Bist M, Kirschbaum T, Wei Y, Zhou Y, Kuchroo VK, Burkett PR, et al. (2018a). Author Correction: Nociceptor sensory neurons suppress neutrophil and gammadelta T cell responses in bacterial lung infections and lethal pneumonia. Nat Med 24, 1625–1626. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baral P, Umans BD, Li L, Wallrapp A, Bist M, Kirschbaum T, Wei Y, Zhou Y, Kuchroo VK, Burkett PR, et al. (2018b). Nociceptor sensory neurons suppress neutrophil and gammadelta T cell responses in bacterial lung infections and lethal pneumonia. Nat Med 24, 417–426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Belmonte C, and Giraldez F (1981). Responses of cat corneal sensory receptors to mechanical and thermal stimulation. J Physiol 321, 355–368. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bertke AS, Swanson SM, Chen J, Imai Y, Kinchington PR, and Margolis TP (2011). A5-positive primary sensory neurons are nonpermissive for productive infection with herpes simplex virus 1 in vitro. J Virol 85, 6669–6677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bonini S, Rama P, Olzi D, and Lambiase A (2003). Neurotrophic keratitis. Eye (Lond) 17, 989–995. [DOI] [PubMed] [Google Scholar]
- Bouley DM, Kanangat S, Wire W, and Rouse BT (1995). Characterization of herpes simplex virus type-1 infection and herpetic stromal keratitis development in IFN-gamma knockout mice. J Immunol 155, 3964–3971. [PubMed] [Google Scholar]
- Brash JT, Denti L, Ruhrberg C, and Bucher F (2019). VEGF188 promotes corneal reinnervation after injury. JCI Insight 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Calippe B, Augustin S, Beguier F, Charles-Messance H, Poupel L, Conart JB, Hu SJ, Lavalette S, Fauvet A, Rayes J, et al. (2017). Complement Factor H Inhibits CD47-Mediated Resolution of Inflammation. Immunity 46, 261–272. [DOI] [PubMed] [Google Scholar]
- Cardone J, Le Friec G, Vantourout P, Roberts A, Fuchs A, Jackson I, Suddason T, Lord G, Atkinson JP, Cope A, et al. (2010). Complement regulator CD46 temporally regulates cytokine production by conventional and unconventional T cells. Nat Immunol 11, 862–871. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carmeliet P, and Tessier-Lavigne M (2005). Common mechanisms of nerve and blood vessel wiring. Nature 436, 193–200. [DOI] [PubMed] [Google Scholar]
- Chiu IM, Pinho-Ribeiro FA, and Woolf CJ (2016). Pain and infection: pathogen detection by nociceptors. Pain 157, 1192–1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chucair-Elliott AJ, Zheng M, and Carr DJ (2015). Degeneration and regeneration of corneal nerves in response to HSV-1 infection. Invest Ophthalmol Vis Sci 56, 1097–1107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cohen JA, Edwards TN, Liu AW, Hirai T, Jones MR, Wu J, Li Y, Zhang S, Ho J, Davis BM, et al. (2019). Cutaneous TRPV1(+) Neurons Trigger Protective Innate Type 17 Anticipatory Immunity. Cell 178, 919–932 e914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cruzat A, Pavan-Langston D, and Hamrah P (2010). In vivo confocal microscopy of corneal nerves: analysis and clinical correlation. Semin Ophthalmol 25, 171–177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cruzat A, Witkin D, Baniasadi N, Zheng L, Ciolino JB, Jurkunas UV, Chodosh J, Pavan-Langston D, Dana R, and Hamrah P (2011). Inflammation and the nervous system: the connection in the cornea in patients with infectious keratitis. Invest Ophthalmol Vis Sci 52, 5136–5143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doymaz MZ, and Rouse BT (1992). Herpetic stromal keratitis: an immunopathologic disease mediated by CD4+ T lymphocytes. Invest Ophthalmol Vis Sci 33, 2165–2173. [PubMed] [Google Scholar]
- Farooq AV, and Shukla D (2012). Herpes simplex epithelial and stromal keratitis: an epidemiologic update. Surv Ophthalmol 57, 448–462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ferreira SH, Lorenzetti BB, Bristow AF, and Poole S (1988). Interleukin-1 beta as a potent hyperalgesic agent antagonized by a tripeptide analogue. Nature 334, 698–700. [DOI] [PubMed] [Google Scholar]
- Gallar J, Tervo TM, Neira W, Holopainen JM, Lamberg ME, Minana F, Acosta MC, and Belmonte C (2010). Selective changes in human corneal sensation associated with herpes simplex virus keratitis. Invest Ophthalmol Vis Sci 51, 4516–4522. [DOI] [PubMed] [Google Scholar]
- Group CR, Martin DF, Maguire MG, Ying GS, Grunwald JE, Fine SL, and Jaffe GJ (2011). Ranibizumab and bevacizumab for neovascular age-related macular degeneration. N Engl J Med 364, 1897–1908. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hamrah P, Cruzat A, Dastjerdi MH, Zheng L, Shahatit BM, Bayhan HA, Dana R, and Pavan-Langston D (2010). Corneal sensation and subbasal nerve alterations in patients with herpes simplex keratitis: an in vivo confocal microscopy study. Ophthalmology 117, 1930–1936. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hendricks RL, and Tumpey TM (1990). Contribution of virus and immune factors to herpes simplex virus type I-induced corneal pathology. Invest Ophthalmol Vis Sci 31, 1929–1939. [PubMed] [Google Scholar]
- Hendricks RL, Tumpey TM, and Finnegan A (1992). IFN-gamma and IL-2 are protective in the skin but pathologic in the corneas of HSV-1-infected mice. J Immunol 149, 3023–3028. [PubMed] [Google Scholar]
- Huang W, Xie P, Xu M, Li P, and Zao G (2011). The influence of stress factors on the reactivation of latent herpes simplex virus type 1 in infected mice. Cell Biochem Biophys 61, 115–122. [DOI] [PubMed] [Google Scholar]
- Jeon S, Rowe AM, Carroll KL, Harvey SAK, and Hendricks RL (2018). PD-L1/B7-H1 Inhibits Viral Clearance by Macrophages in HSV-1-Infected Corneas. J Immunol 200, 3711–3719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jin K, Mao XO, and Greenberg DA (2006). Vascular endothelial growth factor stimulates neurite outgrowth from cerebral cortical neurons via Rho kinase signaling. J Neurobiol 66, 236–242. [DOI] [PubMed] [Google Scholar]
- Julian K, Terrada C, Fardeau C, Cassoux N, Francais C, LeHoang P, and Bodaghi B (2011). Intravitreal bevacizumab as first local treatment for uveitis-related choroidal neovascularization: longterm results. Acta Ophthalmol 89, 179–184. [DOI] [PubMed] [Google Scholar]
- Kaplan PE, and Kaplan C (1980). Blink reflex: review of methodology and its application to patients with stroke syndromes. Arch Phys Med Rehabil 61, 30–33. [PubMed] [Google Scholar]
- Kurbanyan K, Hoesl LM, Schrems WA, and Hamrah P (2012). Corneal nerve alterations in acute Acanthamoeba and fungal keratitis: an in vivo confocal microscopy study. Eye (Lond) 26, 126–132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Labetoulle M, Baudouin C, Calonge M, Merayo-Lloves J, Boboridis KG, Akova YA, Aragona P, Geerling G, Messmer EM, and Benitez-Del-Castillo J (2019). Role of corneal nerves in ocular surface homeostasis and disease. Acta Ophthalmol 97, 137–145. [DOI] [PubMed] [Google Scholar]
- Lepisto AJ, Frank GM, Xu M, Stuart PM, and Hendricks RL (2006). CD8 T cells mediate transient herpes stromal keratitis in CD4-deficient mice. Invest Ophthalmol Vis Sci 47, 3400–3409. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liesegang TJ (2001). Herpes simplex virus epidemiology and ocular importance. Cornea 20, 1–13. [DOI] [PubMed] [Google Scholar]
- Longair MH, Baker DA, and Armstrong JD (2011). Simple Neurite Tracer: open source software for reconstruction, visualization and analysis of neuronal processes. Bioinformatics 27, 2453–2454. [DOI] [PubMed] [Google Scholar]
- Martin JR, Jenkins FJ, and Henken DB (1991). Targets of herpes simplex virus type 1 infection in a mouse corneal model. Acta Neuropathol 82, 353–363. [DOI] [PubMed] [Google Scholar]
- Matheis F, Muller PA, Graves CL, Gabanyi I, Kerner ZJ, Costa-Borges D, Ahrends T, Rosenstiel P, and Mucida D (2020). Adrenergic Signaling in Muscularis Macrophages Limits Infection-Induced Neuronal Loss. Cell 180, 64–78 e16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McNamee KE, Alzabin S, Hughes JP, Anand P, Feldmann M, Williams RO, and Inglis JJ (2011). IL-17 induces hyperalgesia via TNF-dependent neutrophil infiltration. Pain 152, 1838–1845. [DOI] [PubMed] [Google Scholar]
- Molesworth-Kenyon SJ, Yin R, Oakes JE, and Lausch RN (2008). IL-17 receptor signaling influences virus-induced corneal inflammation. J Leukoc Biol 83, 401–408. [DOI] [PubMed] [Google Scholar]
- Muller LJ, Marfurt CF, Kruse F, and Tervo TM (2003). Corneal nerves: structure, contents and function. Exp Eye Res 76, 521–542. [DOI] [PubMed] [Google Scholar]
- Muller RT, Abedi F, Cruzat A, Witkin D, Baniasadi N, Cavalcanti BM, Jamali A, Chodosh J, Dana R, Pavan-Langston D, and Hamrah P (2015). Degeneration and Regeneration of Subbasal Corneal Nerves after Infectious Keratitis: A Longitudinal In Vivo Confocal Microscopy Study. Ophthalmology 122, 2200–2209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Newell CK, Martin S, Sendele D, Mercadal CM, and Rouse BT (1989a). Herpes simplex virus-induced stromal keratitis: role of T-lymphocyte subsets in immunopathology. J Virol 63, 769–775. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Newell CK, Sendele D, and Rouse BT (1989b). Effects of CD4+ and CD8+ T-lymphocyte depletion on the induction and expression of herpes simplex stromal keratitis. Reg Immunol 2, 366–369. [PubMed] [Google Scholar]
- Nishida T, and Yanai R (2009). Advances in treatment for neurotrophic keratopathy. Curr Opin Ophthalmol 20, 276–281. [DOI] [PubMed] [Google Scholar]
- Nishijima K, Ng YS, Zhong L, Bradley J, Schubert W, Jo N, Akita J, Samuelsson SJ, Robinson GS, Adamis AP, and Shima DT (2007). Vascular endothelial growth factor-A is a survival factor for retinal neurons and a critical neuroprotectant during the adaptive response to ischemic injury. Am J Pathol 171, 53–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Norn MS (1970). Dendritic (herpetic) keratitis. IV. Follow-up examination of corneal sensitivity. Acta Ophthalmol (Copenh) 48, 383–395. [DOI] [PubMed] [Google Scholar]
- Oetjen LK, Mack MR, Feng J, Whelan TM, Niu H, Guo CJ, Chen S, Trier AM, Xu AZ, Tripathi SV, et al. (2017). Sensory Neurons Co-opt Classical Immune Signaling Pathways to Mediate Chronic Itch. Cell 171, 217–228 e213. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Okada Y, Sumioka T, Ichikawa K, Sano H, Nambu A, Kobayashi K, Uchida K, Suzuki Y, Tominaga M, Reinach PS, et al. (2019). Sensory nerve supports epithelial stem cell function in healing of corneal epithelium in mice: the role of trigeminal nerve transient receptor potential vanilloid 4. Lab Invest 99, 210–230. [DOI] [PubMed] [Google Scholar]
- Oliveira-Soto L, and Efron N (2001). Morphology of corneal nerves using confocal microscopy. Cornea 20, 374–384. [DOI] [PubMed] [Google Scholar]
- Pavan-Langston D (1990). Herpes simplex virus ocular infections: current concepts of acute, latent and reactivated disease. Trans Am Ophthalmol Soc 88, 727–796. [PMC free article] [PubMed] [Google Scholar]
- Pinto LG, Cunha TM, Vieira SM, Lemos HP, Verri WA Jr., Cunha FQ, and Ferreira SH (2010). IL-17 mediates articular hypernociception in antigen-induced arthritis in mice. Pain 148, 247–256. [DOI] [PubMed] [Google Scholar]
- Reyes JL, Vannan DT, Eksteen B, Avelar IJ, Rodriguez T, Gonzalez MI, and Mendoza AV (2018). Innate and Adaptive Cell Populations Driving Inflammation in Dry Eye Disease. Mediators Inflamm 2018, 2532314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rosenberg ME, Tervo TM, Muller LJ, Moilanen JA, and Vesaluoma MH (2002). In vivo confocal microscopy after herpes keratitis. Cornea 21, 265–269. [DOI] [PubMed] [Google Scholar]
- Rowe AM, St Leger AJ, Jeon S, Dhaliwal DK, Knickelbein JE, and Hendricks RL (2013). Herpes keratitis. Prog Retin Eye Res 32, 88–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Royer DJ, Echegaray-Mendez J, Lin L, Gmyrek GB, Mathew R, Saban DR, Perez VL, and Carr DJ (2019). Complement and CD4(+) T cells drive context-specific corneal sensory neuropathy. Elife 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sabbaga EM, Pavan-Langston D, Bean KM, and Dunkel EC (1988). Detection of HSV nucleic acid sequences in the cornea during acute and latent ocular disease. Exp Eye Res 47, 545–553. [DOI] [PubMed] [Google Scholar]
- Severin MJ, and White RJ (1968). The neural transmission of herpes simplex virus in mice. Light and electron microscopic findings. Am J Pathol 53, 1009–1020. [PMC free article] [PubMed] [Google Scholar]
- Sondell M, Sundler F, and Kanje M (2000). Vascular endothelial growth factor is a neurotrophic factor which stimulates axonal outgrowth through the flk-1 receptor. Eur J Neurosci 12, 4243–4254. [DOI] [PubMed] [Google Scholar]
- Storkebaum E, Lambrechts D, Dewerchin M, Moreno-Murciano MP, Appelmans S, Oh H, Van Damme P, Rutten B, Man WY, De Mol M, et al. (2005). Treatment of motoneuron degeneration by intracerebroventricular delivery of VEGF in a rat model of ALS. Nat Neurosci 8, 85–92. [DOI] [PubMed] [Google Scholar]
- Suryawanshi A, Mulik S, Sharma S, Reddy PB, Sehrawat S, and Rouse BT (2011a). Ocular neovascularization caused by herpes simplex virus type 1 infection results from breakdown of binding between vascular endothelial growth factor A and its soluble receptor. J Immunol 186, 3653–3665. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Suryawanshi A, Veiga-Parga T, Rajasagi NK, Reddy PB, Sehrawat S, Sharma S, and Rouse BT (2011b). Role of IL-17 and Th17 cells in herpes simplex virus-induced corneal immunopathology. J Immunol 187, 1919–1930. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Suryawanshi A, Veiga-Parga T, Reddy PB, Rajasagi NK, and Rouse BT (2012). IL-17A differentially regulates corneal vascular endothelial growth factor (VEGF)-A and soluble VEGF receptor 1 expression and promotes corneal angiogenesis after herpes simplex virus infection. J Immunol 188, 3434–3446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tanelian DL, and Beuerman RW (1984). Responses of rabbit corneal nociceptors to mechanical and thermal stimulation. Exp Neurol 84, 165–178. [DOI] [PubMed] [Google Scholar]
- Tang Q, Chen W, and Hendricks RL (1997). Proinflammatory functions of IL-2 in herpes simplex virus corneal infection. J Immunol 158, 1275–1283. [PubMed] [Google Scholar]
- Thomas J, Gangappa S, Kanangat S, and Rouse BT (1997). On the essential involvement of neutrophils in the immunopathologic disease: herpetic stromal keratitis. J Immunol 158, 1383–1391. [PubMed] [Google Scholar]
- Tovar YRLB, Zepeda A, and Tapia R (2007). Vascular endothelial growth factor prevents paralysis and motoneuron death in a rat model of excitotoxic spinal cord neurodegeneration. J Neuropathol Exp Neurol 66, 913–922. [DOI] [PubMed] [Google Scholar]
- Treat BR, Bidula SM, St Leger AJ, Hendricks RL, and Kinchington PR (2020). Herpes Simplex Virus 1-Specific CD8(+) T Cell Priming and Latent Ganglionic Retention Are Shaped by Viral Epitope Promoter Kinetics. J Virol 94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tuominen IS, Konttinen YT, Vesaluoma MH, Moilanen JA, Helinto M, and Tervo TM (2003). Corneal innervation and morphology in primary Sjogren’s syndrome. Invest Ophthalmol Vis Sci 44, 2545–2549. [DOI] [PubMed] [Google Scholar]
- Verjans GM, Remeijer L, van Binnendijk RS, Cornelissen JG, Volker-Dieben HJ, Baarsma SG, and Osterhaus AD (1998). Identification and characterization of herpes simplex virus-specific CD4+ T cells in corneas of herpetic stromal keratitis patients. J Infect Dis 177, 484–488. [DOI] [PubMed] [Google Scholar]
- Wang MTM, Tien L, Han A, Lee JM, Kim D, Markoulli M, and Craig JP (2018). Impact of blinking on ocular surface and tear film parameters. Ocul Surf 16, 424–429. [DOI] [PubMed] [Google Scholar]
- Wilhelmus KR, Coster DJ, Donovan HC, Falcon MG, and Jones BR (1981). Prognostic indicators of herpetic keratitis. Analysis of a five-year observation period after corneal ulceration. Arch Ophthalmol 99, 1578–1582. [DOI] [PubMed] [Google Scholar]
- Wuest TR, and Carr DJ (2010). VEGF-A expression by HSV-1-infected cells drives corneal lymphangiogenesis. J Exp Med 207, 101–115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yun H, Lathrop KL, and Hendricks RL (2016). A Central Role for Sympathetic Nerves in Herpes Stromal Keratitis in Mice. Invest Ophthalmol Vis Sci 57, 1749–1756. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yun H, Rowe AM, Lathrop KL, Harvey SA, and Hendricks RL (2014). Reversible nerve damage and corneal pathology in murine herpes simplex stromal keratitis. J Virol 88, 7870–7880. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zagaria MAE (2015). HSV Keratitis An Important Infectious Cause of Blindness. Us Pharmacist 40, 16–18. [Google Scholar]
- Zander E, and Weddell G (1951). Observations on the innervation of the cornea. J Anat 85, 68–99. [PMC free article] [PubMed] [Google Scholar]
- Zheng M, Klinman DM, Gierynska M, and Rouse BT (2002). DNA containing CpG motifs induces angiogenesis. Proc Natl Acad Sci U S A 99, 8944–8949. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






