The synergistic anticancer effects of ReoT3D, CPT-11, and BBI608 on murine colorectal cancer cells

Abstract

Background

Many types of oncolytic viruses (OVs) were enrolled in clinical trials. Recently, an OV named Talimogene laherparepvec approved for the treatment of melanoma. This achievement highlighted the clinical application of OVs. Scientists focus on using these anticancer agents in combination with the current or/and new anticancer chemotherapeutics. They aim to increase the oncolytic effect of a new approach for the treatment of cancer cells.

Objectives

The present study aimed to assess the anticancer impacts of ReoT3D, irinotecan (CPT-11), and napabucasin (BBI608) against murine colorectal cancer cells (CT26). They are assessed alone and in combination with each other.

Methods

Here, oncolytic reovirus was propagated and titrated. Then MTT assay was carried out to assess the toxicity of this OV and chemotherapeutics effect on CT26 cells. The anticancer effects of ReoT3D, CPT-11, and BBI608, alone and simultaneously, on CT26 cell line, were assessed by the induction of apoptosis, cell cycle arrest, colony-forming, migration, and real-time PCR experiments.

Results

Alone treatment with ReoT3D, CPT-11, and BBI608 led to effectively inducing of apoptosis, cell cycle arrest, and apoptotic genes expression level and significantly reduce of colony-forming, migration, and anti-apoptotic genes expression rate. Importantly, the maximum anticancer effect against CT26 cell line was seen upon combination ReoT3D, CPT-11, and BBI608 treatment.

Conclusion

The present study highlights that combination of ReoT3D, CPT-11, and BBI560 showed synergistic anticancer activity against CT26 cell line. This modality might be considered as a new approach against colorectal cancer (CRC) in the in vivo and clinical trial investigations.

Graphical abstract

Introduction

Cancer as a worldwide health care challenge is responsible for 18.1 million new cases and 9.6 million death in people of high incoming countries. However, more than 2/3 of deaths occur in medium, and low-income societies [1]. Colorectal cancer (CRC) is one of the four common diagnosed cancers with half-million death annually in the United States [2]. Surgery, chemo, and radiation therapies are three human approaches to fight against CRC. When CRC diagnosed, around 50% of sufferings from metastasis, henceforward led to tumor progression and decreased the efficiency of the current treatment options [3]. So, exploring, and design of new agents and strategies for metastatic cancers treatment are essentially needed. Oncolytic viruses (OVs) could infect tumor cells and induce oncolytic activity. This privilege feature of OVs attracted scientists attention to use them as a new anti-tumor candidate [4]. Recently, an OV application in cancer therapy received Food and Drug Administration (FDA) approval and introduced as a compelling treatment approach [4, 5]. OVs might have natural tropism or engineered for cancer cells that selectively replicate, kill and spread in the tumor environment [6, 7]. A wide range of OVs with various features is under cancer therapy investigations [8].

Oncolytic reovirus is a wild type OVs with double-stranded RNA genome from the Reoviridae family, which causes mild clinical symptoms in humans [9]. Three strains of reovirus, namely Dearing, long, and Jones are naturally cancer cells killers, and Dearing strain (ReoT3D) frequently was used in the clinical trials because of having great oncolytic ability [10]. ReoT3D selectively targets and replicates in KRAS activated cancer cells [11]. KRAS signaling pathway is a genetical disorder takes part in the progression of different cancers [12]. Also, ReoT3D could target and infect the murine colorectal cells (CT26) because these cells express mutant of KRAS gene [13]. Although ReoT3D monotherapy demonstrated hopeful results, combination therapy of current cancer treatment methods with reovirus significantly increased anti-tumor responses [14]. Besides, combination therapy with ReoT3D and chemotherapeutic drugs in comparison to monotherapy by ReoT3D increased anticancer activity and survival rate in the mice models and patients [15, 16].

The irinotecan (CPT-11) as a topoisomerase I inhibitor was discovered in 1983 in Japan. It exhibits potent anticancer effect against a wide range of cancers by arresting topoisomerase I (Topo I) function in preclinical models and clinical trial in human [17, 18]. In vivo studies and clinical trials provoke that this water-soluble agent converts to the SN-38, as an active metabolite, and functional form of CPT-11 led to cell killing by suppression of replication fork at cancer cells [18]. In recent years, chemotherapy has made great strides in the production of chemical drugs, especially stem cell inhibitors which napabucasin (BBI608) is the newest and best one. BBI608 is an inhibitor of STAT3; a signaling pathway is the main regulator of oncogenesis pathways in different tumors. Therefore targeting such pathway should be considered to produce new anticancer agents. BBI608 can directly suppress the transcription of STAT3-derived genes and also indirectly inhibits other related genes and pathways [19].

To our knowledge, in vitro anticancer effect of combination regime of ReoT3D, CPT-11, and BBI608 against CT 26 cells have not yet been reported. Therefore, we explored the potential anticancer impacts of ReoT3D in KRAS activated pathway CT26 cells when combined with CPT-11 and BBI560 for the first time.

Material and methods

Cells and drugs

The murine colorectal cancer cell line named CT26 as a target for our cancer therapy and L929 as a typical host for reovirus production and titration, were maintained in Dulbecco’s Modified Eagle Medium (DMEM; Sigma, USA) added with 10% fetal bovine serum (FBS; Gibco, USA), 1 mM GlutaMAX (Sigma, USA) and penicillin and streptomycin (100 units/ mL, 100 mg/mL, respectively; (Sigma, USA)_. Cells were cultured in the conventional incubator atmosphere at 37 °C with 5% CO₂ and passaged with routine protocols.

Also, CPT-11 (50 mg; Sigma, USA, Cat No: 100286–90-6) was prepared from CinnaGen Medical Biotechnology Research Center, Tehran, Iran and also BBI608 was purchased from TOCRIS company (USA, Batch No: 1A/185013; 10 mg).

ReoT3D propagation and titration

The ReoT3D virus was provided as a gift from Dr. Shamsi-Shahrabadi at Iran Medical University. For virus propagation, L929 cells at 80% confluency infected at a multiplicity of infection (MOI) 1pfu/cells of ReoT3D as described in the previous report [20]. Eventually, the supernatant of cultures containing ReoT3D purified and then titrated by tissue culture infectious dose 50 (TCID₅₀) as described by Smith et al. [21].

Toxicity assay

The 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay was conducted to quantify the susceptibility of CT26 cells to ReoT3D, CPT-11, and BBI608. Thus, 10⁴ cells/mL of CT26 cells were cultured in 96-well plates and at 70% confluency inoculated with an increasing concentration of ReoT3D (MOI: 0.05 to 20 PFUs/cell), CPT-11 (10 to 120 mg/ml), and BBI608 (1 to 20 mM/ml). After 24, 48, and 72 h incubation, target cells were incubated with MTT (2 mg/ml stock concentration; Sigma, USA, Cat No: 298–93-1) at 37 °C for 2 h. Subsequently, the supernatant was removed from the cultures and cells were lysed by adding DMSO (50 ul for each well; Sigma, USA, Cat No: 506008) at incubator atmosphere for 20 min. A spectrophotometer read the absorbance at a wavelength of 570 nm. Each experiment was repeated 3 times for data analysis.

In vitro experiments

CT26 cells treatment with ReoT3D, CPT-11, and BBI560

Five treatment groups containing control, ReoT3D, CPT-11, BBI560, and combination of all agents were designed and their in vitro anticancer effects were tested against CT26 cell line. The 3 × 10⁵ cells/well of CT26 cells were seeded in 96-well plates and then at ~70% confluence were inoculated with above-designed groups for 48 h. All experiments carried out in all treatments (alone and combined groups) and control groups in triplicate and mean of three values used for statistical analysis.

Flow cytometry assay for cell death rate and cell cycle distribution analysis

The potential effect of designed groups on apoptosis induction rate and cells cycle distribution alterations of CT26 cell line after 48 h incubation was evaluated by flow cytometry assay. For apoptosis assay, target cultures were grown, washed with cold PBS, and detached by incubation in the presence of trypsin. Collected aliquots containing 10⁶ cells in each sample were incubated in 1x flow buffer containing AnnexinV-FITC (Biolegend, Cat No: 640945) as described by manufacturer’s guidance [22, 23]. Subsequently, cells were stained by propidium iodide (PI; 10 μL, Biolegend, Cat No: 420201) and then Annexin V-FITC and PI emission intensity measured by a FACS Calibur machine (BD biosciences, San Jose). Debris and dead cells were deleted from the analysis by forwarding and sideways light scatter by FlowJo software (version 7.6).

For cell cycle analysis, CT26 cells were collected, and aliquots of 10⁶ cells in each sample were washed and resuspended in PBS as above. Next, cells were fixed and permeabilized in 4% paraformaldehyde (Sigma, USA, Cat No: 30525894) and 70% ice-cold ethanol by incubation for 1 and 24 h at 4 °C, respectively. CT26 cells were stained with a staining solution comprised of 40 μL of PI (Sigma, USA, P4170, Cat No: 25535-16-4), 10 μL of RNase and 950 μL of PBS for 30 min at room atmosphere. Eventually, cell cycle analysis was examined by a FACS Calibur machine (BD biosciences, San Jose) and FlowJo software.

Colony-forming ability

A density of 1 × 10³ CT26 cells in high glucose MEM supplemented with 10% FBS were seeded in the 10 cm² Petri dishes. After 6 h incubation, target dishes containing adherent CT26 cells were inoculated with ReoT3D, CPT-11, and BBI608 independently or in combination, and treatment followed by incubation at 37 °C with 5% CO₂ for 10 days_. During the treatment period, media was discarded from the cultures and refreshed with a new one every 72 h. Next, Petri dishes containing treated cells were washed twice by PBS, survived colonies fixed with 4% paraformaldehyde and stained in 1% Giemsa staining solution (Sigma, USA, Cat No: 51811–82-6). Pictures were taken from the colonies, and Image J software (version 1.42) was used for colony-forming abilities, including average size, the number of colonies and covered area by colonies.

Migration assay by scratch

To assess the migration rate of treated and non-treated cultures, CT26 cells were harvested from the flasks, a density of 1 × 10³ cells/well was seeded in the 6 well plates and incubated at the humidified chamber. When seeded cultures reached to ~80% confluency, they were scratched by a pipette tip. Next, ReoT3D, CPT-11, and BBI608 in alone and in combination groups were added to the wells and obtained light microscopic images at 0 to 48 h post-treatment, followed by analyzing with Image J software.

Real-time PCR assay for gene expression

At 48 h post-treatment, test cultures were collected from all groups, and total RNA was extracted by TRIzol (Invitrogen, USA, Cat No: 15596018). Then cDNA synthesis was done by HyperScript™ first-strand synthesis kit (Invitrogen, USA, Cat No: 11904018) as described by manufacturer’s guidance. The gene expression level of apoptotic and anti-apoptotic genes with specific primers (Table 1) in test cultures was measured by SybrGreen Master Mix Kit Amplicon, Denmark, Cat No: A325402) in a StepOne Plus real-time PCR machine (Applied Biosystems). Also, S16 was considered as an internal control and relative expression rate of target genes measured using the relative quantification (2^-ΔΔCt) method. Finally, raw data was analyzed in the REST software (version 2009).

Table 1.

The details of primers sequences that were used in real-time PCR assay, (m: mice)

Primers and Probes	Sequence (5′---- > 3′)	Target gene
m-P53-F	GATGTATTGAAATCGGTCCCA	Apoptotic
m- P53-R	CTCCTCAGTGTCAGCCTATA	Apoptotic
m-P21-F	GGACACCGAGACTTACAGA	Apoptotic
m- P21-R	GCAACAGAGAAGCCAGGG	Apoptotic
m-Bid-F	GTAGAGTAAAGATTGGTTCAGGG	Apoptotic
m-Bid-R	GGATTGTAAAGATGTGAGCCGA	Apoptotic
m-Bax-F	CCTACTTTGGGACATCGTTT	Apoptotic
m-Bax-R	CTACCGTTGAAGTTGACCC	Apoptotic
m-Caspase8-F	CATTCTACAGTCCAGTATCTACC	Apoptotic
m-Caspase8-R	CCTTCAAGATGCCACTTCT	Apoptotic
m-Caspase3-F	CATTCGTATGTCCTTCAGTCG	Apoptotic
m-Caspase3-R	CCTTCCACCGTTGCCTTA	Apoptotic
m- K-RAS-F	GTGCCTATGGTCCTGGTAG	Apoptotic
m- K-RAS-R	CGTAACTCCTTGCTAACTCC	Apoptotic
m- STAT3-F	GGAGGAGAGGATCGTGGAG	Apoptotic
m- STAT3-R	ACCAGCAACCTGACTTTCG	Apoptotic
m-Bcl2-F	GGACAACTGCGAGAGGRG	Anti-apoptotic
m-Bcl2-R	CTGGAGACAAACTAAAGAGGAC	Anti-apoptotic
m- Bcl-xL-F	CTTGGTGTGGTCGGTGTC	Anti-apoptotic
m- Bcl-xL-R	GGTGAGTGGAGAGTGGAGG	Anti-apoptotic
m-S16-F (Rps16)	GACAAAAGAACGCAGGCT	Internal control
m-S16-R (Rps16)	GCACACTTCCCACCACC	Internal control

Statistical analysis

The data were acquired from FlowJo 7.6, Image J, and REST software. Statistical analysis of data expressed as mean ± standard deviation (SD) was computed by Graph Pad Prism (version 8.4.2) and a P value <0.05 was reported as statistically significant. The paired t-test, Fisher’s, and one-way ANOVA were used to show intragroup differences, differences between two groups, and differences among three or more groups, respectively.

Results

Cytotoxicity of ReoT3D, CPT-11, and BBI608 significantly increased by combined treatment

ReoT3D stock was expanded in the normal host cell (L929) and viral cytopathic effect (CPE) monitored by light microscope every 6 h. reovirus CPE was started from 16 h post-infection (hpi), and the maximum level was seen at 48 hpi. Titration results computed 1 × 10^7.4 TCID₅₀/ml of our stock.

MTT assay was conducted to evaluate the toxicity of ReoT3D, CPT-11, and BBI608 on the mouse colorectal cell line letter 24, 48, and 72 h treatment. As viability data depicted in Fig. 1, all our anticancer agents suppressed the viability of CT26 cells in time and dose-manner in comparison with control. Overall, among the groups, lowest and highest toxicity were detected at 24 hpi of 10 μg /ml of CPT-11 and 72 hpi of 20 mM/ml of BBI608, respectively. Although the high concentration of all anticancer agents was capable of reducing the cell viability in both all tested times, CT26 cells were resistant to the low tested doses of each option, especially CPT-11 and ReoT3D (Fig. 1). All these highlight that CT26 cells are permissive to expose with ReoT3D, CPT-11, and BBI608 by increasing time and dose. Finally, ReoT3D at MOI: 1 Pfu/cell, CPT-11 at 60 mg/ml and BBI608 at 2 mM/ml in separate groups and MOI: 0.5 pfu/cell of ReoT3D + 20 mg/ml of CPT-11 + 1 mM/ml of BBI608 in the combined group were selected as working doses for doing in vitro anticancer tests.

Fig. 1.

MTT assay. Cytotoxicity of ReoT3D, CPT-11, and BBI608 on CT26 cells upon treatment for 24, 48, and 72 h. a Viability of CT26 cells in the presence of ReoT3D; b Viability of CT26 cells in the presence of CPT-11; c Viability of CT26 cells in the presence of BBI608. The results are representatives of three independent runs

Apoptotic cells population in combined-treated cells was more than cultures treated with an alone agent

We looked for changes in the death rate in treated and non-treated cultures via flow cytometry at 48 hpi (Fig. 2). Generally, AnnexinV-FITC staining results clear that cell death rate in all alone and especially in combined-treated cultures significantly induced in comparison with control. Among the separate groups, CT26 cells treated with CPT-11 showed a slight increase in the number of apoptotic cells. ReoT3D infection alone resulted in a district increase in apoptotic cells population and highest induction in both early (12.7%) and late apoptotic cells (22.0%) percent was detected when they treated with BBI608 among separate groups (Fig. 2). Surprisingly, the combination of ReoT3D, CPT-11, and BBI608 had an excellent effect on the early apoptosis induction in CT26 cells (28.2%), while this treat decreased late apoptotic cells population (12.6%) in competition with BBI608-treated sample (22.0%).

Fig. 2.

Apoptosis assay. The cell death rate of CT26 cells after 48 h treatment with ReoT3D, CPT-11, and BBI608 in alone and combined groups was measured by flow cytometry. a Shown are representative dot plots from two-color flow cytometry: lower left quadrant (Q4) viable cells; bottom right quadrant (Q3) early apoptotic cells; top right quadrant (Q2) late apoptotic cells/cells without membrane integrity; b Bar graph of all target cultures are shown, the results are representatives of three independent runs, *p < 0.05, **p < 0.01, ***p < 0.001(n = 3)

Combined of ReoT3D, CPT-11, and BBI608 results in significantly S phase reduction with G0/G1 and G2/M arrest with sub-G1 apoptotic fraction induction

We wanted to evaluate the cell cycle distribution in treated and non-treated cultures via flow cytometry at 48 hpi (Fig. 3). In CT26 cells, exposure with CPT-11 alone led to the only arrest in G0/G1 checkpoint with a marked decrease of S-phase fraction. ReoT3D treatment also resulted in a reduction in S phase and induction in G1 and G2M phases, and these cell cycle arrests were highly increased upon alone treatment with BBI608 (Fig. 3a). As we expected, the highest induction in G1/S and G2/M phases with marked arrest in M phase was observed in combination-treated cells). Furthermore, a significant increase was seen in the percentage of sub-G1 cells at a combination (3.4%) treated cultures in comparison with other alone treats and no-treated control samples (Fig. 3b).

Fig. 3.

Cell cycle analysis. Cell cycle distribution of CT26 cells after 48 h treatment with ReoT3D, CPT-11, and BBI608 in alone and combined groups was measured by flow cytometry. a Representative plots of one set of triplicate experiments are shown; b Bar graph of cell distributions of all target cultures are shown, the results are representatives of three independent runs, *p < 0.05, **p < 0.01(n = 3)

Combined ReoT3D, CPT-11, and BBI608 reduces marked colony-forming and migration activity

We next sought to compare the migration and colony-forming potency in treated CT26 cells with control samples at 48 h after exposure. Image J software measured three factors in captured pictures from survived colonies of treated and non-treated samples to determine the colony-forming potency. Although all relative colony size (Fig. 4b), the number of colonies (Fig. 4c) and colony area (Fig. 4d) data were more compelling in all treatment groups of CT26 cultures, combination-treated cells indicated more reduction in these factors in comparison to alone treated groups (Fig. 4).

Fig. 4.

Colony-forming assay. a Colony-forming viability of CT26 cells after 48 h treatment with ReoT3D, CPT-11, and BBI608 in alone and combined groups; b Bar graph of relative colony size; c Bar graph of the number of survived colonies; d Bar graph of colony area. The results are representatives of three independent runs which analyzed by ImageJ software,*p < 0.05, **p < 0.01(n = 3)

Light microscope illustrations were captured during treatment every 6 h and number of migrated cells of obtained images at 0, 12, 24, and 48 h after exposure was calculated by Image J software to determine the possible effect of treats on CT26 cells (Fig. 5). In the monotherapy groups, all options showed a desirable effect on reducing the number of migrated cells, most marked anti-migration action was seen in the BBI608-exposed culture. By inhibiting the migration activity of CT26 cells, we suggest that treatment agents, especially the combination of ReoT3D, CPT-11, and BBI608, suppress the invasion of treated samples.

Fig. 5.

Migration assay. a The migration rate of CT26 cells was measured by scratch assay at 0, 24 and 48 h after treatment with ReoT3D, CPT-11, and BBI608 in alone and combined groups; b Bar graph of migrated cells at target cultures. The results are representatives of three independent runs and results are given as a percentage closure of the initial scratch, *p < 0.05, **p < 0.01(n = 3)

Combined ReoT3D, CPT-11, and BBI608 increases potentially an expression of apoptotic genes and decreases anti-apoptotic genes

To further assess anticancer activities of reovirus and chemotherapeutics, we investigated the potency of ReoT3D alone and combination with drugs on the expression level of apoptotic and anti-apoptotic genes by considering S16 gene as an internal control for data analysis in real-time PCR. In CT26 cells, exposure with CPT-11 alone led to a remarkable decrease of exogenous apoptosis genes solely. CT26 infection with ReoT3D caused a significantly inductive effect on the relative expression level of both endogenous and exogenous apoptosis genes. Among alone treated cells, induction in apoptotic genes expression reached to the maximum level at BBI608- treated with desirable suppressive effect of anti-apoptotic genes. These reductions in exogenous and endogenous mRNA expression were hugely induced by combination treatment, highest decreasing in anti-apoptotic genes was detected on these exposed samples (Fig. 6). So, real-time PCR data are parallel with apoptosis ones and confirm the increased anti-apoptotic action in combination therapy. Also, the expression level of KRAS and STAT3 genes was evaluated in all treatment groups, and we found that alone treatment with RoeT3D or BBI608 significantly down-regulated KRAS and STAT3 genes, respectively. However, significant down-regulation at both KRAS and STAT3 mRNAs was detected in combination treatments.

Fig. 6.

Real-time PCR assay. The relative expression level of apoptotic and anti-apoptotic genes at all target groups after 48 h treatment. The results are representatives of three independent runs, *p < 0.05, **p < 0.01(n = 3)

Discussion

ReoT3D a wild type oncolytic reovirus with selectively controlled infection and replication in KRAS activated normal cancer cells and cancer stem cells (CSCs) in different tumors are investigated in previous studies [11]. Although ReoT3D was enrolled in some clinical trials, a study demonstrated that reovirus alone did not show compelling results in the treatment of advanced malignancies. For this reason, the current study emphasis is on combination therapy with ReoT3D and chemotherapy [24]. On the other hand, current methods, including surgery, chemo, and radiotherapies, could not wholly suppress CRC metastasis and also have many side effects for patients [25]. Hence, different kind of OVs and drugs were utilized against different cancer cell lines through combining of oncolytic reovirus and chemotherapeutics [26–28]. Even some other combination regimes were tested for the treatment of patient’s in clinical trials [29–31]. Maximum anticancer potential of ReoT3D likely realized in combination therapies by targeting different signaling pathways of cancer cells and decrease the adverse effects of virus injection [27].

In this study, we aimed to investigate the combination treatment of ReoT3D, CPT-11, and BBI608 against CT26 cell line. To our knowledge, this is a first comprehensive in vitro combination assessment of murine CRC cell line to exposure with these agents. At the same time, prior studies evaluated the anticancer effect of monotherapy and combination of ReoT3D with CPT-11, and BBI608 with CPT-11 on mouse and human colorectal cell lines [13, 27, 32, 33]. CPT-11 is a topoisomerase I inhibitor that suppresses the replication of cancer cells with damaged DNA and routinely utilized for the treatment of CRC [34]. ReoT3D, as an oncolytic virus, could preferentially target the KRAS activated cancer cells such as CT26 cell line [13]. BBI608 is the latest brilliant CSCs killer that targets STAT3 pathway [19]. Regarding with mentioned anticancer features of all selected agents, this combination modality could target KRAS and STAT3 pathways in normal cancer cells and CSCs. It can be a very effective method to get rid of tumor metastasis and relapse in a wide range of solid tumors such as CRC.

Here, we first evaluated CT26 cell line viability in the presence of ReoT3D, CPT-11, and BBI608 and toxicity evaluation data clarified that CT26 cells were susceptible to exposure with a high concentration of these agents; this susceptibility was affected by time and dose. We carried out different experiments to understand the anticancer activity of selected regimes.

Base on flow cytometry findings, treatment with ReoT3D, CPT-11, and BBI608 were capable of inducing apoptosis in CT26 cells significantly. Among alone treatment regime, the highest increase in early and late apoptosis result caused by BBI608 treated-group. The published data suggested ReoT3D triggered oncolysis from caspase-independent pathway [35], but against, another one showed that ReoT3D mediated apoptosis by an effect on the caspase-dependent pathway [36]. At the molecular level, CPT-11 increased oncolysis of KRAS mutant human CRC cells by up-regulation of caspase-independent genes, especially P21 [27]. However, our gene expression findings exhibited that CPT-11 up-regulated both caspase-dependent and independent manner genes in CT26 cells.

Furthermore, we found that ReoT3D and BBI608 alone treatment significantly up-regulated both caspase-dependent and independent manner genes (P21, P53, Bid, Bax, Caspase8, and Caspase3) and also down-regulated anti-apoptotic genes (BCL2, BCL-XL) in comparison with non-treated cells. Those genes were more affected by combination therapy of ReoT3D, CPT-11, and BBI608, which led to higher percentage of apoptotic cells in combination treated-group than monotherapy, these results are reasonable and absolutely depends on cell type and other microenvironmental elements in target cells. The importance of cell source and treatment regimens are shown in the previous study [37]. Collectively, apoptosis and gene expression results suggest that early inducted apoptotic and late reduced apoptotic at the combination-treated sample in comparison with BBI608 treated-cells may be due to synergistic effect between all agents in the targeting of different apoptotic pathways. All these highlight synergistic cooperation between all tested agents in the induction of apoptosis. This synergistic activity may be due to DNA damage in the presence of anticancer agents, which subsequently led to the induction of P53 dependent apoptosis [18]. It has been shown that ReoT3D performs its oncolysis activity by reduction of PI3K/Akt pathway and IFN-stimulated genes [38]. Also, inhibition of STAT3, Nanog, Klf4, survivin, C-myc, and β-catenin genes by BBI608 treatment was confirmed previously [39]. Our results indicated that combination treatments down-regulated both KRAS and STAT3 genes expression, highlighting the potential synergistic effect of ReoT3D, CPT-11, and BBI608. Consistently, it has been shown that down-regulation of STAT3 and KRAS genes expression through anticancer agents could induce apoptosis in cancer cells [27, 40]. However, more investigations at the molecular level should focus on the potential effects of present combination treatment on the wide range of genes involved in apoptosis induction.

The cell cycle assay is a critical experiment that correctly reflects the effect of anticancer agents on the proliferation and survival of cancer cells. Anticancer agents inhibited proliferation of tumor cells by an effect on different stages on cell cycle. For example, CPT-11 performs its anti-proliferative activity by induction of G1 arrest [41], which our cell cycle analysis confirmed that. Previous works showed that BBI608 could arrest the proliferation of cancer cells in G1/S checkpoint [39, 42], unlike their findings, we found that exposure with this agent led to arrest in G1/S and G2/M phases significantly. This may be due to the difference in cell types used in these studies.

Moreover, it has been shown that ReoT3D inhibited proliferation tumor cells by arresting at G1/S and G2/M phases [43, 44], like our observation. As we expected, combination treatment was more useful to inhibit the proliferation of CT26 cells at G0/G1, G2/M, and M checkpoints. This maximum reduction in S phase of combination treatment in comparison with alone treats may be due to synergistic activity between ReoT3D, CPT-11, and BBI608 to strongly arrest the cell cycle progression of murine colorectal cancer cells at G0/G1, G2/M, and M checkpoints. Furthermore, cell cycle analysis of present in vitro setting indicated that the percentage of sub-G1 cells significantly increased in the combination treatment group. As a result, combination therapy using ReoT3D, CPT-11, and BBI608 largely induced apoptosis and confirmed apoptosis analysis because Sub-G1 phase of the cell cycle is a reflector of apoptotic cells with fragmented DNA [45].

Moreover, other applied anticancer experiments showed that migration and colony-forming potency of CT26 cell line was inhibited by monotherapy and these abilities were more suppressed in combination-treated cells. As a final viewpoint, it seems that ReoT3D, CPT-11, and BBI608 had cooperation with together to induce the oncolysis of murine colorectal cancer cells in multiple ways. More focuses are also urgent to better clarifying of these findings.

Conclusion

Although monotherapy with ReoT3D, CPT-11, and BBI608 was effective to induce oncolysis of CT26 cells, maximum anticancer activity was observed in treated culture with combination regime. Collectively, findings of current in vitro assay support the possibility of combination using ReoT3D, CPT-11, and BBI608 as a new regime for treatment of KRAS activated cancer cells. More in vivo and clinical trials investigations are needed to guarantee our achievements.

Authors’ contributions

AB has done all experiments, data collection & analysis and also wrote the original draft of the manuscript. HS has designed the work plan, supervised the whole study and edited the original draft. MS and EA were advisers for the present study that has done bioinformatics works and designed primers for the molecular experiment. All authors read and approved the final manuscript.

Funding information

This work was funded by of Tarbiat Modares University, Faculty of Medical Sciences (grant number: Med-76,015) and partially funded by National Institute for Medical Research Development (NIMAD) (grant number: 957970).

Data availability

Available upon the request.

Code availability

Not applicable.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no competing interests.