Skip to main content
Poultry Science logoLink to Poultry Science
. 2020 Sep 15;99(12):6371–6377. doi: 10.1016/j.psj.2020.09.002

An EAV-HP insertion in the 5ʹ flanking region of SLCO1B3 is associated with its tissue-expression profile in blue-eggshell Yimeng chickens (Gallus gallus)

Jianfei Chen ∗,1, Seyed Benyamin Dalirsefat †,1, Deping Han ‡, Xianggui Dong ∗, Guoying Hua ∗, Xiaotong Zheng ∗, Tianlan Xia ∗, Tianqi Shao ∗, Xuemei Deng ∗,2, Changxin Wu ∗
PMCID: PMC7704947  PMID: 33248552

Abstract

We previously reported that blue eggshell color in chickens is associated with a partial endogenous retroviral (EAV-HP) insertion in the promoter region of the solute carrier organic anion transporter family member 1B3 (SLCO1B3) gene. The EAV-HP sequence includes numerous regulatory elements, which may modulate the expression of adjacent genes. To determine whether this insertion influences the expression of neighboring genes, we screened the expression of solute carrier organic anion transporter family members 1C1, 1B1 (SLCO1C1, SLCO1B1), and SLCO1B3 in 13 and 10 tissues from female and male Yimeng chickens, respectively. We observed that the insertion only significantly modulated the expression of SLCO1B3 and did not majorly affect that of SLCO1C1 and SLCO1B1. High expression of SLCO1B3 was detected in the shell gland, magnum, isthmus, and vagina of the oviduct in female blue-eggshell chickens. We also observed ectopic expression of SLCO1B3 in the testes of male chickens. SLCO1B3 is typically highly expressed in the liver; however, the EAV-HP insertion significantly reduces SLCO1B3 expression. As a liver-specific transporter, a reduction in the expression of SLCO1B3 may affect liver metabolism, particularly that of bile acids. We also detected higher ectopic expression of SLCO1B3 in the lungs of birds heterozygous for the EAV-HP insertion than in homozygous genotypes. In conclusion, we confirmed that the EAV-HP insertion modifies SLCO1B3 expression, and showed, for the first time, similar expression profile of this gene in all parts of the oviduct in females and testis in males. We also observed different levels of SLCO1B3 expression in the liver, which were associated with the EAV-HP insertion, and significantly higher expression in the lungs of birds with heterozygous genotype. The effects of these changes in the SLCO1B3 expression pattern on the function of the tissues warrant further investigation.

Key words: chicken, blue-eggshell, EAV-HP, SLCO1B3, expression profile

Introduction

Avian eggshell color diversity is known to contribute to crypsis, solar radiation filtering, enhanced eggshell strength, and sexual selection (Kilner, 2006; Maurer et al., 2012). The color of the eggshell is determined by the proportion of protoporphyrin IX, biliverdin, and biliverdin zinc chelate (Gorchein et al., 2010). Blue eggshells contain higher levels of biliverdin, whereas brown and pink eggshells contain protoporphyrin IX, and white eggshells contain extremely low amounts or are completely devoid of any pigment (Kennedy and Vevers, 1976; Wang et al., 2007). Blue eggshell color in chickens has been reported as an autosomal dominant trait controlled by the oocyan (O) allele (Punnett, 1933), and some mapping regions and genes associated with the blue-eggshell phenotype have been identified (Bitgood et al., 1980; Wang et al., 2010, 2011; Wragg et al., 2012).

We previously demonstrated that the solute carrier organic anion transporter family member 1B3 (SLCO1B3) gene containing a partial endogenous retroviral (EAV-HP) insertion in the 5ʹ flanking region is strongly associated with blue eggshells in chickens (Wang et al., 2013). Furthermore, the sequence of the causal mutation is similar to that of the env gene of avian leukosis virus subgroup J, which is a type of retrovirus (Smith et al., 1999; Sacco et al., 2000). The occurrence of retroviruses in plant and animal genomes has been extensively studied, and it has been found that partial retroviral fragments can result in high ectopic expression of adjacent genes or abnormal transcription (Matsumine et al., 1991; Chang et al., 2006; Butelli et al., 2012; Zhang et al., 2019). In addition to SLCO1B3, there are 2 other adjacent genes, solute carrier organic anion transporter family members 1C1 (SLCO1C1) and 1B1 (SLCO1B1) (reported as LOC418189), which are located 9 kb upstream and ∼26 kb downstream of the insertion site, respectively. These 3 genes are members of the organic anion transporting polypeptide (OATP, SLCO) family, which are known to transport many endogenous and exogenous substances (Hagenbuch and Meier, 2003; Hagenbuch and Gui, 2008). Solute carrier organic anion transporter family members 1C1, SLCO1B1, and SLCO1B3 are expressed in multiple chicken tissues (Barbosa-Morais et al., 2012; Merkin et al., 2012). Furthermore, SLCO1C1 and SLCO1B1 have been suggested as candidate genes affecting the brownness of eggshells (Chuanwei et al., 2014). Therefore, it is necessary to determine whether the expression of these 2 genes is also regulated by the EAV-HP insertion.

High ectopic expression of SLCO1B3 has been reported in the shell gland of blue-eggshell chickens (Wang et al., 2013). Wragg et al. (2013) noted that the EAV-HP insertion is associated with a high expression of SLCO1B3 in the shell gland and oviduct of the Mapuche fowl, a native blue-eggshell chicken breed; however, the part of the oviduct to which these observations pertain remains unclear. OATP1B3 (encoded by SLCO1B3) is an important transporter involved in the specific transport of various endogenous and exogenous substances in the liver of humans, including CCK-8, bile acids, and some drug molecules (Ismair et al., 2001; Hagenbuch and Gui, 2008; Meyer and Kim, 2009). Considering that SLCO1B3 is expressed primarily in the liver (König et al., 2000), a systematic analysis of the expression profile of SLCO1B3 would be of interest, as this could reveal the systemic function of the EAV-HP insertion in blue-eggshell chickens. Moreover, as male and female chickens harbor the same insertional mutation, it would be of interest to examine the expression profile in both hens and roosters.

In this study, we examined the expression of SLCO1C1, SLCO1B1, and SLCO1B3 in different EAV-HP–insertion genotypes, that is, homozygous dominant insertion (EAV-HP+/+), heterozygous insertion (EAV-HP+/−), and homozygous recessive insertion (EAV-HP−/−), in 13 hen and 10 rooster tissues. The findings of this study are expected to improve our understanding of the effects of the EAV-HP insertional mutation on SLCO1B3 function and the associated changes in blue-eggshell chickens.

Materials and methods

Study Animals

Yimeng chickens, obtained from the Shandong Longsheng Agriculture and Animal Husbandry Group Co., Ltd. (Linyi City, Shandong Province, China) were used in this study. This is a native Chinese chicken breed in which the blue-eggshell trait is not fixed. All chickens were raised in cages under the same environment and ad libitum conditions. All experimental procedures were approved by the Animal Care and Use Committee of the China Agricultural University (Approval no. XK257).

Diagnostic Genotyping Test for the EAV-HP Insertion

The chickens included in the experiments were approximately 300 d old. Blood was collected from a wing vein, which was then used for total genomic DNA extraction using the TIANamp Blood DNA Kit (Tiangen, Dalian, China). The concentration and purity of the extracted DNA were determined by spectrophotometry and agarose gel electrophoresis, respectively. All chickens were genotyped based on the retroviral EAV-HP insertion in SLCO1B3 using a previously reported multiplex PCR method (Wang et al., 2013).

Tissue Sample Collection

Yimeng chickens with different genotypes (EAV-HP+/+, EAV-HP+/−, and EAV-HP−/−) were randomly selected from population 1 (3 males and 3 females for each genotype, i.e., 9 males and 9 females in total) and population 2 (4 EAV-HP+/− hens and 4 EAV-HP−/− hens). The chickens were euthanized by severing the jugular vein after anesthesia. Tissue samples were collected from the heart, liver, spleen, lung, kidney, duodenum, jejunum, ileum, colon, ovary, oviduct (magnum, shell gland, isthmus, and vagina), and testis of birds from one or both populations. Samples of hens were collected ∼3 to 5 h before the next expected oviposition.

Real-Time Quantitative PCR

The total RNA was extracted using the RNAprep Pure Kit (Tiangen). The cDNA was synthesized from 1.5 μg of the extracted total RNA using the FastKing RT Kit (Tiangen). The expression of SLCO1C1, SLCO1B1, and SLCO1B3 genes was quantified by real-time quantitative PCR using SuperReal PreMix Plus (SYBR Green) (Tiangen). Primers for quantitative PCR (Table 1) were designed using Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, CA) and then synthesized (Sangon Biotech, Beijing, China). Data were collected from 3 biological replicates, and each biological replicate further had 3 technical replicates. The cycling conditions were as follows: 95°C for 15 min, followed by 40 cycles of 95°C for 10 s, 58°C (an optimized annealing temperature for each primer pair, Table 1) for 15 s, and 72°C for 24 s. In addition, a mixed sample containing the cDNAs of all sampled tissues from an EAV-HP+/− chicken was analyzed in each cycle for correcting of system errors. The PCR was performed using CFX96 Real-Time System (Bio-Rad, Hercules, CA). Glyceraldehyde-3-phosphate dehydrogenase was selected as the housekeeping gene for normalization of the expression of target genes.

Table 1.

Primers used for real-time quantitative PCR.

Primer names Primer sequence (5'→3′) GenBank number Size (bp) Anneal temperature (°C)
SLCO1B1-F
SLCO1B1-R
TCACATAACTGGAATGGCAA
AACTGTTTTTAGGGGAGGAA
CGNC:50698 158 58
SLCO1B3-F
SLCO1B3-R
TGGTGATTGCATTTGTAAGCTA
TGGAGAGCAGGGATTTATGC
CGNC:50697 197 58
SLCO1C1-F
SLCO1C1-R
TGCTGTTGCTCTCATTGTTT
TAGGTGATGCCATTCTCTCC
CGNC:9932 184 58
GAPDH-F
GAPDH-R
CTCTGTTGTTGACCTGACCT
CAACCTGGTCCTCTGTGTAT
CGNC:49077 125 58∼60

Statistical Analysis

Data were collected and analyzed using Bio-Rad CFX Manager. The cycle threshold (CT) values of the genes were exported to Microsoft Excel. The relative gene expression was determined by the 2−ΔΔCT method described by Schmittgen and Livak (2008). For example, the ΔΔCT for SLCO1B3 was calculated using the following formula:

ΔΔCT = [(CTSLCO1B3−CTGAPDH) sample A−(CTSLCO1B3− CTGAPDH)sample mix]

The sample mix allowed for comparison of the gene expression level of all samples. The relative expression of the other 2 genes was calculated using the same formula. Differences in gene expression among the 3 genotypes were analyzed using Kruskal–Wallis test in R, version 4.0.1, software (https://www.r-project.org) and considered significant at P ≤ 0.05.

Results

Tissue Expression Profile of SLCO1C1 and SLCO1B1 in Female and Male Chickens

Analysis of SLCO1C1 and SLCO1B1 expression patterns in the 13 and 10 tested tissues from female and male chickens, respectively, revealed low expression levels in most of the selected tissues. The expression level of SLCO1C1 was very low, almost undetectable, in the heart, liver, kidney, and duodenum tissues, whereas that of SLCO1B1 was extremely low in most tissues, except the lung, kidney, magnum, shell gland, and vagina. Significantly (P ≤ 0.05) higher expression levels of these 2 genes were observed in the magnum than in other tissues. Although differences were detected in the expression levels of SLCO1B1 between some tissues, including the colon and testis in male chickens, because of the extremely low expression levels, such differences were deemed irrelevant; moreover, this gene exhibited different expression patterns in hens. No significant differences were detected in the expression of SLCO1C1 and SLCO1B1 among the 3 genotypes in any tissue in both male and female chickens (Figures 1 and 2, Supplementary Figures 1 and 2).

Figure 1.

Figure 1

Relative expression of SLCO1C1 in the 13 tested tissues of Yimeng hens with different EAV-HP–insertion genotypes. Error bars indicate the SE (n = 3). Abbreviation: SLCO1C1, solute carrier organic anion transporter family members 1C1.

Figure 2.

Figure 2

Relative expression of SLCO1B1 in the 13 tested tissues of Yimeng hens with different EAV-HP–insertion genotypes. Error bars indicate the SE (n = 3). Abbreviation: SLCO1B1, solute carrier organic anion transporter family members 1B1.

SLCO1B3 Exhibits Higher Ectopic Expression in Reproductive Tissues

Analysis of the relative expression levels of SLCO1B3 in 13 and 10 tissues from female and male chickens, respectively, revealed significant differences in several tissues among the EAV-HP+/+, EAV-HP+/−, and EAV-HP−/− genotypes (Figures 3 and 4). Notably, high ectopic expression of SLCO1B3 was detected along the entire oviduct in blue-eggshell chickens. In EAV-HP+/+ and EAV-HP+/− hens, SLCO1B3 was significantly overexpressed in the magnum, shell gland, and vagina of the oviduct, exhibiting 800- to 6,000-fold higher expression than that in EAV-HP−/− hens. Furthermore, in EAV-HP+/+ hens, the expression levels of SLCO1B3 were similar in different parts of the oviduct, whereas in EAV-HP+/− hens, the expression levels of SLCO1B3 in the magnum were approximately 1/5-fold compared with those in the other 2 parts of the oviduct. In addition, the expression levels of SLCO1B3 were 2-fold higher in the shell gland and vagina of EAV-HP+/+ hens than in those of the EAV-HP+/− hens. Analysis of the expression levels of SLCO1B3 in male chickens of different genotypes revealed higher expression in the testes of EAV-HP+/+ and EAV-HP+/− roosters than in EAV-HP−/− roosters. The expression levels of SLCO1B3 in EAV-HP+/+ roosters were approximately 2-fold higher than those in EAV-HP+/− roosters (Figure 4). Moreover, the expression levels of SLCO1B3 in testicular tissues from the different genotypes were similar to those in the entire oviduct of hens, indicating that this gene exhibits higher ectopic expression in the reproductive tissues of both male and female blue-eggshell chickens.

Figure 3.

Figure 3

Relative expression of SLCO1B3 in the 13 tested tissues of Yimeng hens with different EAV-HP–insertion genotypes. Error bars indicate the SE (n = 3). ∗ indicates significant differences (P ≤ 0.05). Abbreviation: SLCO1B3, solute carrier organic anion transporter family member 1B3.

Figure 4.

Figure 4

Relative expression of SLCO1B3 in the 10 tested tissues of Yimeng roosters with different EAV-HP–insertion genotypes. Error bars indicate the SE (n = 3). ∗ indicates significant differences (P ≤ 0.05). Abbreviation: SLCO1B3, solute carrier organic anion transporter family member 1B3.

SLCO1B3 Expression Profile in the Liver and Other Tissues

In addition to the high ectopic expression of SLCO1B3 in the reproductive tissues of blue-eggshell chickens, we observed that SLCO1B3 was specifically expressed in the liver of non–blue-eggshell hens, whereas the expression level was low in other tissues, which is similar to the tissue-expression profile of human SLCO1B3. Moreover, the expression of SLCO1B3 in the liver was inversely related to that in the oviduct and testis in all 3 genotypes, with EAV-HP−/− chickens characterized by a lower expression in the oviduct or testis and a higher expression in the liver than those in EAV-HP+/+ and EAV-HP+/− chickens. Furthermore, although the expression levels of SLCO1B3 were low in the liver of EAV-HP+/+ chickens, they were comparable with those in the oviduct (magnum, shell gland, and vagina) of EAV-HP+/− hens (Figure 3). These observations indicate that the EAV-HP insertion significantly reduces SLCO1B3 expression in the chicken liver.

No differences were detected in the expression of SLCO1B3 in the lung tissues between EAV-HP+/+ and EAV-HP−/− hens; however, SLCO1B3 was significantly overexpressed in male and female EAV-HP+/− chickens (Figures 3 and 4). In addition, the expression of SLCO1B3 in the colon tissues of male chickens was similar to that in the lung tissues for all 3 genotypes, although the expression levels in both these tissues tended to be low. In contrast, no such trend could be detected in the colon tissues of hens.

To confirm the different patterns in the expression of SLCO1B3 in the liver, lung, magnum, and shell gland, samples from population 2 were analyzed. Similar expression patterns of this gene were detected in the liver, lung, magnum, isthmus, and shell gland (Supplementary Figure 3), and the EAV-HP insertion promoted the ectopic expression of SLCO1B3 in the lung, magnum, isthmus, and shell gland in all individuals from population 2.

Discussion

In blue-shelled chickens, genes near the EAV-HP–insertion region include SLCO1C1, SLCO1B3, and SLCO1B1, which are all members of the OATP family of membrane transporters. Of these, SLCO1C1 is known to play a prominent role in the transport of molecules, including thyroid hormones, which is a well-documented function of this gene in humans (Pizzagalli et al., 2002; Sugiyama et al., 2003). To date, no functional analyses of SLCO1B1 have been conducted in poultry. Wang et al. (2013) did not report SLCO1C1 expression in the shell glands of either blue- or brown-shelled hens. In contrast, Wragg et al. (2013) reported the expression of this gene in the liver; however, no such observation could be made in the present study, which may be attributed to the differences in the chicken breeds and primers used. We further detected low expression levels of SLCO1C1 and SLCO1B1 in most of the tissues examined, which was consistent with previous results of transcriptome analysis of chicken tissues (Barbosa-Morais et al., 2012; Merkin et al., 2012). However, higher expression levels were observed in the magnum of the oviduct than in other tissues. As OATPs, SLCO1C1 and SLCO1B1 are expected to play certain roles in the oviduct tissues; however, apart from their lower expression levels in the male colon and testes, no significant differences could be detected among the different genotypes, indicating that the EAV-HP insertion does not significantly affect their expression.

We focused on the expression profile of SLCO1B3, as it determines the blue-eggshell phenotype in chickens and is also an important liver transport gene. In comparison with EAV-HP−/− hens, SLCO1B3 was significantly overexpressed in the shell gland, which is the site for pigment incorporation into the eggshell during egg formation, of EAV-HP+/+ and EAV-HP+/− hens. Furthermore, the expression levels of SLCO1B3 in the shell gland were approximately 2-fold higher in homozygous individuals than in heterozygous individuals. These observations are consistent with the findings of Wang et al. (2013), who showed that SLCO1B3 is expressed exclusively in the shell gland of blue-eggshell chickens.

Furthermore, we found that the EAV-HP insertion altered the expression of SLCO1B3 not only in the shell gland but also in the liver, lung, testis, and the entire oviduct, including the magnum, isthmus, and vagina. In hens, the different parts of the oviduct play distinct roles during egg formation: the magnum is primarily associated with the formation of egg white, and the isthmus and shell gland are associated with the formation of the eggshell membrane and eggshell itself, respectively. Although the production of blue-shelled eggs has been confirmed to be associated with high ectopic expression of SLCO1B3 in the shell gland, the roles played by the other parts of the oviduct (the magnum, isthmus, and vagina) remain to be determined. As no evidence indicating the origin of the biliverdin content of blue eggshells is available, it can be conjectured that this compound may be derived from the shell gland, either directly or indirectly via accumulation from other sites of biliverdin production, such as the blood or other parts of the oviduct. Furthermore, SLCO1B3 exhibited higher expression in the testes of blue-eggshell chickens. The high expression of this gene in both male and female reproductive organs indicated that there may be specific hormone-related signals in the EAV-HP sequence. This inference is consistent with the function of the U3 region transcription factor predicted by Wragg et al. (2013). It would thus be informative to determine whether the ectopic expression of SLCO1B3 in the testis has any prominent effect on male reproduction.

Considering the limited number of studies on chicken OATP1B3, we attempted to interpret its function based on its role in humans. OATP1B3 is an important transport protein in the basolateral hepatocyte membrane (König et al., 2000), transporting various substrates to the liver for metabolism, thereby eliminating xenobiotics, such as bile acids. In our literature search, we found multiple studies showing that jaundice and hyperbilirubinemia in humans are associated with mutations in SLCO1B3 (Serena et al., 2009; Keppler, 2014). Moreover, certain forms of cancer have been shown to be linked to an abnormal transcript of this gene, which results in the deletion of the first 28 amino acids in the encoded protein (Serena et al., 2009; Keppler, 2014). In the present study, we observed that the EAV-HP insertion is associated with a significant reduction in the expression of SLCO1B3 in the liver. In this context, human SLCO1B3 is activated by the farnesoid X receptor (FXR), hepatocyte nuclear factor 1-alpha (HNF1α), and hepatocyte nuclear factor 3-beta, in the promoter region located within 120 bp of the 5ʹ flanking region (Jung et al., 2001, 2002; Ohtsuka et al., 2006). Consistently, we predicted the potential binding elements in chicken SLCO1B3 for FXR, HNF1α, and hepatocyte nuclear factor 3-beta (Supplementary Figure 4), namely, an inverted hexanucleotide repeat motif element that can be activated by the bile acid and an HNF1α site near the inverted hexanucleotide repeat motif element. We believe that insertion of the large EAV-HP fragment separates the original transcriptional elements of SLCO1B3, such that activation of SLCO1B3 expression is disrupted, to a certain extent, by the large distance between the promoter and transcription start site. However, SLCO1B3 was found to have retained a moderate expression level in the liver tissues, which may be attributed to the function of the long terminal repeat region. However, the possibility that the original transcription start site remains functionally active, albeit with reduced transcriptional efficiency owing to the EAV-HP insertion, should not be excluded. A marked decrease in the expression levels of SLCO1B3 in the liver may predictably perturb the transport and metabolism of certain endogenous and exogenous substances, some of which, including bile acids, serve as ligands for nuclear receptors, such as FXR and retinoid X receptor, of which the former plays a key role in the metabolism of bile acids and fatty acids (Makishima et al., 1999; Shen et al., 2011). We speculate that a significant decrease in the expression of SLCO1B3 in chicken liver may adversely affect lipid metabolism, which requires further investigation.

Interestingly, we detected unexpectedly high expression levels of SLCO1B3 in the lung tissues of EAV-HP+/− chickens, whereas such high expression levels were not detected in male and female EAV-HP+/+ chickens. To the best of our knowledge, this is the first study demonstrating the expression of SLCO1B3 in the lungs of chickens, further suggesting a heterozygous expression advantage. In this context, we initially suspected that the EAV-HP insertion may stimulate the expression of SLCO1B3 in the lung tissues; however, considering that the expression of this gene in EAV-HP+/+ individuals was virtually the same as that in EAV-HP−/− individuals, a more thorough study of the chicken EAV-HP activation region, including the identification of transcription factors that bind to the EAV-HP sequence, is required.

In conclusion, we observed an alteration in the expression patterns of SLCO1B3, an important membrane transport protein-coding gene, due to the retroviral EAV-HP insertion in different genotypes and sexes of blue-eggshell Yimeng chickens. The high ectopic expression of SLCO1B3 detected in the entire oviduct of hens and testes of roosters reflects similar regulation of gene expression in both these reproductive tissues. However, we observed that the expression of SLCO1B3 in the liver was inversely related to that in the reproductive tissues in both male and female chickens. The effects of these contrasting patterns of the expression of SLCO1B3 in the liver and reproductive tissues of blue-eggshell Yimeng chickens require further study. Nevertheless, our findings contribute significantly to our current knowledge on the role of EAV-HP transcriptional regulatory elements in the regulation of gene expression. The expression profile of SLCO1B3 will provide a valuable basis for further investigating the associated transcription factors.

Acknowledgments

This study was supported by the National High Technology Research and Development Program of China (2013AA102501), the Agriculture Research System of China (CARS-40), and the Natural Science Foundation of China (31072024). The authors thank breed conservation farm and the contact Junjiang Long in Shandong Longsheng Agriculture and Animal Husbandry Group Co., Ltd.

Conflict of Interest Statement: We declare no competing financial interests.

Footnotes

Supplementary data associated with this article can be found in the online version at https://doi.org/10.1016/j.psj.2020.09.002.

Supplementary data

Supplementary Figure 1.

Supplementary Figure 1

Relative expression of SLCO1C1 in the 10 tested tissues of Yimeng roosters with different EAV-HP–insertion genotypes. Error bars indicate the standard error (n = 3). Abbreviation: SLCO1C1, solute carrier organic anion transporter family members 1C1.

Supplementary Figure 2.

Supplementary Figure 2

Relative expression of SLCO1B1 in the 10 tested tissues of Yimeng roosters with different EAV-HP–insertion genotypes. Error bars indicate the standard error (n = 3). ∗ indicates significant differences (P ≤ 0.05). Abbreviation: SLCO1B1, solute carrier organic anion transporter family members 1B1.

Supplementary Figure 3.

Supplementary Figure 3

Relative expression of SLCO1B3 in the 5 tested tissues of Yimeng hens with different EAV-HP–insertion genotypes (population 2). Error bars indicate the standard error (n = 4). ∗ indicates significant differences (P ≤ 0.05). Abbreviation: SLCO1B3, solute carrier organic anion transporter family member 1B3.

Supplementary Figure 4.

Supplementary Figure 4

Predicted transcription factor binding site of the SLCO1B3 5ʹ flanking region in Yimeng chickens. Abbreviation: SLCO1B3, solute carrier organic anion transporter family member 1B3.

References

  1. Barbosa-Morais N.L., Irimia M., Pan Q., Xiong H.Y., Gueroussov S., Lee L.J., Slobodeniuc V., Kutter C., Watt S., Colak R., Kim T., Misquitta-Ali C.M., Wilson M.D., Kim P.M., Odom D.T., Frey B.J., Blencowe B.J. The evolutionary landscape of alternative splicing in vertebrate species. Science. 2012;338:1587–1593. doi: 10.1126/science.1230612. [DOI] [PubMed] [Google Scholar]
  2. Bitgood J.J., Shoffner R.N., Otis J.S., Briles W.E. Mapping of the genes for pea comb, blue egg, barring, silver, and blood groups A, E, H, and P in the domestic fowl. Poult. Sci. 1980;59:1686–1693. doi: 10.3382/ps.0591686. [DOI] [PubMed] [Google Scholar]
  3. Butelli E., Licciardello C., Zhang Y., Liu J., Mackay S., Bailey P., Reforgiato-Recupero G., Martin C. Retrotransposons control fruit-specific, cold-dependent accumulation of anthocyanins in blood oranges. Plant Cell. 2012;24:1242–1255. doi: 10.1105/tpc.111.095232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chang C., Coville J., Coquerelle G., Gourichon D., Oulmouden A., Tixier-Boichard M. Complete association between a retroviral insertion in the tyrosinase gene and the recessive white mutation in chickens. BMC Genomics. 2006;7:19. doi: 10.1186/1471-2164-7-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chuanwei Z., Zesheng L., Ning Y., Zhonghua N. Quantitative expression of candidate genes affecting eggshell color. Anim. Sci. J. 2014;85:506–510. doi: 10.1111/asj.12182. [DOI] [PubMed] [Google Scholar]
  6. Gorchein A., Lim C.K., Cassey P. Extraction and analysis of colourful eggshell pigments using HPLC and HPLC/electrospray ionization tandem mass spectrometry. Biomed. Chromatogr. 2010;23:602–606. doi: 10.1002/bmc.1158. [DOI] [PubMed] [Google Scholar]
  7. Hagenbuch B., Gui C. Xenobiotic transporters of the human organic anion transporting polypeptides (OATP) family. Xenobiotica. 2008;38:778–801. doi: 10.1080/00498250801986951. [DOI] [PubMed] [Google Scholar]
  8. Hagenbuch B., Meier P.J. The superfamily of organic anion transporting polypeptides. Biochim. Biophys. Acta. 2003;1609:1–18. doi: 10.1016/s0005-2736(02)00633-8. [DOI] [PubMed] [Google Scholar]
  9. Ismair M.G., Stieger B., Cattori V., Hagenbuch B., Fried M., Meier P.J., Kullak-Ublick G.A. Hepatic uptake of cholecystokinin octapeptide by organic anion-transporting polypeptides OATP4 and OATP8 of rat and human liver. Gastroenterology. 2001;121:1185–1190. doi: 10.1053/gast.2001.28704. [DOI] [PubMed] [Google Scholar]
  10. Jung D., Hagenbuch B., Gresh L., Pontoglio M., Meier P.J., Kullak-Ublick G.A. Characterization of the human OATP-C (SLC21A6) gene promoter and regulation of liver-specific OATP genes by hepatocyte nuclear factor 1 alpha. J. Biol. Chem. 2001;276:37206–37214. doi: 10.1074/jbc.M103988200. [DOI] [PubMed] [Google Scholar]
  11. Jung D., Podvinec M., Meyer U.A., Mangelsdorf D.J., Fried M., Meier P.J., Kullak-Ublick G.A. Human organic anion transporting polypeptide 8 promoter is transactivated by the farnesoid X receptor/bile acid receptor. Gastroenterology. 2002;122:1954–1966. doi: 10.1053/gast.2002.33583. [DOI] [PubMed] [Google Scholar]
  12. Kennedy G.Y., Vevers H.G. A survey of avian eggshell pigments. Comp. Biochem. Physiol. B. 1976;55:117–123. doi: 10.1016/0305-0491(76)90183-8. [DOI] [PubMed] [Google Scholar]
  13. Keppler D. The roles of MRP2, MRP3, OATP1B1, and OATP1B3 in conjugated hyperbilirubinemia. Drug Metab. Dispos. 2014;42:561–565. doi: 10.1124/dmd.113.055772. [DOI] [PubMed] [Google Scholar]
  14. Kilner R.M. The evolution of egg colour and patterning in birds. Biol. Rev. Camb. Philos. Soc. 2006;81:383–406. doi: 10.1017/S1464793106007044. [DOI] [PubMed] [Google Scholar]
  15. König J., Cui Y., Nies A.T., Keppler D. A novel human organic anion transporting polypeptide localized to the basolateral hepatocyte membrane. Am. J. Physiol. Gastrointest. Liver Physiol. 2000;278:G156–G164. doi: 10.1152/ajpgi.2000.278.1.G156. [DOI] [PubMed] [Google Scholar]
  16. Makishima M., Okamoto A.Y., Repa J.J., Tu H., Learned R.M., Luk A., Hull M.V., Lustig K.D., Mangelsdorf D.J., Shan B. Identification of a nuclear receptor for bile acids. Science. 1999;284:1362–1365. doi: 10.1126/science.284.5418.1362. [DOI] [PubMed] [Google Scholar]
  17. Matsumine H., Herbst M.A., Ou S.H., Wilson J.D., McPhaul M.J. Aromatase mRNA in the extragonadal tissues of chickens with the henny-feathering trait is derived from a distinctive promoter structure that contains a segment of a retroviral long terminal repeat. Functional organization of the Sebright, Leghorn, and Campine aromatase genes. J. Biol. Chem. 1991;266:19900–19907. [PubMed] [Google Scholar]
  18. Maurer G., Portugal S.J., Cassey P. Review: an embryo's eye view of avian eggshell pigmentation. J. Avian Biol. 2012;42:494–504. [Google Scholar]
  19. Merkin J., Russell C., Chen P., Burge C.B. Evolutionary dynamics of gene and isoform regulation in mammalian tissues. Science. 2012;338:1593–1599. doi: 10.1126/science.1228186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Meyer Z.S.H., Kim R.B. Hepatic OATP1B transporters and nuclear receptors PXR and CAR: interplay, regulation of drug disposition genes, and single nucleotide polymorphisms. Mol. Pharm. 2009;6:1644–1661. doi: 10.1021/mp9000298. [DOI] [PubMed] [Google Scholar]
  21. Ohtsuka H., Abe T., Onogawa T., Kondo N., Sato T., Oshio H., Mizutamari H., Mikkaichi T., Oikawa M., Rikiyama T., Katayose Y., Unno M. Farnesoid X receptor, hepatocyte nuclear factors 1alpha and 3beta are essential for transcriptional activation of the liver-specific organic anion transporter-2 gene. J. Gastroenterol. 2006;41:369–377. doi: 10.1007/s00535-006-1784-3. [DOI] [PubMed] [Google Scholar]
  22. Pizzagalli F., Hagenbuch B., Stieger B., Klenk U., Folkers G., Meier P.J. Identification of a novel human organic anion transporting polypeptide as a high affinity thyroxine transporter. Mol. Endocrinol. 2002;16:2283–2296. doi: 10.1210/me.2001-0309. [DOI] [PubMed] [Google Scholar]
  23. Punnett R.C. Genetic studies in poultry. IX. The blue egg. J. Genet. 1933;27:465–470. [Google Scholar]
  24. Sacco M.A., F. D. M.J., Howes K., Venugopal K. Avian endogenous retrovirus EAV-HP shares regions of identity with avian leukosis virus subgroup J and the avian retrotransposon ART-CH. J. Virol. 2000;74:1296–1306. doi: 10.1128/jvi.74.3.1296-1306.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Schmittgen T.D., Livak K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008;3:1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]
  26. Serena S., Fabio B., Andrea M., Mcardle P.F., Gianluca U., Mariano D., Sandra L., Antonella M., Maria Grazia P., Lucia P. Common variants in the SLCO1B3 locus are associated with bilirubin levels and unconjugated hyperbilirubinemia. Hum. Mol. Genet. 2009;18:2711–2718. doi: 10.1093/hmg/ddp203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Shen L., Liu H., Peng J., Gan L., Lu L., Zhang Q., Li L., He F., Jiang Y. Effects of farnesoid X receptor on the expression of the fatty acid synthetase and hepatic lipase. Mol. Biol. Rep. 2011;38:553–559. doi: 10.1007/s11033-010-0140-0. [DOI] [PubMed] [Google Scholar]
  28. Smith L.M., Toye A.A., Howes K., Bumstead N., Payne L.N., Venugopal K. Novel endogenous retroviral sequences in the chicken genome closely related to HPRS-103 (subgroup J) avian leukosis virus. J. Gen. Virol. 1999;80:261–268. doi: 10.1099/0022-1317-80-1-261. [DOI] [PubMed] [Google Scholar]
  29. Sugiyama D., Kusuhara H., Taniguchi H., Ishikawa S., Nozaki Y., Aburatani H., Sugiyama Y. Functional characterization of rat brain-specific organic anion transporter (Oatp14) at the blood-brain barrier: high affinity transporter for thyroxine. J. Biol. Chem. 2003;278:43489–43495. doi: 10.1074/jbc.M306933200. [DOI] [PubMed] [Google Scholar]
  30. Wang X.T., Bai J.R., Zhao C.J., Zhang H., Bao H.G., Xu G.Y., Li J.Y., Lian L.S., Wu C.X., Deng X.M. Localisation of the genomic sequence interval for the blue eggshell gene using an F2 resource population of Dongxiang chickens. Br. Poult. Sci. 2010;51:507–509. doi: 10.1080/00071668.2010.502520. [DOI] [PubMed] [Google Scholar]
  31. Wang X.T., Deng X.M., Zhao C.J., Li J.Y., Xu G.Y., Lian L.S., Wu C.X. Study of the deposition process of eggshell pigments using an improved dissolution method. Poult. Sci. 2007;86:2236–2238. doi: 10.1093/ps/86.10.2236. [DOI] [PubMed] [Google Scholar]
  32. Wang Z.P., Liu R.F., Wang A.R., Li J.Y., Deng X.M. Expression and activity analysis reveal that heme oxygenase (decycling) 1 is associated with blue egg formation. Poult. Sci. 2011;90:836–841. doi: 10.3382/ps.2010-01143. [DOI] [PubMed] [Google Scholar]
  33. Wang Z., Qu L., Yao J., Yang X., Li G., Zhang Y., Li J., Wang X., Bai J., Xu G., Deng X., Yang N., Wu C. An EAV-HP insertion in 5' flanking region of SLCO1B3 causes blue eggshell in the chicken. PLoS Genet. 2013;9:e1003183. doi: 10.1371/journal.pgen.1003183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Wragg D., Mwacharo J.M., Alcalde J.A., Wang C., Han J.L., Gongora J., Gourichon D., Tixier-Boichard M., Hanotte O. Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche Fowl. PLoS One. 2013;8:e71393. doi: 10.1371/journal.pone.0071393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Wragg D., Mwacharo J.M., Alcalde J.A., Hocking P.M., Hanotte O. Analysis of genome-wide structure, diversity and fine mapping of Mendelian traits in traditional and village chickens. Heredity. 2012;109:6–18. doi: 10.1038/hdy.2012.9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zhang L., Hu J., Han X., Li J., Gao Y., Richards C.M., Zhang C., Tian Y., Liu G., Gul H., Wang D., Tian Y., Yang C., Meng M., Yuan G., Kang G., Wu Y., Wang K., Zhang H., Wang D., Cong P. A high-quality apple genome assembly reveals the association of a retrotransposon and red fruit colour. Nat. Commun. 2019;10:1494. doi: 10.1038/s41467-019-09518-x. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES