Skip to main content
Poultry Science logoLink to Poultry Science
. 2020 Oct 8;99(12):7046–7054. doi: 10.1016/j.psj.2020.09.071

Characterization of integrons and antimicrobial resistance in Salmonella from broilers in Shandong, China

Xiaonan Zhao ∗, Ming Hu ∗, Qing Zhang ∗, Cui Zhao †, Yin Zhang ∗, Lulu Li ∗, Jing Qi ∗, Yanbo Luo ∗, Dong Zhou ‡, Yuqing Liu ∗,1
PMCID: PMC7705031  PMID: 33248621

Abstract

Salmonella spp. are one of the most important foodborne bacterial pathogens in human beings and animals. This study aimed to analyze the prevalence and characterization of Salmonella from broilers in Shandong, China. A total of 67 Salmonella were recovered from 600 rectal swabs collected from 3 large-scale intensive broiler farms (67/600, 11.2%) between May and October 2018. Among Salmonella isolates, the most common serovars were S. enteritidis and S. typhimurium. The highest occurrence of resistance observed was for polymyxin (100%), followed by ampicillin (68.7%). The multidrug-resistant Salmonella isolation rate was observed to be 53.7%. Four β-lactamase genes were detected among the isolates, and all the isolates carried blaTEM (67/67, 100%), followed by blaOXA (19/67, 28.4%), blaCTX-M (17/67, 25.4%), and blaPSE (7/67, 10.4%). Four plasmid-mediated quinolone resistance gene were detected among the isolates; the prevalent resistance genes was aac(6′)-Ib-cr (18/67, 26.9%), followed by oqxB (9/67, 13.4%), qnrB (6/67, 9.0%), and qnrD (1/67, 1.5%). The prevalent rate of mcr-1 was 6.0% (4/67). Class 1 integrons were detected in 26.9% of these isolates and contained 7 groups of resistance gene cassettes. Multilocus sequence typing analysis revealed 7 sequence types, and ST11 was the most frequent sequence types. This study indicated that reduction of Salmonella and strict control on the use of antibiotics in more than 5,000 million broilers in Shandong are the vitally important measures to keep public health.

Key words: Salmonella, broiler, antimicrobial susceptibility, class 1 integron, MLST

Background

Salmonella is a notorious human pathogen that can lead to an estimated 153 million enteric infections and 56,969 diarrheal deaths each year worldwide (Kirk et al., 2015). In China, a study based on the literature review estimated that the incidence of nontyphoidal salmonellosis was 626.6 cases per 100,000 persons (Yue et al., 2020). It has been widely reported that most of human salmonellosis is caused by infection derived from contaminated eggs, poultry meat, and meat products (Omwandho and Kubota, 2010; Kirk et al., 2015; Gonçalves-Tenório et al., 2018). Previous studies have reported the consistency relationship between Salmonella causing human diseases and those isolated at farms or food products (Pan et al., 2019; Paudyal et al., 2019).

Serovar determination is extremely important for epidemiological surveillance and disease assessment because different serovars may have different host ranges or cause different diseases. To date, more than 2,600 Salmonella serovars have been reported (Achtman et al., 2012). Poultry, especially broilers, are well-known reservoirs of various Salmonella serovars, most of which are able to infect humans (Nógrády et al., 2012).

Antimicrobial resistance is increasingly becoming an important issue with salmonellosis infections in both animals and humans (Duc et al., 2019). In animal husbandry, antibiotics are widely used for growth promotion or treatment purposes which facilitated the emergence and dissemination of antibiotic resistance in Salmonella (Thomas et al., 2020). Currently, the increasing prevalence of multidrug resistance (MDR) in Salmonella to clinically important antimicrobial agents such as fluoroquinolones and β-lactams has been an emerging problem in China (Xu et al., 2019). This phenomenon of multiple resistance represents a worldwide problem for both veterinary and public health sectors. Salmonella can acquire resistance genes through mobile elements such as integrons, which contributes to the spread and distribution of antibiotic resistance genes across diverse bacterial populations (Blair et al., 2015). The chicken can be used as a vehicle for spreading and distributing these antimicrobial-resistant strains to humans (Gong et al., 2016).

Research on the prevalence and antimicrobial resistance of Salmonella isolated from broilers is important for determining the specific distribution patterns of antimicrobial resistance for this pathogen and developing effective treatment strategies to control and prevent Salmonella infections in humans and animals. Routine monitoring of antimicrobial-resistant Salmonella is undertaken in most developed countries and is an integral part of health risk assessment programs (WHO, 2014). To date, numerous studies reported the prevalence and characterization of Salmonella from broilers, the contamination of Salmonella was 6.5 to 38.5% in broilers, and the major serotypes were Salmonella infantis and enteritidis (Kumar et al., 2019; İncili et al., 2019; Firouzabadi et al., 2020; Yang et al., 2020). In China, broilers are widely reared and is an important sources of chicken meat (Yue et al., 2020). Therefore, it is necessary to monitor Salmonella in broilers every year. The purpose of this study was to determine the prevalence and characteristics of Salmonella isolated from broilers in Shandong province, China. It will help to define guidelines for improving salmonellosis control which in turn might lead to fewer human foodborne salmonellosis cases.

Methods

Sampling

From May to October 2018, 3 large-scale intensive broiler farms in Tai'an, Jinan, and Weifang areas of Shandong province were selected as sampling points (Figure 1). During sampling time, all broilers in each farm were well. The broiler flocks had the capacity ranging from 150,000 to 200,000 birds at the average age of 25 d. All the commercial farms used cage farming. We selected 5 broiler houses for each farm, and 20 rectal swabs from different individual animals were collected from each broiler houses. All the sampling sites were visited only once. To prevent cross-contamination, gloves were worn during sampling and changed after each sample. A total of 600 rectal swab samples (200 per farm) were collected and transported under aseptic conditions and cold chain to our laboratory for bacterial isolation and identification (Table 1).

Figure 1.

Figure 1

Map of sampling locations. The 3 regions are the main broiler-producing areas in Shandong.

Table 1.

Prevalence of Salmonella isolates from broilers in Shandong province.

Locations No. of samples No. of positive samples (%)
Tai'an 200 35 (17.5%)
Jinan 200 15 (7.5%)
Weifang 200 17 (8.5%)
Total 600 67 (11.2%)

Salmonella Isolation and Serotype Identification

Salmonella isolation was conducted using previously published protocols (Yan et al., 2010), with some modification. Briefly, each swab sample was mixed with 9 mL of buffered peptone water (Hopebiol, Qingdao, China) and incubated at 37°C for 16 to 18 h for preenrichment. After incubation, 1-mL aliquots of buffered peptone water suspensions were inoculated in 10-mL volumes of selenite cysteine broth (Hopebiol, Qingdao, China) at 42°C and 10-mL volumes of tetrathionate brilliant green broth (Hopebiol, Qingdao, China) at 37°C for 24 h, respectively. Loopful of selenite cysteine broth and tetrathionate brilliant green broth cultures were then streaked onto xylose lysine tergitol 4 agar plates (Hopebiol, Qingdao, China), which were incubated at 37°C for 24 to 48 h. A single isolated colony was picked from the plates, based on typical Salmonella colony characteristics for microscopical examination, and further confirmed using the API 20E system (Sysmex bioMerieux, Tokyo, Japan).

For all confirmed Salmonella isolates, their serovars were determined according to the Kauffmann-White scheme by slide agglutination with O and H antigens (Tianrun Bio-Pharmaceutical, Ningbo, China) following the manufacturer's instructions.

Antimicrobial Susceptibility Testing

The antimicrobial susceptibility of all the Salmonella isolates was assessed by the Kirby-Bauer disc diffusion method on Mueller-Hinton agar plates according to the Clinical and Laboratory Standard Institute (CLSI, 2019) guidelines. Isolates were tested for sensitivity to amoxicillin/clavulanic acid (AC), ampicillin (AMP), ceftiofur (CEF), enrofloxacin (ENR), neomycin (NEO), doxycycline (DOX), florfenicol (FLO), gentamicin, and polymyxin (PB), which were commonly used in farms. An isolate was defined as MDR isolate if it was resistant to no less than 3 classes of antimicrobials. The Escherichia coli ATCC 25922 was used as a quality control and was purchased from Beina Biotechnology Co., Ltd (Beijing, China).

Detection of Antimicrobial Resistance Genes

The DNA for all experiments was extracted by the TIANamp Bacteria DNA Kit (Tiangen, Beijing, China) according to the manufacturer's instructions, and DNA templates were stored at −20°C until used. PCR screening for extended-spectrum β-lactamase genes (blaTEM, blaCTX-M, blaOXA, blaSHV and blaPSE), plasmid-mediated quinolone resistance genes (aac(6′)-Ib-cr, qnrA, qnrB, qnrC, qnrD, qepA, oqxA and oqxB), and PB resistance gene (mcr-1) was performed using previously reported primers (Table 2) (Ahmed et al., 2013; Li et al., 2013; Liu et al., 2016). The amplification consisted of an initial denaturation at 94°C for 10 min, followed by 32 cycles of 94°C for 30 s, 50°C to 64°C (depending on the primer) for 30 s, and 72°C for 15 s, and final extension at 72°C for 10 min. Amplified products were identified by their molecular weights after electrophoresis on 1.0% agarose gel at 180 V for 90 min and staining with ethidium bromide. The PCR products were sequenced (Sangon Shanghai, China), and the sequences were analyzed and aligned using the NCBI Basic Local Alignment Search Tool program (http://blast.ncbi.nlm.nih.gov/).

Table 2.

PCR primers and annealing temperatures in this study.

Gene Oligonucleotide sequence (5’→ 3′) Annealing temperature (°C) Reference
blaTEM F: ATTCTTGAAGACGAAAGGGC 60 Li et al., 2013
R: ACGCTCAGTGGAACGAAAAC
blaSHV F: CACTCAAGGATGTATTGTG 60 Li et al., 2013
R: TTAGCGTTGCCAGTGCTCG
blaOXA F: ACACAATACATATCAACTTCGC 60 Li et al., 2013
R: AGTGTGTTTAGAATGGTGATC
blaPSE F: TTT GGT TCCGCG CTA TCT G 58 Li et al., 2013
R: TAC TCC GAG CAC CAA ATC CG
blaCTX-M F: CGCTTTGCGATGTGCAG 60 Li et al., 2013
R: ACCGCGATATCGTTGGT
qnrA F: ATTTCTCACGCCAGGATTTG 60 Ahmed et al., 2013
R: TGCCAGGCACAGATCTTGAC
qnrB F: CGACCTKAGCGGCACTGAAT 50 Ahmed et al., 2013
R: GAGCAACGAYGCCTGGTAGYTG
qnrC F: GGGTTGTACATTTATTGAATC 50 Ahmed et al., 2013
R: TCCACTTTACGAGGTTCT
qnrD F: CGAGATCAATTTACGGGGAATA 50 Ahmed et al., 2013
R: AACAAGCTGAAGCGCCTG
aac(6′)-Ib-cr F: TTGCGATGCTCTATGAGTGGCTA 55 Ahmed et al., 2013
R: CTCGAATGCCTGGCGTGTTT
qepA F: GCAGGTCCAGCAGCGGGTAG 60 Ahmed et al., 2013
R: CTTCCTGCCCGAGTATCGTG
oqxA F: GATCAGTCAGTGGGATAGTTT 55 Ahmed et al., 2013
R: TACTCGGCGTTAACTGATTA
oqxB F: TTCTCCCCCGGCGGGAAGTAC 64 Ahmed et al., 2013
R: CTCGGCCATTTTGGCGCGTA
mcr-1 F: CGGTCAGTCCGTTT 55 Liu et al., 2016
R: CTTGGTCGGTCTGTAGGG

Detection of Class 1 Integrons

All Salmonella isolates were screened for the presence of class 1 integrons based on the primers previously described (Kerrnet et al., 2002). The amplification fragments were purified from the agarose gel using a gel extraction kit (Tiangen, Beijing, China) and subsequently sequenced (Invitrogen, Beijing, China). Gene cassette homology searches were preformed using a Basic Local Alignment Search Tool analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Multilocus Sequence Typing

All Salmonella isolates were characterized by multilocus sequence typing (MLST), which was performed using 7 housekeeping genes (aroC, dnaN, hemD, hisD, purE, sucA, and thrA) as described online (http://mlst.warwick.ac.uk/mlst/dbs/Senterica/documents/primersEnterica_html). All amplification fragments were purified and sequenced (Invitrogen, Beijing, China). The alleles and sequence types (STs) were assigned according to the MLST database (http://mlst.warwick.ac.uk/mlst/dbs/Senterica) criteria.

Results

Prevalence and Serovars of Salmonella

The prevalence of Salmonella in broilers form Shandong is presented in Table 1. Overall, 600 fresh fecal swabs were tested, and 67 (67/600, 11.2%) samples were positive for Salmonella, corresponding to 35/200 (17.5%) samples in Tai'an, 15/200 (7.5%) samples in Jinan, and 17/200 (8.5%) samples in Weifang.

The 67 Salmonella isolates were serotyped into 6 distinct serovars. These serotypes were including Salmonella enteritidis (S. enteritidis), Salmonella typhimurium (S. typhimurium), Salmonella kentucky (S. kentucky), Salmonella indiana (S. indiana), Salmonella pullorum (S. pullorum), and Salmonella senftenberg (S. senftenberg). The most common serovars were S. enteritidis (37/67, 55.2%) and S. typhimurium (18/67, 26.9%). In addition, there were 5 distinct serovars from Tai'an, 4 from Jinan, and 2 from Weifang. S. pullorum was detected only in Jinan, while S. senftenberg and S. kentucky were isolated only from Tai'an (Table 3).

Table 3.

Resistance phenotype, sequence type, incidence of class 1 integron, and resistance genes in Salmonellla isolated from broilers in Shandong province.

Source Strain Sequence type Serovar Antimicrobial resistance Integrons/resistance genes
Tai'an T-1 34 Typhimurium PB blaTEM,blaSPE,blaOXA,acc(6′)-Ib-cr
T-2 11 Enteritidis AC-AMP-DOX-PB blaTEM
T-3 11 Enteritidis AC-AMP-PB blaTEM
T-4 11 Enteritidis AC-AMP-DOX-PB Class 1 (aadA2), blaTEM,blaSPE
T-5 19 Typhimurium CEF-DOX-ENR-PB Class 1 (dfrA1-aadA1), blaTEM,blaSPE
T-6 19 Typhimurium DOX-ENR-PB blaTEM
T-7 11 Enteritidis DOX-ENR-PB blaTEM,blaSPE
T-8 11 Enteritidis ENR-FLO-PB Class1 (aacA4-blaOXA-CatB3-aar-3), blaTEM,blaSPE,blaOXA
T-9 11 Enteritidis PB blaTEM,blaOXA
T-10 11 Enteritidis FLO-PB blaTEM
T-11 14 Senftenberg AC-AMP-CEF-DOX-ENR-FLO-GEN-PB blaTEM,blaCTX-M,blaOXA,acc(6′)-Ib-cr
T-12 17 Indiana AC-AMP-CEF-DOX-ENR-FLO-PB blaTEM,blaCTX-M
T-13 11 Enteritidis ENR-FLO-PB blaTEM,blaOXA,acc(6′)-Ib-cr
T-14 34 Typhimurium PB blaTEM
T-15 14 Senftenberg AC-AMP-CEF-DOX-ENR-GEN-FLO-PB blaTEM,blaCTX-M,blaOXA,acc(6′)-Ib-cr, oqxB
T-16 19 Typhimurium PB blaTEM
T-17 19 Typhimurium PB blaTEM
T-18 198 Kentucky AC-AMP-CEF-DOX-ENR-GEN-FLO-PB Class1 (aadA7), blaTEM,blaCTX-M,blaOXA,acc(6′)-Ib-cr, mcr-1
T-19 11 Enteritidis AC-AMP-PB blaTEM
T-20 19 Typhimurium PB blaTEM
T-21 11 Enteritidis AC-AMP-FLO-PB blaTEM
T-22 11 Enteritidis AC-AMP-CEF-DOX-ENR-FLO-PB blaTEM
T-23 11 Enteritidis CEF-PB blaTEM
T-24 11 Enteritidis AMP-CEF-PB blaTEM,blaOXA
T-25 11 Enteritidis AC-AMP-DOX-PB blaTEM
T-26 11 Enteritidis AMP-CEF-PB blaTEM
T-27 11 Enteritidis AMP-ENR-PB blaTEM
T-28 11 Enteritidis AMP-CEF-PB blaTEM,blaOXA
T-29 19 Typhimurium PB blaTEM
T-30 11 Enteritidis AC-AMP-DOX-PB blaTEM
T-31 19 Typhimurium PB blaTEM
T-32 19 Typhimurium PB blaTEM
T-33 198 Kentucky AC-AMP-CEF-DOX-ENR-FLO-GEN-NEO-PB blaTEM,blaCTX-M,blaOXA,acc(6′)-Ib-cr, qnrB, mcr-1
T-34 198 Kentucky AC-AMP-CEF-DOX-ENR-FLO-GEN-NEO-PB blaTEM,blaCTX-M,blaOXA,acc(6′)-Ib-cr
T-35 198 Kentucky AC-AMP-CEF-DOX-ENR-FLO-NEO-PB blaTEM,blaCTX-M,blaOXA,acc(6′)-Ib-cr, mcr-1
Jinan J-1 19 Typhimurium DOX-ENR-GEN-NEO-PB Class 1 (dfrA17-aadA5), blaTEM
J-2 17 Indiana AC-AMP-DOX-ENR-FLO-NEO-PB Class 1 (aadA2), blaTEM,acc(6′)-Ib-cr
J-3 92 Pullorum AMP-CEF-PB blaTEM
J-4 17 Indiana AC-AMP-DOX-FLO-GEN-NEO-PB Class 1 (aadA2), blaTEM,acc(6′)-Ib-cr, oqxB
J-5 34 Typhimurium AC-AMP-ENR-FLO-GEN-NEO-PB blaTEM,blaOXA,acc(6′)-Ib-cr
J-6 11 Enteritidis AMP-ENR-FLO-GEN-NEO-PB Class1 (aadA2), blaTEM,acc(6′)-Ib-cr, qnrB, oqxB
J-7 92 Pullorum AC-AMP-CEF-DOX-ENR-FLO-NEO-PB blaTEM,blaCTX-M,oqxB
J-8 92 Pullorum AC-AMP-CEF-DOX-ENR-FLO-NEO-PB Class1 (aacA4-blaOXA-CatB3-aar-3), blaTEM,blaCTX-M,qnrB, oqxB
J-9 11 Enteritidis AC-AMP-DOX-ENR-GEN-NEO-PB blaTEM
J-10 19 Typhimurium AMP-PB blaTEM,blaOXA
J-11 19 Typhimurium PB Class1 (aacA4-blaOXA-CatB3-aar-3), blaTEM,blaCTX-M,blaSPE,blaOXA,acc(6′)-Ib-cr, oqxB
J-12 11 Enteritidis AMP-PB Class1 (dfrA17-aadA5), blaTEM,blaCTX-M,oqxB
J-13 19 Typhimurium PB Class1 (aadA22), blaTEM
J-14 19 Typhimurium PB Class1 (dfrA17-aadA5), blaTEM,blaCTX-M,blaOXA,acc(6′)-Ib-cr, qnrB, oqxB
J-15 34 Typhimurium PB blaTEM,blaOXA
Weifang W-1 11 Enteritidis AC-AMP-PB Class1 (dfrA17-aadA5), blaTEM
W-2 11 Enteritidis AC-AMP-PB blaTEM
W-3 11 Enteritidis AC-AMP-PB blaTEM,blaCTX-M
W-4 11 Enteritidis AC-AMP-PB blaTEM
W-5 11 Enteritidis AC-AMP-CEF-NEO-PB blaTEM,blaCTX-M
W-6 11 Enteritidis AC-AMP-CEF-DOX-ENR-FLO-NEO-PB blaTEM,blaCTX-M,blaOXA,acc(6′)-Ib-cr, mcr-1
W-7 19 Typhimurium AC-AMP-CEF-DOX-ENR-FLO-NEO-PB Class1 (aadA5-blaOXA), blaTEM,blaCTX-M,acc(6′)-Ib-cr, qnrD
W-8 11 Enteritidis AMP-CEF-DOX-ENR-FLO-NEO-PB Class1 (aacA4-blaOXA-CatB3-aar-3), blaTEM
W-9 11 Enteritidis AMP-CEF-DOX-ENR-FLO-PB blaTEM,blaCTX-M,qnrB, oqxB
W-10 11 Enteritidis AC-AMP-PB Class1 (dfrA17-aadA5), blaTEM
W-11 11 Enteritidis AC-AMP-PB Class1 (dfrA17-aadA5), blaTEM,blaOXA
W-12 11 Enteritidis AC-AMP-PB blaTEM
W-13 11 Enteritidis AC-AMP-PB blaTEM,blaSPE
W-14 11 Enteritidis AC-AMP-DOX-PB blaTEM
W-15 11 Enteritidis AC-AMP-DOX-ENR-PB blaTEM
W-16 11 Enteritidis AC-AMP-CEF-DOX-ENR-FLO-NEO-PB blaTEM,blaCTX-M,acc(6′)-Ib-cr, qnrB
W-17 11 Enteritidis AC-AMP-CEF-DOX-ENR-FLO-NEO-PB blaTEM,acc(6′)-Ib-cr

Antimicrobial Susceptibility Testing

The results of the antimicrobial susceptibility analysis of 67 Salmonella isolates are presented in Table 3. The highest occurrence of resistance observed was for PB (67/67, 100%), followed by AMP (46/67, 68.7%). In contrast, low level of resistance was found for gentamicin (10/67, 14.9%)and NEO (17/67, 25.4%). In addition, 36 isolates (36/67, 53.7%) exhibited MDR. Of the isolates from Tai'an, the most frequent MDR pattern was AC, AMP, DOX, and PB, which was represented by 4 S. enteritidis isolates; the isolates from Jinan were AC, AMP, CEF, DOX, ENR, FLO, NEO, and PB, which were represented by 2 S. pullorum isolates; the isolates from Weifang was AC, AMP, CEF, DOX, ENR, FLO, NEO, and PB, which was represented by one S. typhimurium isolates and 3 S. enteritidis isolates. The MDR Salmonella serovars were S. enteritidis (20/36, 55.6%), S. typhimurium (5/36, 13.9%), S. kentucky (4/36, 11.1%), S. indiana (3/36, 8.3%), S. pullorum (2/36, 5.6%), and S. senftenberg (2/36, 5.6%).

Detection of Antimicrobial Resistance Genes

PCR analysis for antimicrobial resistance revealed that 4 β-lactamase genes were detected among the isolates, and all the isolates carried blaTEM (67/67, 100%), followed by blaOXA (19/67, 28.4%), blaCTX-M (17/67, 25.4%), and blaPSE (7/67, 10.4%). Four plasmid-mediated quinolone resistance genes were detected among the isolates, and the prevalent resistance gene was aac(6′)-Ib-cr (18/67, 26.9%), followed by oqxB (9/67, 13.4%), qnrB (6/67, 9.0%), and qnrD (1/67, 1.5%). The prevalent rate of mcr-1 was 6.0% (4/67). Of note, blaOXA was commonly found in Salmonella isolates from Tai'an, oqxB was commonly found in Jinan, and blaCTX-M was commonly found in Weifang (Table 3).

Detection of Class 1 Integrons

The overall occurrence of class 1 integrons carrying Salmonella in tested samples was 26.9% (18/67) and contained 7 groups of resistance gene cassettes. The gene cassette dfrA17-aadA5 (6/18, 33.3%) was the most prevalent in class 1 integrons-carrying Salmonella in this study, followed by aadA2 (4/18, 22.2%), aacA4-blaOXA-CatB3-aar-3 (4/18, 22.2%), aadA7 (1/18, 5.6%), aadA22 (1/18, 5.6%), dfrA1-aadA1 (1/18, 5.6%), and aadA5-blaOXA (1/18, 5.6%) (Table 3). aadA7 and dfrA1-aadA1 were found only in Tai'an, aadA22 was found only in Jinan, and aadA5-blaOXA was found only in Weifang.

MLST Analysis

An interlinked data set with partial sequencing of 7 housekeeping genes at 399 bp to 501 bp revealed that all the Salmonella isolates were grouped into 7 STs: ST11, ST14, ST17, ST19, ST34, ST92, and ST198 (Table 3). ST11 was the most common ST in this study both in Tai'an and Weifang and involved with 37 Salmonella isolates. ST19 was the most prevalent ST in Jinan and involved with 5 Salmonella isolates. In addition, most of the isolates with similar STs belonged to the same serovars, such as ST11 with S. enteritidis, ST19 and ST34 with S. typhimurium, and ST17 with S. indiana.

Discussion

The prevalence and distribution of Salmonella constitute a threat to human health and present a major financial burden (Moawad et al., 2017). In the present study, the prevalence of Salmonella was 11.2%, which was similar to that in the previous reports from poultry slaughterhouses in Sichuan province (10.7%) (Li et al., 2013) and Germany (13.2%) but was lower than that reported from poultry slaughterhouses in Shandong province (23.5%) (Zhao et al., 2017a, Zhao et al., 2017b) and Thailand-Cambodia border provinces (35.8%) (Trongjit et al., 2017). Data on the prevalence of Salmonella in different studies were difficult to compare based on differences in regions, sampling procedures, sample sizes, collection seasons, and bacteria isolation and identification methods. In this study, the prevalence of Salmonella in broilers (17.5%) from Tai'an was higher than that in other regions. This may be the main reason for the poor farm management which can result in wide-spreading of Salmonella in farms; farm management was very important. The source of Salmonlla infection to broilers may be the feed, drinking water, and rodents.

In many countries all over the world, a wide range of different Salmonella serotypes have been found to contaminate the broilers (Abdeen et al., 2018). In addition, S. enteritidis was the most common serotype identified in broilers, which was similar to the previous reports from Sichuan and Henan province (Lu et al., 2011; Bai et al., 2015). However, other studies have reported the dominance of other Salmonella serovars: S. indiana in Chicken farms in Shandong, China, and Kagoshima, Japan (Zhao et al., 2017a, Zhao et al., 2017b; Duc et al., 2019), and S. typhimurium in Latvia (Terentjeva et al., 2017). This difference may be associated with geographic variation and the chicken breeds. Of note, high isolation rates of S. typhimurium were also noticed. S. typhimurium remains one of the main serotype that can lead to sever human and animal diseases (Amanda et al., 2020). Therefore, it is necessary to continuously monitor the local serovar variation of Salmonella and formulate a reasonable prevention and control strategy accordingly.

Antibiotic resistance in Salmonella has been a major problem in animal farms especially in broilers. Although relevant departments have been emphasizing the limited use of antibiotics in animal feeding, the effect was small. In this study, all the Salmonella isolates were resistant to PB, which was much higher than that previously reported in Salmonella from food-producing animals (5.2%) at slaughter in Europe (Farid et al., 2018). This high resistant rate of PB in broilers may be attributed to the wide use of this antibiotic in animals during breeding and disease control, and it suggests that farm managers should reduce antibiotic usage. Resistance to AMP (68.7%) was frequently observed in Salmonella isolates, which was higher than that previously reported in Jiangsu province (19.3%) (Cai et al., 2016) and in South Africa (47.0%) (Zishiri et al., 2016). In this study, the MDR Salmonella isolate rate was 53.7% which was lower than that previously reported from Shandong province (80.8%) in 2016 (Zhao et al., 2017a, Zhao et al., 2017b) and similar to the report from pigs in Southern Brazil (Tamang et al., 2015). In addition, S. enteritidis showed a high MDR rate, in contrast with the report that most of S. indiana showed MDR (Zhang et al., 2020). Considering these results, the prudent use of antibacterial agents should be strongly recommended in clinical, veterinary, and agricultural settings to preserve antibiotic activity and avoid the development of cross-resistance.

Production of β-lactamases has been identified as the main plasmid-mediated mechanisms of resistance to third-generation cephalosporins and is currently considered a major concern both in human and veterinary medicine (Rhouma and Letellier, 2017). In this study, all the Salmonella isolates carried blaTEM, which was higher than that in the report from Egypt (41.5%) (Ashraf et al., 2014). Of note, all the Salmonella isolates carried blaTEM, but 68.7% showed phenotypical resistance to AMP, indicating that there existed another resistance mechanism. It has been reported that blaOXA was considered to be the most commonly identified β-lactamase gene in Salmonella isolates from China, and in portugal, blaCTX-M was commonly detected in Salmonella isolates from poultry, swine, and food products of animal origin (Clemente et al., 2013), which was different from our result.

Quinolones are commonly used in veterinary practice worldwide for Salmonella infections (Mehdi et al., 2018). In this study, aac(6′)-Ib-cr, oqxB, qnrB, and qnrD genes were detected in 26.9, 13.4, 9.0, and 1.5%, respectively, in all Salmonella isolates, which was different from the report in Henan province, qnrA, qnrB, qnrS, and aac(6′)-Ib-cr genes were identified in Salmonella strains isolated from retail foods with the incidence of 46.6, 12.7, 19.5, and 13.6%, respectively (Yang et al., 2013). In other study, in Egypt, qnrA, qnrB, and qnrS genes were detected in 33.3, 20.0, and 6.7%, respectively, in all Salmonella isolates from raw chicken and beef meat (Moawad et al., 2017). In addition, most Salmonella isolates containing a quinolone resistance gene displayed resistance to ENR, suggesting the chromosomal quinolone resistance determining region point mutation might be present in these strains and conferring the high-level quinolone resistance.

Colistin is often used to treat food-producing animals and has been considered the last resort antibiotics for the rapidly increasing MDR gram-negative pathogens (Kaye et al., 2016). However, colistin resistance mediated by mcr-1–harboring plasmids is an emerging threat in Enterobacteriaceae, similar to Salmonella (Sun et al., 2018). In this study, the prevalent rate of mcr-1 was 6.0%, which was higher than that in Europe (0.1%). In this study, of all the Salmonella resistance to PB, however, only 6.0% of the isolates carried mcr-1, which was different from the report that there was a close positive correlation between the resistance phenotypes and genotypes of the isolates.

The presence of genetic element such as integrons is often associated with multiresistant phenotypes among Salmonella isolates and plays an important role in the spread of antimicrobial resistance genes among gram-negative bacteria (Marathe et al., 2019). In this study, class 1 integron detected in 26.9% of Salmonella isolates, which was higher than that previously study from raw chicken and beef meat in Egypt (13.3%) (Moawad et al., 2017) and from poultry in Korea (9.1%) (Dessie et al., 2013) but lower than a report from meat and dairy products in Egypt (39.1%) (Ashraf et al., 2014). The predominant gene cassette was dfrA17-aadA5, which confers resistance to trimethoprim (dfrA) and spectinomycin (aadA) and has been reported worldwide in isolates from different origins; it might be associated with the extensive use of trimethoprim and spectinomycin in broiler breeding. In addition, 61.1% class 1 integron was detected in MDR Salmonella isolates, which was different from the report that all the class 1 integron exhibited resistance to at least 3 classes of antimicrobials (Firoozeh et al., 2012; Wang et al., 2020).

MLST results showed that 7 STs were generated from all Salmonella isolates belonging to 6 serotypes. ST11 was the most frequent genotype that was recovered in this study, and this ST corresponded to S. enteritidis, which coincides with our previous report from chickens in Shandong (Zhao et al., 2017a, Zhao et al., 2017b). ST19 and ST34 corresponded to S. typhimurium, which have continually been reported to cause human salmonellosis in recent years (Garvey et al., 2013). Another case that should be considered is ST92, a rarely reported ST which appeared in Shandong province that corresponds to S. pullorum and often reported to cause pullorum disease of chickens in China (Wang et al., 2020). Our results revealed that the MLST patterns were generally associated with serotypes and provided a reliable prediction of the Salmonella serovars (Cai et al., 2016).

Conclusion

In summary, we examined the epidemiology of Salmonella from broilers in Shandong, China. The results showed that the prevalence of Salmonella was found to be high in the broilers. Clinically important serovars S. enteritidis and S. typhimurium dominated the isolates recovered in this study, with almost all other identified serovars also linked to human salmonellosis. In addition, the high rate of MDR Salmonella is alarming which requires the prudent use of antibiotics in broilers. Therefore, continuous surveillance of Salmonella in broilers is essential to detect emerging Salmonella serovar, antimicrobial resistance trends, and associated resistance genes.

Acknowledgments

This work was supported by the National Key Research and Development Project (2019YFA0904004); Shandong Agricultural Major Applied Technology Innovation Program (SD2019XM009); Major National Science and Technology Program (2018ZX10733402-013); Open subject of State Key Laboratory of Infectious Disease Prevention and Control, China (2019SKLID317); and The High-Level Talents and Innovative Team Recruitment Program of the Shandong Academy of Agricultural Sciences, China (CXGC2018E10).

Reference

  1. Abdeen E., Elmonir W., Suelam I.I.A., Mousa W.S. Antibiogram and genetic diversity of Salmonella enterica with zoonotic potential isolated from morbid native chickens and pigeons in Egypt. J. Appl. Microbiol. 2018;124:1265–1273. doi: 10.1111/jam.13697. [DOI] [PubMed] [Google Scholar]
  2. Achtman M., Wain J., Weill F., Nair S., Sangal V., Krauland M.G., Harbittle J.L., Uesbeck A.G., Dougan L., Harrison H., Brisse S. Multilocus sequence typing as a replacement for serotyping in Salmonella enterica. PLoS Pathog. 2012;8:e1002776. doi: 10.1371/journal.ppat.1002776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ahmed A., Shimamoto M.T., Shimamoto T. Molecular characterization of multidrug-resistant avian pathogenic Escherichia coli isolated from septicemic broilers. Int. J. Med. Microbiol. 2013;303:475–483. doi: 10.1016/j.ijmm.2013.06.009. [DOI] [PubMed] [Google Scholar]
  4. Amanda A.S., Marcelo F.C., Vilela F.P., Frazão M.R., Paziani M.H., Almeida F., Medeiros M.I.C., Rodrigues D.D.P., Kress M.R.Z., Allard M.W., Falcão J.P. Phenotypic and genotypic characterization of Salmonella typhimurium isolates from humans and foods in Brazil. PLoS One. 2020;15:e0237886. doi: 10.1371/journal.pone.0237886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Ashraf M.A., Toshi S., Tadashi S. Characterization of integrons and resistance genes in multidrug-resistant Salmonella enterica isolated from meat and dairy products in Egypt. Int. J. Food Microbiol. 2014;189:39–44. doi: 10.1016/j.ijfoodmicro.2014.07.031. [DOI] [PubMed] [Google Scholar]
  6. Bai L., Lan R.T., Zhang X.L., Cui S.H., Xu J., Guo Y.C., Li F.Q., Zhang D. Prevalence of Salmonella isolates from chicken and pig slaughter houses and emergence of ciprofloxacin and cefotaxime co-resistant S. enterica serovar Indiana in Henan, China. PLoS One. 2015;10:e0144532. doi: 10.1371/journal.pone.0144532. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Blair J., Webber M., Baylay A., Ogbolu D., Piddock L. Molecular mechanisms of antibiotic resistance. Nat. Rev. Microbiol. 2015;13:42–51. doi: 10.1038/nrmicro3380. [DOI] [PubMed] [Google Scholar]
  8. Cai Y.Q., Tao J., Jiao Y., Fei X., Zhou L., Wang Y., Zheng H.J., Pan Z.M., Jiao X.A. Phenotypic characteristics and genotypic correlation between Salmonella isolates from a slaughterhouse and retail markets in Yangzhou, China. Int. J. Food Microbiol. 2016;222:56–64. doi: 10.1016/j.ijfoodmicro.2016.01.020. [DOI] [PubMed] [Google Scholar]
  9. Clemente L., Manageiro V., Ferreira E., Jones-Dias D., Correia I., Themudo P., Albuquerque T., Canica M. Occurrence of extended-spectrum β-lactamases among isolates of Salmonella enterica subsp. enterica from food-producing animals and food products, in Portugal. Int. J. Food Microbiol. 2013;167:221–228. doi: 10.1016/j.ijfoodmicro.2013.08.009. [DOI] [PubMed] [Google Scholar]
  10. Clinical and Laboratory Standards Institute . CLSI; Wayne, PA: 2019. Performance Standards for Antimicrobial Susceptibility Testing. 29th Informational Supplement, M100-S29. [Google Scholar]
  11. Dessie H.K., Bae D.H., Lee Y.J. Characterization of integrons and their cassettes in Escherichia coli and Salmonella isolates from poultry in Korea. Poult. Sci. 2013;92:3036–3043. doi: 10.3382/ps.2013-03312. [DOI] [PubMed] [Google Scholar]
  12. Duc V.M., Nakamoto Y., Fujiwara A., Toyofuku H., Obi T., Chuma T. Prevalence of Salmonella in broiler chickens in Kagoshima, Japan in 2009 to 2012 and the relationship between serovars changing and antimicrobial resistance. BMC Vet. Res. 2019;15:108. doi: 10.1186/s12917-019-1836-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Farid E.G., Anno D.J., Xavier B., Didier H., Marlene S. mcr-1-Like detection in commensal Escherichia coli and Salmonella spp. from food-producing animals at slaughter in Europe. Vet. Microbiol. 2018;213:42–46. doi: 10.1016/j.vetmic.2017.11.014. [DOI] [PubMed] [Google Scholar]
  14. Firoozeh F., Zahraei-Salehi T., Shahcheraghi F., Karimi V., Aslani M.M. Characterization of class I integrons among Salmonella enterica serovar Enteritidis isolated from humans and poultry. FEMS Immunol. Med. Microbiol. 2012;64:237–243. doi: 10.1111/j.1574-695X.2011.00883.x. [DOI] [PubMed] [Google Scholar]
  15. Firouzabadi A., Saadati D., Najimi M., Jajarmi M. Prevalence and related factors of Salmonella spp. and Salmonella typhimurium contamination among broiler farms in Kerman Province, Iran. Prev. Vet. Med. 2020;175:104838. doi: 10.1016/j.prevetmed.2019.104838. [DOI] [PubMed] [Google Scholar]
  16. Garvey P., McKeown P., Kelly P., Cormican M., Anderson W., Flack A., Barron S., De Lappe N., Buckley J., Cosgrove C., Molloy D., O’Connor J., Sullivan P., Matthews J., Ward M., Breslin A., O’Sullivan M.B., Kelleher K., McNamara A., Foley-Nolan C., Pelly H., Cloak F. Investigation and management of an outbreak of Salmonella typhimurium DT8 associated with duck eggs, Ireland 2009 to 2011. Eurosurveillance. 2013;18:17–23. [PubMed] [Google Scholar]
  17. Gonçalves-Tenório A., Silva B.N., Rodrigues V., Cadavez V., Gonzales-Barron U. Prevalence of pathogens in poultry meat: a meta-analysis of European published surveys. Foods. 2018;7:69. doi: 10.3390/foods7050069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gong J., Wang C., Shi S., Bao H., Zhu C., Kelly P., Zhuang L., Lu G., Dou X., Wang R., Xu B., Zou J. Highly drug-resistant Salmonella enterica serovar Indiana clinical isolates recovered from broilers and poultry workers with diarrhea in China. Antimicrob. Agents Chemother. 2016;60:1943–1947. doi: 10.1128/AAC.03009-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. İncili G.K., Koluman A., Dikici A., Kahraman T., Unlu A.T. Characterization of Salmonella isolated from organically reared poultry located in the same longitude with three distinct seasonal characteristics. J. Food Saf. 2019;39:1–8. [Google Scholar]
  20. Kaye K.S., Pogue J.M., Tran T.B., Nation R.L., Li J. Agents of last resort: polymyxin resistance. Infect. Dis. Clin. North Am. 2016;30:391–414. doi: 10.1016/j.idc.2016.02.005. [DOI] [PubMed] [Google Scholar]
  21. Kerrnet M.B., Klemmensen T., Frimodt-Moller N., Espersen F. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 2002;50:513–516. doi: 10.1093/jac/dkf164. [DOI] [PubMed] [Google Scholar]
  22. Kirk M.D., Pires S.M., Black R.E., Caipo M., Crump J.A., Devleesschauwer B., Dopfer D., Aamir F., Fischer-Walker C.L., Hald T., Hall A.J., Keddy K.H., lake R.J., Lanata C.F., Torgerson P.R., Hall A.J., Keddy K.H., Lake R.J., Lanata C.F., Torgerson P.R., Havelaar A.H., Angulo F.J. World Health Organization estimates of the global and regional disease burden of foodborne bacterial, protozoal, and viral diseases, 2010: a data synthesis. PLoS Med. 2015;12:e1001921. doi: 10.1371/journal.pmed.1001940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kumar N., Mohan K., Georges K., Dziva F., Adesiyun A.A. Prevalence, serovars, and antimicrobial resistance of Salmonella in cecal samples of chickens slaughtered in pluck shops in Trinidad. J. Food Prot. 2019;82:1560–1567. doi: 10.4315/0362-028X.JFP-18-553. [DOI] [PubMed] [Google Scholar]
  24. Li R.C., Lai J., Wang Y., Liu S.L., Li Y., Liu K.Y., Shen J.Z., Wu C.M. Prevalence and characterization of Salmonella species isolated from pigs, ducks and chickens in Sichuan Province, China. Int. J. Food Microbiol. 2013;163:14–18. doi: 10.1016/j.ijfoodmicro.2013.01.020. [DOI] [PubMed] [Google Scholar]
  25. Liu Y.Y., Wang Y., Walsh T.R., Yi L.X., Zhang R., Spencer J., Doi Y., Tian G., Dong B., Huang X., Yu L., Gu D., Ren H., Chen X., Lv L., He D., Zhou H., Liang Z., Liu J., Shen J. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect. Dis. 2016;16:161–168. doi: 10.1016/S1473-3099(15)00424-7. [DOI] [PubMed] [Google Scholar]
  26. Lu Y., Wu C.M., Wu G.J., Zhao H.Y., He T., Cao X.Y., Dai L., Xia L.N., Qin S.S., Shen J.Z. Prevalence of antimicrobial resistance among Salmonella isolates from chicken in China. Foodborne Pathog. Dis. 2011;8:45–53. doi: 10.1089/fpd.2010.0605. [DOI] [PubMed] [Google Scholar]
  27. Marathe N.P., Berglund F., Razavi M., Pal C., Dröge J., Samant S., Kristiansson E., Larsson D.G.J. Sewage effluent from an Indian hospital harbors novel carbapenemases and integron-borne antibiotic resistance genes. Microbiome. 2019;7:97. doi: 10.1186/s40168-019-0710-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mehdi Y., Létourneau-Montminy M.P., Gaucher M.L., Chorfi Y., Suresh G., Rouissi T., Brar S.K., Côté C., Ramirez A.A., Godbout S. Use of antibiotics in broiler production: global impacts and alternatives. Anim. Nutr. 2018;4:170–178. doi: 10.1016/j.aninu.2018.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Moawad A.A., Hotzel H., Awad O., Tomaso H., Neubauer H., Hafe M.H., Hosny E. Occurrence of Salmonella enterica and Escherichia coli in raw chicken and beef meat in northern Egypt and dissemination of their antibiotic resistance markers. Gut Pathog. 2017;9:57. doi: 10.1186/s13099-017-0206-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nógrády N., Király M., Davies R., Nagy B. Multidrug resistant clone of Salmonella infantis of broiler in Europe. Int. J. Food Microbiol. 2012;157:108–112. doi: 10.1016/j.ijfoodmicro.2012.04.007. [DOI] [PubMed] [Google Scholar]
  31. Omwandho C., Kubota T. Salmonella enterica serovar enteritidis: a mini review of contamination routes and limitations to effective control. Jpn. Agric. Res. Q. 2010;44:7–16. [Google Scholar]
  32. Pan H., Zhou X., Chai W., Paudyal N., Li S., Zhou X., Zhou K., Wu Q., Wu B., Li G., Rajkovic A., Fang W., Rankin S.C., Li Y., Xu X., Schifferli D.M., Yue M. Diversified sources for human infections by Salmonella enterica serovar newport. Transbound. Emerg. Dis. 2019;66:1044–1048. doi: 10.1111/tbed.13099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Paudyal N., Pan H., Elbediwi M., Zhou X., Peng X., Li X., Fang W., Yue M. Characterization of Salmonella Dublin isolated from bovine and human hosts. BMC Microbiol. 2019;19:226. doi: 10.1186/s12866-019-1598-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Rhouma M., Letellier A. Extended-spectrum β-lactamases, carbapenemases and the mcr-1 gene: is there a historical link? Int. J. Antimicrob. Agents. 2017;49:269–271. doi: 10.1016/j.ijantimicag.2016.11.026. [DOI] [PubMed] [Google Scholar]
  35. Sun J., Zhang H., Liu Y.H., Feng Y. Towards understanding MCR-like colistin resistance. Trends Microbiol. 2018;26:794–808. doi: 10.1016/j.tim.2018.02.006. [DOI] [PubMed] [Google Scholar]
  36. Tamang M.D., Gurung M., Nam H.M., Moon D.C., Kim S.R., Jang G.C., Jung D.Y., Jung S.C., Park Y.H., Lim S.K. Prevalence and characterization of Salmonella in pigs from conventional and organic farms and first report of S. serovar 1,4,[5],12: i:- from Korea. Vet. Microbiol. 2015;178:119–124. doi: 10.1016/j.vetmic.2015.05.005. [DOI] [PubMed] [Google Scholar]
  37. Terentjeva M., Avsejenko J., Streikisa M., Utinane A., Kovalenko K., Berzins A. Prevalence and antimicrobial resistance of Salmonella in meat and meat products in Latvia. Ann. Agric. Environ. Med. 2017;24:317–321. doi: 10.5604/12321966.1235180. [DOI] [PubMed] [Google Scholar]
  38. Thomas K.M., Glanville W., Barker C.G.D., Benschop J., Buza J.J., Cleaveland S., Davis M.A., French N.P., Mmbaga B.T., Prinsen G., Swai E.S., Zadoks R.N., Crump J.A. Prevalence of Campylobacter and Salmonella in African food animals and meat: a systematic review and meta-analysis. Int. J. Food Microbiol. 2020;315:108382. doi: 10.1016/j.ijfoodmicro.2019.108382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Trongjit S., Angkititrakul S., Tuttle R.E., Poungseree J., Padungtod P., Chuanchuen R. Prevalence and antimicrobial resistance in Salmonella enterica isolated from broiler chickens, pigs and meat products in Thailand-Cambodia border provinces. Microbiol. Immunol. 2017;61:23–33. doi: 10.1111/1348-0421.12462. [DOI] [PubMed] [Google Scholar]
  40. Wang J., Li J., Liu F., Cheng Y., Su J. Characterization of Salmonella enterica isolates from diseased poultry in northern China between 2014 and 2018. Pathogens. 2020;9:95. doi: 10.3390/pathogens9020095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. World Health Organization (WHO) Additional global, regional and national strategies and plans to address antimicrobial resistance. 2014. http://www.cddep.org/garp/home Accessed Apr. 2014.
  42. Xu H.Y., Zhang W., Guo C., Xiong H.P., Chen X., Jiao X.N., Su J., Mao L.T., Zhao Z., Li Q.C. Prevalence, serotypes, and antimicrobial resistance profiles among Salmonella isolated from food catering workers in Nantong, China. Foodborne Pathog. Dis. 2019;16:346–351. doi: 10.1089/fpd.2018.2584. [DOI] [PubMed] [Google Scholar]
  43. Yan H., Li L., Alam M.J., Shinoda S., Miyoshi S., Shi L. Prevalence and antimicrobial resistance of Salmonella in retail foods in northern China. Int. J. Food Microbiol. 2010;143:230–234. doi: 10.1016/j.ijfoodmicro.2010.07.034. [DOI] [PubMed] [Google Scholar]
  44. Yang X., Huang J., Zhang Y., Liu S., Chen L., Xiao C., Zeng H., Wei X., Gu Q., Li Y., Wang J., Ding Y., Zhang J., Wu Q. Prevalence, abundance, serovars and antimicrobial resistance of Salmonella isolated from retail raw poultry meat in China. Sci. Total Environ. 2020;713:136385. doi: 10.1016/j.scitotenv.2019.136385. [DOI] [PubMed] [Google Scholar]
  45. Yang B., Qiao L., Zhang X., Cui Y., Xia X., Cui S., Wang X., Meng X., Ge W., Shi X. Serotyping, antimicrobial susceptibility, pulse field gel electrophoresis analysis of Salmonella isolates from retail foods in Henan Province, China. Food Control. 2013;32:228–235. [Google Scholar]
  46. Yue M., Song H., Bai L. Call for special issue papers: food safety in China: current practices and future needs. Foodborne Pathog. Dis. 2020;17:295. doi: 10.1089/fpd.2020.29013.cfp. [DOI] [PubMed] [Google Scholar]
  47. Zishiri O., Mkhize N., Mukaratirwa S. Prevalence of virulence and antimicrobial resistance genes in Salmonella spp. isolated from commercial chickens and human clinical isolates from South Africa and Brazil. Onderstepoort J. Vet. Res. 2016;83:1–11. doi: 10.4102/ojvr.v83i1.1067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zhang Z.F., Zhang J.X., Yang J.X., Xu X.B., Zhou X.J., Shi C.L., Zhao X.D., Liu Y.H., Shi X.M. Co-existence of mphA, oqxAB and blaCTX-M-65 on the IncHI2 plasmid in highly drug-resistant Salmonella enterica serovar Indiana ST17 isolated from retail foods and humans in China. Food Control. 2020;118:107269. [Google Scholar]
  49. Zhao X., Yang J., Zhang B., Sun S., Chang W. Characterization of integrons and resistance genes in Salmonella isolates from farm animals in Shandong province, China. Front. Microbiol. 2017;8:1300. doi: 10.3389/fmicb.2017.01300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhao X., Ye C., Chang W., Sun S. Serotype distribution, antimicrobial resistance, and class 1 integrons profiles of Salmonella from animals in slaughterhouses in Shandong Province, China. Front. Microbiol. 2017;8:1049. doi: 10.3389/fmicb.2017.01049. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES