Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Dec 1.
Published in final edited form as: Cancer Lett. 2014 Jul 22;353(2):232–241. doi: 10.1016/j.canlet.2014.07.019

Epigenetic silencing of microRNA-373 to epithelial-mesenchymal transition in non-small cell lung cancer through IRAK2 and LAMP1 axes

Hyang Sook Seol a,b,†, Yoshimitsu Akiyama c,†, Shu Shimada c, Hee Jin Lee a, Tae Im Kim b, Sung Min Chun a,b, Shree Ram Singh d,*, Se Jin Jang a,b,*
PMCID: PMC7707239  NIHMSID: NIHMS1641174  PMID: 25063738

Abstract

The role of microRNAs (miRNAs) in carcinogenesis as tumor suppressors or oncogenes has been widely reported. Epigenetic change is one of the mechanisms of transcriptional silencing of miRNAs in cancer. To identify lung cancer-related miRNAs that are mediated by histone modification, we conducted microarray analysis in the Calu-6 non-small cell lung cancer (NSCLC) cell line after treatment with suberoylanilide hydroxamic acid (SAHA), a histone deacetylase (HDAC) inhibitor. The expression level of miR-373 was enhanced by SAHA treatment in this cell line by microarray and the following quantitative RT-PCR analyses. Treatment with another HDAC inhibitor, Trichostatin A, restored the levels of miR-373 expression in A549 and Calu-6 cells, while demethylation drug treatment did not. Importantly, miR-373 was found to be down-regulated in NSCLC tissues and cell lines. Transfection of miR-373 into A549 and Calu-6 cells attenuated cell proliferation, migration, and invasion and reduced the expression of mesenchymal markers. Additional microarray analysis of miR-373-transfected cells and computational predictions identified IRAK2 and LAMP1 as targets of miR-373. Knockdown of these two genes showed similar biological effects to those of miR-373 overexpression. In clinical samples, overexpression of IRAK2 correlated with decreased disease-free survival of patients with non-adenocarcinoma. In conclusion, we found that miR-373 is silenced by histone modification in lung cancer cells and identified its function as a tumor suppressor and negative regulator of the mesenchymal phenotype through downstream IRAK2 and LAMP1 target genes.

Keywords: microRNA-373, Non-small cell lung cancer, Histone deacetylase, Tumor suppressor, IRAK2, LAMP1

Introduction

MicroRNAs (miRNAs) are small non-coding RNAs of approximately 22 nucleotides that control the expression level of specific proteins by attenuating the translation of target messenger RNAs (mRNAs). Their functions cover a wide range of biological processes including cell proliferation, migration, and invasion of cancer cells [1–4]. In addition, the expression levels of various miRNAs have been reported to change during the carcinogenic process [5–8]. MicroRNAs are therefore thought to act as tumor suppressors or oncogenes that modulate oncogenic pathways [9–13].

Several causes of aberrant expression of miRNA in cancers have been postulated, such as mutations in the pri-miRNA sequence, gene copy number alterations, and abnormal transcription [14–16]. Epigenetic modification of DNAs, such as DNA promoter methylation and histone modification, contributes to chromatin remodeling and the general regulation of gene expression in mammalian development and human diseases [17–19]. Recent studies have demonstrated evidence of epigenetic aberration of miRNA expression in human cancers [20–23]. Furthermore, in cancer cell lines in which DNA hypermethylation represses miRNA expression, treatment with demethylating drugs and histone deacetylase (HDAC) inhibitors has been found to restore miRNA expression [24–28].

Lung cancer has a high incidence and mortality rate, making it the most deadly malignant disease in the world [29]. Accumulation of multiple genetic aberrations, as well as epigenetic changes, which affect key cellular genes such as oncogenes and tumor suppressor genes, plays a key role in lung carcinogenesis [30–32]. MicroRNAs have been reported as targets of epigenetic events during carcinogenesis. In lung cancer, several miRNAs, such as miR-9–3, miR-34b, miR-124–1, miR-124–2, miR-124–3, mir-126, miR-137, miR-152, miR-193a, miR-503, and miR-886–3p, are silenced by DNA hypermethylation [33–41]. Furthermore, histone modification may be another possible epigenetic mechanism underlying aberrant miRNA expression. However, little evidence exists to suggest that miRNAs are affected by this mechanism in lung cancer.

In the present study, we identify that miR-373 is silenced by histone modification and participates as a tumor suppressor in lung cancer cells. After overexpression of miR-373 in A549 and Calu-6 lung cancer cells, we searched its downstream target genes by microarray and the following computational database analyses. We observed that the miR-373 plays as negative regulator of the mesenchymal phenotype through downstream target genes, interleukin-1 receptor-associated kinase-like 2 (IRAK2) and lysosomal-associated membrane protein 1 (LAMP1).

Materials and methods

Cell lines and tissue specimens

Eight non-small cell lung cancer (NSCLC) cell lines (A549, Calu-6, H460, EKVX, H23, H322M, H332M, and H358) were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 100 μg/mL streptomycin. Tissue specimens surgically resected from primary lung cancer patients were randomly collected in the Asan Medical Center. Informed consent from all patients and ethical approval by the Institutional Review Board of Asan Medical Center were obtained prior to any experiments.

Deacetylation and demethylation assays

A549 and Calu-6 cells were seeded at 3 × 105 cells/well in 60 cm2 dishes and cultured for 24 hours. Calu-6 cells were then exposed to 3 μM or 5 μM suberoylanilide hydroxamic acids (SAHA) for 72 hours. A549 and Calu-6 cells were treated with 300 nM Trichostatin A (TSA) as HDAC inhibitors, and 3 μM 5-aza-2′-deoxycytidine (AZA) as a DNA demethylating drug for 72 hours. These three reagents were purchased from Sigma Aldrich (St. Louis, MO).

RNA extraction and qRT-PCR

Total RNA was isolated from cells and tissues using TRIzol reagent (Invitrogen, Carlsbad, CA). For single-stranded complementary DNA synthesis, 1 μg of total RNA was reverse-transcribed by MultiScribe™ Reverse Transcriptase (Applied Biosystems, Carlsbad, CA). The primer sets and amplification conditions for PCR are listed in Appendix: Supplementary Table S1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA and 18s ribosomal RNA expressions were used as endogenous controls. For the quantification of miRNA, 20 ng of total RNA was reverse-transcribed using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) with specific primers for U6 small nuclear RNA (RNU6B) and miR-373 (Applied Biosystems). PCR amplifications were subsequently performed in triplicate according to the TaqMan MicroRNA Assay protocol (Applied Biosystems). The expression levels of miR-373 were normalized against those of the endogenous control RNU6B by the 2-ΔΔCt methods.

Western blotting

Cells were lysed using the Cell Lysis Buffer (#9803; Cell Signaling Technology, Danvers, MA) with a protease inhibitor cocktail kit (P3100–005; GenDEPOT, Barker, TX) and a phosphatase inhibitor (sc-45065; Santa Cruz Biotechnology, Santa Cruz, CA). Aliquots containing 30 μg of cell lysates were denatured in 5 × sample buffer, electrophoretically resolved on SDS-polyacrylamide gels, and then transferred onto a nitrocellulose membrane (Amersham, Buckinghamshire, UK) in transfer buffer [25 mM Tris, 192 mM glycine, 20% (v/v) methanol (pH 8.3)] at 300 mA at 4 °C for 90 minutes. The membranes were blocked with 7% skim milk in PBS containing 0.1% Tween 20 for 60 minutes at room temperature and then incubated with the antibodies listed in Appendix: Supplementary Table S2. The secondary antibody used was an HRP-conjugated goat anti-rabbit IgG (1:2000; Cell Signaling Technology). The blots were developed using the ECL western blotting analysis system (GE Healthcare, Buckinghamshire, UK).

Synthetic miRNA/siRNA transfection

Two NSCLC cell lines, A549 and Calu-6, were transfected with Precursor Molecule mimicking miR-373 (Applied Biosystems), scrambled sequence miRNA (Scrambled Negative Control; Applied Biosystems), siRNAs targeting IRAK2 (IRAK-2 sense 5′ CAGCAACGUCAAGAGCUCUAAUU 3′ antisense 5′ UUAGAGCUCUUGACGUUGCUGUU 3′) and LAMP1 (LAMP1 sense 5′ AGAAAUGCAACACGUUAUU 3′ and antisense 5′ UAACGUGUUGCAUUUCUUU 3′) or a scrambled sequence siRNA (sense 5′ CCUCGUGCCGUUCCAUCAGGUAGUU 3′ and antisense 5′ CUACCUGAUGGAACGGCACGAGGUU 3′) to a final concentration of 5–100 nM using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Cells were harvested for assaying at 24–72 hours after transfection.

Cell proliferation assay

The effect of miR-373 on cell proliferation was evaluated by MTT assay. Briefly, 103 A549 and Calu-6 cells were treated with precursor miR-373 in 96-well plates. After incubation for 1, 3, and 5 days at 37 °C, 20 μL of 10 mg/mL MTT (Sigma Aldrich) was added to each well. Four hours after incubation with MTT, the supernatant was discarded and the precipitate of formazan was dissolved in 200 μL of dimethylsulfoxide. The solution was measured on a microplate reader at 540 nm.

Wound healing assay

Transfected cells were seeded at 3 × 105 cells/well in 6-well plates at a density, which was expected to reach 70–80% confluence as a monolayer after 24 hours of growth. A scratch was made through the center of each well using a 200-μL pipette tip, and dislodged cells were removed by three washes with complete culture media. The plates were then incubated with RPMI 1640 with 1% FBS for 48 hours, and the scratch was microscopically observed.

Cell migration and invasion assays

We tested the motile and invasive capacity of A549 and Calu-6 cells transfected with mimic RNA oligos using BD Biocoat Tumor Invasion System (BD Biosciences, San Diego, CA) according to the manufacturer’s protocol with minor modifications. Briefly, A549 and Calu-6 cells were transfected with mimic miR-373, siIRAK2, siLAMP1, or negative control for 24 hours. These transfected cell lines were then seeded into the upper chamber of the transwells with serum-free medium (3 × 104 cells). The bottom wells in the system were filled with medium containing 1% FBS. After 72 hours of incubation, the cells in the upper chamber were removed, and the cells infiltrating through the chamber membrane were microscopically counted.

Microarray analysis and miRNA target prediction

Total RNA was extracted from A549 and Calu-6 cells at 24 hours after transient transfection. Complementary DNA microarray analysis was conducted by DNA Chip Research (Macrogen, Korea) with whole Human Genome oligo DNA arrays (Agilent Technologies, Santa Clara, CA). The predicted targets of miR-373 and their binding sites were analyzed by miRBase, TargetScan and RegRna.

Tissue microarray generation and immunohistochemical staining

Tissue microarrays were constructed from paraffin-embedded blocks of 392 NSCLC cases as previously described [42]. Histological typing and grading were performed according to the World Health Organization guidelines.

Sections at a thickness of 4 μm were generated from tissue microarray blocks and mounted on silane-coated slide-glasses (MUTO Pure Chemicals Co. Ltd, Tokyo, Japan). The slides were deparaffinized through a series of xylene rinses and rehydrated stepwise by soaking in graded alcohol-distilled water solutions. Endogenous peroxidase was quenched with 3% hydrogen peroxide in methanol at room temperature. For antigen retrieval, sections were placed in a 10 mM sodium citrate buffer (pH 6.0) at 95 °C. Non-specific binding was blocked by incubating in 5% normal goat serum for 30 minutes at room temperature. A primary rabbit anti-IRAK2 polyclonal antibody (1:100; Cell Signaling Technology) was applied for 1 hour at room temperature. The intensity of staining was categorized as 0 (negative), 1 (weak), or 2 (strong). The score was dichotomized into negative (no and low expression, score 0 and 1) and positive (high expression, score 2).

Quantitative methylation analysis (EpiTyper)

Genomic DNA was subjected to sodium bisulfite treatment using the EZ methylation kit (Zymo Research, Orange, CA) according to the manufacturer’s instructions. Quantitative DNA methylation was determined by MassArray EpiTyper technology (Sequenom, San Diego, CA) as previously described [43,44]. These data were corrected using DNA methylation standards (0, 20, 40, 60, 80, and 100% methylated genomic DNA). The primers used are as follows: forward 5′-GTAGCAGGATGGCCCTAGAC-3′; and reverse 5′-CGCCCTCTGAACCTTCTCTT-3′. The locations of EpiTyper amplicons are illustrated in Appendix: Supplementary Fig. S1.

Statistical analysis

Associations between categorical variables were analyzed by Pearson’s chi-square and Fisher’s exact tests. Survival curves were calculated by the Kaplan–Meier method, and statistical significance was evaluated using the log-rank test and the Cox proportional hazards regression model. P-values less than 0.05 were considered statistically significant. SPSS 18.0 (SPSS, Chicago, IL) was utilized for statistical analyses.

Results

Detection of miRNAs regulated by histone modification in lung cancer cell lines

We performed miRNA microarray analysis of Calu-6 cells treated with or without SAHA, an HDAC inhibitor. Among the 332 miRNAs that were up-regulated by SAHA treatment (Appendix: Supplementary Table S3), we selected miR-373 as a candidate because it has not been thoroughly analyzed in previous lung cancer studies. Our results were validated by quantitative RT-PCR (qRT-PCR). The expression levels of miR-373 were significantly up-regulated in a dose-dependent manner after SAHA treatment in Calu-6 cells (Fig. 1A). Next, we treated Calu-6 and A549 cells with AZA (a DNMT inhibitor) and TSA (an HDAC inhibitor) and observed that miR-373 was induced by TSA, but not by AZA, which was consistent with our microarray data (Fig. 1B). Hence, miR-373 expression was found to be regulated by histone modification, but not by DNA methylation, in lung cancer cells.

Fig. 1.

Fig. 1.

Open in a new tab

MicroRNA-373 expression is controlled by histone modification, not DNA methylation, in lung cancer cells. (A) Quantitative RT-PCR analysis of miR-373 expression after treatment of Calu-6 cells with SAHA. (B) Quantitative RT-PCR expression analysis of miR-373 after treatment of A549 and Calu-6 cells with AZA and TSA. Error bars represent s.d. (n = 3); ***P < 0.001 by one-way analysis of variance with Dunnett’s test.

MicroRNA-373 expression in primary NSCLC tissues and lung cancer cell lines

We examined the expression levels of miR-373 in 21 primary NSCLC tissues and corresponding normal tissues by qRT-PCR assays using TaqMan. miR-373 expression was significantly lower in NSCLC tissues than in normal lung tissues (Mann–Whitney U-test, P = 0.035) (Fig. 2A). Next, we analyzed the expression level of miR-373 in eight NSCLC cell lines by qRT-PCR using TaqMan. The relative expression level of miR-373 was low in A549, Calu-6, H460, EKVX, and H23 cells, whilst it was high in H332M, H322M, and H358 cells (Fig. 2B). We also showed that the expression level of miR-373 correlated with that of E-cadherin in NSCLC cells (Fisher’s exact test, P = 0.018) (Fig. 2C), which is similar to previous findings on prostate cancer cells [45].

Fig. 2.

Fig. 2.

Open in a new tab

miR-373 expression in NSCLC tissues and cell lines. (A) Quantitative RT-PCR analysis of miR-373 expression in normal lung (normal, n = 19) and lung cancer (cancer, n = 21) tissues. (B) Quantitative RT-PCR analysis of miR-373 expression in NSCLC cell lines. Error bars represent s.d. (n = 3). (C) Western blotting analysis of E-cadherin expression in NSCLC cell lines. Statistically significant differences are indicated; *P < 0.05 by Mann–Whitney U-test.

Biological properties of miR-373 in lung cancer cells

To determine the biological functions of miR-373 in lung cancer cells, we first transfected pre-miR-373 into A549 and Calu-6 cells. Validation of the overexpression of transfected cells is shown in Fig. 3A. In addition, transfected cells showed significant growth inhibition in MTT assays (Fig. 3B). The motility and invasiveness of these two cell lines was diminished by overexpression of miR-373 as shown by wound healing and transwell assays, respectively (Fig. 3C and D, respectively). To confirm the increase in cell motility and invasiveness at the molecular level, we analyzed the expression levels of mesenchymal markers, N-cadherin (CDH2), vimentin (VIM), and fibronectin (FN1). These markers were found to be down-regulated in pre-miR-373-transfected cells at both the mRNA and the protein levels (Fig. 3E and F). Taken together, the results suggest that miR-373 may act as a tumor suppressor and negative regulator of the mesenchymal phenotype in lung cancer.

Fig. 3.

Fig. 3.

Open in a new tab

Transfection of pre-miR-373 in lung cancer cell lines. (A) Quantitative RT-PCR analysis of miR-373 after treatment with pre-miR-373 in A549 and Calu-6 cells. (B) Cell viability assay after treatment with miR-373 mimic in A549 and Calu-6 cells. (C) Wound healing assay in A549 and Calu-6 cells 24 hours after treatment with pre-miR-373. (D) Matrigel invasion chamber assay of A549 and Calu-6 cells 72 hours after treatment with pre-miR-373. (E) Quantitative RT-PCR analysis of mesenchymal markers in A549 and Calu-6 cells after treatment with pre-miR-373. (F) Western blotting analysis of mesenchymal markers in A549 and Calu-6 cells after treatment with pre-miR-373. N-cadherin was not detected in Calu-6 cells. Error bars represent s.d. (n = 3); ***P < 0.001; **P < 0.01; *P < 0.05 by Student’s t-test in (A, D, E). Error bars represent s.d. (n = 5); ***P < 0.001 by one-way analysis of variance with Tukey’s multiple comparison in (B).

Identification of target genes of miR-373

To identify the target genes of miR-373 that directly regulate cell proliferation, migration, and invasion, we transfected pre-miR-373 into A549 and Calu-6 cells and performed additional microarray analysis. We found that genes were up- (>1.5-fold) or down-regulated (>−1.4-fold) after ectopic miR-373 overexpression in the two cell lines. Among the 18 commonly down-regulated genes in A549 and Calu-6 cells with pre-miR-373 transfection, 9 genes (LAMP1, VSP4B, IRAK2, BRMS1L, SYDE1, CYBRD1, PDIK1L, C10orf46 and TGFBR2) were registered as the miR-373 target by miRNA target database (miRBase and TargetScan) analyses (Appendix: Supplementary Table S4). In this study, we selected IRAK2 and LAMP1 as direct target genes of miR-373 by a website for searching miRNA binding motifs (RegRna) (Appendix: Supplementary Fig. S2), both of which may be related to cell motilities and tumor progression [46,47]. IRAK2 is a member of the interleukin-1 receptor-associated kinase (IRAK) family, which is essential for Toll-like receptor-mediated transcriptional and post-transcriptional regulation of tumor necrosis factor (TNF)-α [46]. LAMP1 is a glycoprotein involved in cell-cell adhesion and cell-extracellular matrix interactions [47]. To validate these predictions, we analyzed the expression levels of IRAK2 and LAMP1 after premiR-373 transfection. The expression of both IRAK2 and LAMP1 was down-regulated in miR-373-overexpressed A549 and Calu-6 cells (Fig. 4A), strongly suggesting that IRAK2 and LAMP1 are targets of miR-373.

Fig. 4.

Fig. 4.

Open in a new tab

Knockdown of IRAK2 and LAMP1 in NSCLC cell lines. (A) Quantitative RT-PCR analysis of IRAK2 and LAMP1 expression after treatment of A549 and Calu-6 cells with pre-miR-373. (B) Wound healing assay 24 hours after treatment of A549 and Calu-6 cells with siIRAK2. (C) Matrigel invasion assay 72 hours after treatment of A549 and Calu-6 cells with siIRAK2. (D) Quantitative RT-PCR analysis of mesenchymal markers in A549 and Calu-6 cells after treatment with siIRAK2. (E) Western blotting analysis of mesenchymal markers in A549 and Calu-6 after treatment of siIRAK2. N-cadherin was not detected in Calu-6 cells. Error bars represent s.d. (n = 3); ***P < 0.001; **P < 0.01; *P < 0.05 by Student’s t-test.

To elucidate the biological effects of IRAK2 and LAMP1 genes on migration and invasion of cancer cells, we transfected synthetic siRNAs targeting IRAK2 and LAMP1 genes into A549 and Calu-6 cell lines. Silencing IRAK2 and LAMP1 significantly impaired the migration and invasion capabilities of the two cell lines in wound healing and transwell assays, respectively (Fig. 4B and C, respectively). The expression levels of mesenchymal markers (CDH2, VIM and FN1) were also down-regulated at the mRNA and protein levels (Fig. 4D and E). These results were consistent with those of miR-373 overexpression in these two cell lines (Fig. 3C and E).

Expression of IRAK2 and LAMP1 in human primary lung cancer samples

To elucidate the pathological significance of IRAK2 and LAMP1 expression, we performed immunohistochemistry for IRAK2 and LAMP1 in 392 NSCLC tissues on a tissue microarray. IRAK2 and LAMP1 were overexpressed in 65 cases (16.6%) and 245 cases (62.5%) of NSCLC tissues, respectively (Table 1). The correlations of IRAK2 and LAMP1 expression with pathological factors are summarized in Table 1. IRAK2 expression in adenocarcinoma tissues was significantly higher than that in non-adenocarcinomas (P = 0.014). LAMP1 expression was correlated with lymph node metastasis of NSCLC (P = 0.023). However, there were no statistically significant differences between IRAK2 and LAMP1 overexpression and other clinicopathological factors.

Table 1.

Relationship between IRAK2 and LAMP1 expression and Clinicopathological characteristics of 392 patients with NSCLC.

Variables Number of cases IRAK2
 LAMP1
Number (percent)
 P-valueb Number (percent)
 P-valueb
(−) (+) (−) (+)
Total 392 327 65 160 232
Gender Female 90 75 (83.3%) 15 (16.7%) 1 26 (28.9%) 64 (71.1%) 0.072
Male 302 252 (83.4%) 50 (16.6%) 121 (40.1%) 181 (59.9%)
Smoking history Never 95 78 (82.1%) 17 (17.9%) 0.813 30 (31.6%) 65 (68.4%) 0.212
Ever (former and current) 297 249 (83.8%) 48 (16.2%) 117 (39.4%) 180 (60.6%)
Histological subtype Adenocarcinoma 172 134 (77.9%) 38 (22.1%) 0.014 56 (32.6%) 116 (67.4%) 0.093
Non-adenocarcinomaa 220 193 (87.7%) 27 (12.3%) 91 (41.37%) 129 (58.63%)
Differentiation Well 85 69 (81.2%) 16 (18.8%) 0.624 36 (42.4%) 49 (57.6%) 0.486
Moderately 184 157 (85.3%) 27 (14.7%) 69 (37.5%) 115 (62.5%)
Poorly 123 101 (82.1%) 22 (17.9%) 42 (34.1%) 81 (65.9%)
Pathological tumor stage T1 91 76 (83.5%) 15 (16.5%) 0.784 41 (45.1%) 50 (54.9%) 0.290
T2 245 205 (83.7%) 40 (16.3%) 84 (34.3%) 161 (65.7%)
T3 52 42 (80.8%) 10 (19.2%) 21 (40.4%) 31 (59.6%)
T4 4 4 (100.0%) 0 (0.0%) 1 (25.0%) 3 (75.0%)
Lymph node metastasis Negative 237 203 (85.7%) 34 (14.3%) 0.183 100 (42.2%) 137 (57.8%) 0.023
Positive 155 124 (80.0%) 31 (20.0%) 47 (30.3%) 108 (69.7%)
pTNM stage I 173 151 (87.3%) 22 (12.7%) 0.187 71 (41.0%) 102 (59.0%) 0.108
II 136 109 (80.1%) 27 (19.9%) 53 (39.0%) 83 (61.0%)
III 83 67 (80.7%) 16 (19.3%) 23 (27.7%) 60 (72.3%)
Open in a new tab
a

Non-adenocarcinoma includes 197 squamous cell carcinoma, 11 adenosquamous carcinoma, 6 sarcomatoid carcinoma, and 6 large cell carcinoma.

b

P-values were determined by means of the chi-square tests.

Interestingly, in subgroup analysis, higher expression of IRAK2 was associated with poorer disease-free survival in the non-adenocarcinoma patients (hazard ratio = 1.309; 95% confidence interval: 1.014–1.690; P = 0.036) (Fig. 5B, right), although the overall survival in the NSCLC patients and disease-free survival in the adenocarcinoma patients did not show any differences (Fig. 5B, left and middle). There were no statistically significant differences between the patient survivals and LAMP1 expression by Kaplan–Meier analysis (data not shown). Multivariate analysis also showed that IRAK2 overexpression was associated with poor disease-free survival in the non-adenocarcinoma subgroup (hazard ratio = 1.315; 95% confidence interval: 1.016–1.702; P = 0.038) (Table 2). In contrast, LAMP1 expression did not correlate with disease-free or overall survival in any categories (data not shown).

Fig. 5.

Fig. 5.

Open in a new tab

Correlation between IRAK2 expression and disease-free and overall survival in NSCLC. (A) Kaplan–Meier disease-free and overall survival curves of patients with IRAK2-positive or -negative NSCLC. (B) Immunohistochemical staining of tissue microarray sections of NSCLC with an antibody against IRAK2.

Table 2.

Univariate and multivariate disease-free survival analysis in non-adenocarcinoma.

Variables Univariate analysis
 Multivariate analysis
IRAK2: positive vs negative HR 95% CI P HR 95% CI P
Gender: male vs female 1.309 1.014–1.690 0.036 1.315 1.016–1.702 0.038
Age: ≥60 vs <60 0.766 0.372–1.578 0.470 0.802 0.386–1.668 0.554
pT stage: 2–4 vs 1 1.140 0.754–1.723 0.535 1.374 0.900–2.096 0.141
Lymph node metastasis: positive vs negative 1.977 1.125–3.476 0.018 2.011 1.139–3.552 0.016
IRAK2: positive vs negative 1.667 1.130–2.460 0.01 1.657 1.115–2.461 0.012
Open in a new tab

HR, hazard ratio; CI, confidence interval.

Discussion

Demethylation-expression arrays have been used to identify genes silenced by DNA hypermethylation [48]. In our present study, we used an HDAC inhibitor as the epigenetic modifier instead of the DNMT inhibitor that is normally used in the assay to identify miRNAs silenced by histone modification. Our results identified miR-373 as a target of epigenetic aberration in NSCLC. The role of miR-373 in various types of cancers remains controversial. The miR-520/373 family has been reported to play a tumor suppressive role in ER(−) breast cancer by acting as a link between the NF-κB and TGF-β pathways, thus contributing to the interplay of inflammation, tumor progression, and tumor dissemination [49]. In addition, miR-373 has been found to functionally induce E-cadherin and DSDC2 expression by binding to the promoters of these two genes in prostate and colon cancers [45]. Furthermore, miR-373 has been demonstrated to be an oncogenic miRNA in testicular germ cell tumors through its direct inhibition of the tumor suppressor LATS2 [50].

In the current analyses, we observed that miR-373 expression is down-regulated in lung cancer tissues, and that ectopic overexpression of miR-373 inhibits proliferation, migration, and invasion of lung cancer cell lines. These results suggest that miR-373 may act as a tumor suppressor and negative regulator of the epithelial-mesenchymal transition in lung cancer.

Tanaka et al. [51] have reported CpG Island hypermethylation as a mechanism for the aberrant expression of miR-373 in colorectal cancer. In our current EpiTyper assay, however, we did not find any differences in the methylation level profile of the miR-373 promoter CpG Island among five miR-373-positive and three miR-373-negative lung cancer cell lines (Appendix: Supplementary Fig. S1). In addition, our qRT-PCR analysis after treatment of HDAC and DNMT inhibitors suggested that the down-regulation of miR-373 in NSCLC is not associated with DNA methylation but rather with histone modification.

To identify effector molecules that mediate the biological function of miR-373 in NSCLC, we selected several miRNA candidates using both microarray analysis and informatics. After confirming the predictions at the molecular level, IRAK2 and LAMP1 were identified as potential targets of miR-373 (Fig. 4A). In vitro experiments have shown that IRAK2 plays an essential role for toll-like receptor-mediated transcriptional and post-transcriptional regulation [46] and participates as a mediator of multiple toll-like receptor signaling pathways to NF-κB via activation of TRAF6 ubiquitination [52]. Although there are no reports on IRAK2 overexpression in cultured and primary cancer specimens, our data indicate that loss of miR-373 and the resultant IRAK2 overexpression may be involved in lung carcinogenesis. It is important to analyze whether the relationship between IRAK2 and miR-373 is specific in NSCLC or common event in various cancer. In contrast, LAMP1 has been shown to be overexpressed in astrocytoma [53], human primary and metastatic colorectal cancer cells and tissues [47,54,55], pancreatic carcinoma samples [56] and various other cancer tissues [57]. Because miR-373 was also down-regulated in colon and pancreatic cancers [51,58], it is possible that dysregulation of miR-373-LAMP1 axis may play an important role in these cancers as well as NSCLC. In our present experiments on lung cancer cells, silencing of IRAK2 and LAMP1 by siRNA resulted in similar effects in terms of cell migration and invasion to those of miR-373 overexpression. The experimental results and computational prediction indicate that these two genes may be targets of miR-373 and play effector roles in the biological operation of miR-373 in NSCLCs. To further confirm the molecular relationship between miR-373 and these two target genes, a direct binding assay with miR-373 and the 3′-untranslated regions of these two genes is needed in a future study.

In clinical samples of NSCLC, IRAK2 and LAMP1 were found to be frequently overexpressed in contrast to normal lung tissues (Fig. 5B). Although the positive ratio of the IRAK2 expression in non-adenocarcinoma cases was smaller than those in adenocarcinoma cases, overexpression of IRAK2 significantly correlated with disease-free survival of non-adenocarcinoma patients. IRKA2 overexpression may play a distinct role in these two types of NSCLC. On the contrary, LAMP1 overexpression was significantly related to lymph node metastasis, which is consistent with previous observation that LAPM-1 was preferentially expressed in metastatic colon cancer cells [54]. Thus, our current results suggest that down-regulation of miR-373 by epigenetic aberration and the resultant up-regulation of IRAK2 and LAMP1 contribute to cancer progression or, at least, act as a disease modifier of NSCLC.

Powers et al. [59] have previously described a novel drug targeting IRAK1 and IRAK4 using high-throughput screening of a small-molecule compound library. Furthermore, it was reported that the IRAK1/4 inhibitor is effective in the treatment of melanoma [60] as well as myelodysplastic syndrome [61]. Since the IRAK family plays a key role in NF-κB signaling, IRAK2 may also be a therapeutic target for NSCLC. This hypothesis requires further investigation. One of the four members of the IRAK family, IRAK-1 is known to express in NSCLC tissues and low level of expression of nuclear IRAK-1 and NF-κB are significantly correlated with poor overall survivals in patients [62].

As for other candidates of miR-373 target genes detected by microarray and computational analyses (Appendix: Supplementary Table S4), overexpression of CYBRD1 (known as DCYTB) and VPS4B was also reported in colon and lung cancers, respectively [63,64]. CYBRD1 is a member of the cytochrome b family that plays as iron import [63], and VPS4B is a member of the ATPases family proteins that participates in lysosome-dependent degradation [64]. It is important to analyze whether or not these two genes are target of miR-373 and to identify the roles of these two genes in NSCLC.

In conclusion, in the present study we show that miR-373 is frequently down-regulated in NSCLC tissues and cell lines. Our data also indicate that miR-373 is silenced by histone deacetylation in NSCLC cells, and plays a significant role in lung cancer cell migration and invasion through its functional targets IRAK2 and LAMP1. Therefore, miR-373-IRAK2 and −LAMP1 axes provide new insight into the pathogenesis of lung cancer and could be potential therapeutic targets for the treatment of this disease.

Supplementary Material

Supplemental figures tables

Acknowledgements

Basic Science Research Program through the National Research Foundation of Korea funded by the Ministry of Science, ICT and Future Planning (2012R1A1A3011467); Leading Foreign Research Institute Recruitment Program through the National Research Foundation of Korea funded by the Ministry of Science, ICT and Future Planning (2011-0030105).

Footnotes

Conflict of interest

The authors declare no conflict of interest.

Disclosure of raw expression data

The original data of the expression analysis performed in this paper is provided in the Supplementary Tables.

Supplementary Table S3. Microarray analysis of SAHA treated Calu-6 cell line.

Supplementary Table S4. List of commonly down-regulated genes in A549 and Calu-6 cells with precursor miR-373 transfection.

Appendix: Supplementary material

Supplementary data to this article can be found online at doi:10.1016/j.canlet.2014.07.019.

References

  • [1].Esquela-Kerscher A, Slack FJ, Oncomirs – microRNAs with a role in cancer, Nat. Rev. Cancer 6 (2006) 259–269. [DOI] [PubMed] [Google Scholar]
  • [2].Yongchun Z, Linwei T, Xicai W, Lianhua Y, Guangqiang Z, Ming Y, et al. , MicroRNA-195 inhibits non-small cell lung cancer cell proliferation, migration and invasion by targeting MYB, Cancer Lett. 347 (2014) 65–74. [DOI] [PubMed] [Google Scholar]
  • [3].Su Y, Li X, Ji W, Sun B, Xu C, Li Z, et al. , Small molecule with big role: microRNAs in cancer metastatic microenvironments, Cancer Lett. 344 (2014) 147–156. [DOI] [PubMed] [Google Scholar]
  • [4].Singh SR, Rameshwar P, MicroRNA in development and in the progression of cancer, Springer, New York, 2014. [Google Scholar]
  • [5].Calin GA, Croce CM, MicroRNA signatures in human cancers, Nat. Rev. Cancer 6 (2006) 857–866. [DOI] [PubMed] [Google Scholar]
  • [6].Croce CM, Causes and consequences of microRNA dysregulation in cancer, Nat. Rev. Genet. 10 (2009) 704–714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Mulrane L, McGee SF, Gallagher WM, O’Connor DP, miRNA dysregulation in breast cancer, Cancer Res. 73 (2013) 6554–6562. [DOI] [PubMed] [Google Scholar]
  • [8].Munagala R, Aqil F, Vadhanam MV, Gupta RC, MicroRNA ‘signature’ during estrogen-mediated mammary carcinogenesis and its reversal by ellagic acid intervention, Cancer Lett. 339 (2013) 175–184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Kent OA, Mendell JT, A small piece in the cancer puzzle: microRNAs as tumor suppressors and oncogenes, Oncogene 25 (2006) 6188–6196. [DOI] [PubMed] [Google Scholar]
  • [10].Lotterman CD, Kent OA, Mendell JT, Functional integration of microRNAs into oncogenic and tumor suppressor pathways, Cell Cycle 7 (2008) 2493–2499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Shenouda SK, Alahari SK, MicroRNA function in cancer: oncogene or a tumor suppressor?, Cancer Metast. Rev. 28 (2009) 369–378. [DOI] [PubMed] [Google Scholar]
  • [12].Wang D, Qiu C, Zhang H, Wang J, Cui Q, Yin Y, Human microRNA oncogenes and tumor suppressors show significantly different biological patterns: from functions to targets, PLoS ONE 5 (2010) e13067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Ma X, Choudhury SN, Hua X, Dai Z, Li Y, Interaction of the oncogenic miR-21 microRNA and the p53 tumor suppressor pathway, Carcinogenesis 34 (2013) 1216–1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Li M, Li J, Ding X, He M, Cheng SY, microRNA and cancer, AAPS J. 12 (2010) 309–317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Aure MR, Leivonen SK, Fleischer T, Zhu Q, Overgaard J, Alsner J, et al. , Individual and combined effects of DNA methylation and copy number alterations on miRNA expression in breast tumors, Genome Biol. 14 (2013) R126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Pencheva N, Tavazoie SF, Control of metastatic progression by microRNA regulatory networks, Nat. Cell Biol. 15 (2013) 546–554. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Jones PA, Baylin SB, The fundamental role of epigenetic events in cancer, Nat. Rev. Genet. 3 (2002) 415–428. [DOI] [PubMed] [Google Scholar]
  • [18].Esteller M, Herman JG, Cancer as an epigenetic disease: DNA methylation and chromatin alterations in human tumours, J. Pathol. 196 (2002) 1–7. [DOI] [PubMed] [Google Scholar]
  • [19].Egger G, Liang G, Aparicio A, Jones PA, Epigenetics in human disease and prospects for epigenetic therapy, Nature 429 (2004) 457–463. [DOI] [PubMed] [Google Scholar]
  • [20].Zhang L, Volinia S, Bonome T, Calin GA, Greshock J, Yang N, et al. , Genomic and epigenetic alterations deregulate microRNA expression in human epithelial ovarian cancer, Proc. Natl Acad. Sci. U.S.A. 105 (2008) 7004–7009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Lopez-Serra P, Esteller M, DNA methylation-associated silencing of tumor-suppressor microRNAs in cancer, Oncogene 31 (2012) 1609–1622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Liep J, Rabien A, Jung K, Feedback networks between microRNAs and epigenetic modifications in urological tumors, Epigenetics 7 (2012) 315–325. [DOI] [PubMed] [Google Scholar]
  • [23].Liu X, Chen X, Yu X, Tao Y, Bode AM, Dong Z, et al. , Regulation of microRNAs by epigenetics and their interplay involved in cancer, J. Exp. Clin. Cancer Res. 32 (2013) 96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Saito Y, Liang G, Egger G, Friedman JM, Chuang JC, Coetzee GA, et al. , Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells, Cancer Cell 9 (2006) 435–443. [DOI] [PubMed] [Google Scholar]
  • [25].Scott GK, Mattie MD, Berger CE, Benz SC, Benz CC, Rapid alteration of microRNA levels by histone deacetylase inhibition, Cancer Res. 66 (2006) 1277–1281. [DOI] [PubMed] [Google Scholar]
  • [26].Kozaki K, Imoto I, Mogi S, Omura K, Inazawa J, Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer, Cancer Res. 68 (2008) 2094–2105. [DOI] [PubMed] [Google Scholar]
  • [27].Lujambio A, Ropero S, Ballestar E, Fraga MF, Cerrato C, Setien F, et al. , Genetic unmasking of an epigenetically silenced microRNA in human cancer cells, Cancer Res. 67 (2007) 1424–1429. [DOI] [PubMed] [Google Scholar]
  • [28].Pogribny IP, Rusyn I, Role of epigenetic aberrations in the development and progression of human hepatocellular carcinoma, Cancer Lett. 342 (2014) 223–230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D, Global cancer statistics, CA Cancer J. Clin. 61 (2011) 69–90. [DOI] [PubMed] [Google Scholar]
  • [30].Osada H, Takahashi T, Genetic alterations of multiple tumor suppressors and oncogenes in the carcinogenesis and progression of lung cancer, Oncogene 21 (2002) 7421–7434. [DOI] [PubMed] [Google Scholar]
  • [31].Wen J, Fu J, Zhang W, Guo M, Genetic and epigenetic changes in lung carcinoma and their clinical implications, Mod. Pathol. 24 (2011) 932–943. [DOI] [PubMed] [Google Scholar]
  • [32].Brzeziańska E, Dutkowska E, Antczak A, The significance of epigenetic alterations in lung carcinogenesis, Mol. Biol. Rep. 40 (2013) 309–325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Wang Z, Chen Z, Gao Y, Li N, Li B, Tan F, et al. , DNA hypermethylation of microRNA-34b/c has prognostic value for stage non-small cell lung cancer, Cancer Biol. Ther. 11 (2011) 490–496. [DOI] [PubMed] [Google Scholar]
  • [34].Cao J, Song Y, Bi N, Shen J, Liu W, Fan J, et al. , DNA methylation-mediated repression of miR-886–3p predicts poor outcome of human small cell lung cancer, Cancer Res. 73 (2013) 3326–3335. [DOI] [PubMed] [Google Scholar]
  • [35].Zhu X, Li Y, Shen H, Li H, Long L, Hui L, et al. , miR-137 inhibits the proliferation of lung cancer cells by targeting Cdc42 and Cdk6, FEBS Lett. 587 (2013) 73–81. [DOI] [PubMed] [Google Scholar]
  • [36].Li N, Zhang F, Li S, Zhou S, Epigenetic silencing of MicroRNA-503 regulates FANCA expression in non-small cell lung cancer cell, Biochem. Biophys. Res. Commun. 444 (2014) 611–616. [DOI] [PubMed] [Google Scholar]
  • [37].Heller G, Weinzierl M, Noll C, Babinsk V, Ziegler B, Altenberge C, et al. , Genome-wide miRNA expression profiling identifies miR-9–3 and miR-193a as targets for DNA methylation in non-small cell lung cancers, Clin. Cancer Res. 18 (2012) 1619–1629. [DOI] [PubMed] [Google Scholar]
  • [38].Watanabe K, Emoto N, Hamano E, Sunohara M, Kawakami M, Kage H, et al. , Genome structure-based screening identified epigenetically silenced microRNA associated with invasiveness in non-small-cell lung cancer, Int. J. Cancer 130 (2012) 2580–2590. [DOI] [PubMed] [Google Scholar]
  • [39].Khodyrev DS, Pronina IV, Rykov SV, Beresneva EV, Fridman MV, Kazubskaia TP, et al. , Methylation of some miRNA genes is involved in the regulation of their target genes RAR-beta2 and NKIRAS1 expression in lung cancer, Mol. Biol. (Mosk) 46 (2012) 773–785. [PubMed] [Google Scholar]
  • [40].Kitano K, Watanabe K, Emoto N, Kage H, Hamano E, Nagase T, et al. , CpG island methylation of microRNAs is associated with tumor size and recurrence of non-small-cell lung cancer, Cancer Sci. 102 (2011) 2126–2131. [DOI] [PubMed] [Google Scholar]
  • [41].Wang J, Yang B, Han L, Li X, Tao H, Zhang S, et al. , Demethylation of miR-9–3 and miR-193a genes suppresses proliferation and promotes apoptosis in non-small cell lung cancer cell lines, Cell. Physiol. Biochem. 32 (2013) 1707–1719. [DOI] [PubMed] [Google Scholar]
  • [42].Lee HJ, Seol HS, Kim JY, Chun SM, Suh YA, Park YS, et al. , ROS1 receptor tyrosine kinase, a druggable target, is frequently overexpressed in non-small cell lung carcinomas via genetic and epigenetic mechanisms, Ann. Surg. Oncol. 20 (2013) 200–208. [DOI] [PubMed] [Google Scholar]
  • [43].Ehrich M, Nelson MR, Stanssens P, Zabeau M, Liloglou T, Xinarianos G, et al. , Quantitative high-throughput analysis of DNA methylation patterns by base-specific cleavage and mass spectrometry, Proc. Natl Acad. Sci. U.S.A. 102 (2005) 15785–15790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Toyota M, Suzuki H, Sasaki Y, Maruyama R, Imai K, Shinomura Y, et al. , Epigenetic silencing of microRNA-34b/c and B-cell translocation gene 4 is associated with CpG island methylation in colorectal cancer, Cancer Res. 68 (2008) 4123–4132. [DOI] [PubMed] [Google Scholar]
  • [45].Place RF, Li LC, Pookot D, Noonan EJ, Dahiya R, MicroRNA-373 induces expression of genes with complementary promoter sequences, Proc. Natl Acad. Sci. U.S.A. 105 (2008) 1608–1613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [46].Flannery SM, Keating SE, Szymak J, Bowie AG, Human interleukin-1 receptor-associated kinase-2 is essential for Toll-like receptor-mediated transcriptional and post-transcriptional regulation of tumor necrosis factor alpha, J. Biol. Chem. 286 (2011) 23688–23697. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [47].Sawada R, Lowe JB, Fukuda M, E-selectin-dependent adhesion efficiency of colonie carcinoma cells is increased by genetic manipulation of their cell surface lysosomal membrane glycoprotein-1 expression levels, J. Biol. Chem. 268 (1993) 12675–12681. [PubMed] [Google Scholar]
  • [48].Shilatifard A, Chromatin modifications by methylation and ubiquitination: implications in the regulation of gene expression, Annu. Rev. Biochem. 75 (2006) 243–269. [DOI] [PubMed] [Google Scholar]
  • [49].Keklikoglou I, Koerner C, Schmidt C, Zhang JD, Heckmann D, Shavinskaya A, et al. , MicroRNA-520/373 family functions as a tumor suppressor in estrogen receptor negative breast cancer by targeting NF-kappaB and TGF-beta signaling pathways, Oncogene 31 (2012) 4150–4163. [DOI] [PubMed] [Google Scholar]
  • [50].Voorhoeve PM, Agami R, Classifying microRNAs in cancer: the good, the bad and the ugly, Biochim. Biophys. Acta 1775 (2007) 274–282. [DOI] [PubMed] [Google Scholar]
  • [51].Tanaka T, Arai M, Wu S, Kanda T, Miyauchi H, Imazeki F, et al. , Epigenetic silencing of microRNA-373 plays an important role in regulating cell proliferation in colon cancer, Oncol. Rep. 26 (2011) 1329–1335. [DOI] [PubMed] [Google Scholar]
  • [52].Keating SE, Maloney GM, Moran EM, Bowie AG, IRAK-2 participates in multiple toll-like receptor signaling pathways to NFkappaB via activation of TRAF6 ubiquitination, J. Biol. Chem. 282 (2007) 33435–33443. [DOI] [PubMed] [Google Scholar]
  • [53].Jensen SS, Aaberg-Jessen C, Christensen KG, Kristensen B, Expression of the lysosomal-associated membrane protein-1 (LAMP-1) in astrocytomas, Int. J. Clin. Exp. Pathol. 6 (2013) 1294–1305. [PMC free article] [PubMed] [Google Scholar]
  • [54].Saitoh O, Wang WC, Lotan R, Fukuda M, Differential glycosylation and cell surface expression of lysosomal membrane glycoproteins in sublines of a human colon cancer exhibiting distinct metastatic potentials, J. Biol. Chem. 267 (1992) 5700–5711. [PubMed] [Google Scholar]
  • [55].Furuta K, Ikeda M, Nakayama Y, Nakamura K, Tanaka M, Hamasaki N, et al. , Expression of lysosome-associated membrane proteins in human colorectal neoplasms and inflammatory diseases, Am. J. Pathol. 159 (2001) 449–455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [56].Künzli BM, Berberat PO, Zhu ZW, Martignoni M, Kleeff J, Tempia-Caliera AA, et al. , Influences of the lysosomal associated membrane proteins (Lamp-1, Lamp-2) and Mac-2 binding protein (Mac-2-BP) on the prognosis of pancreatic carcinoma, Cancer 94 (2002) 228–239. [DOI] [PubMed] [Google Scholar]
  • [57].Ozaki K, Nagata M, Suzuki M, Fujiwara T, Ueda K, Miyoshi Y, et al. , Isolation and characterization of a novel human lung-specific gene homologous to lysosomal membrane glycoproteins 1 and 2: significantly increased expression in cancers of various tissues, Cancer Res. 58 (1998) 3499–3503. [PubMed] [Google Scholar]
  • [58].Nakata K, Ohchida K, Mizumoto K, Aishima S, Oda Y, Nagai E, et al. , Micro RNA-373 is down-regulated in pancreatic cancer and inhibits cancer cell invasion, Ann. Surg. Oncol. (2014). [DOI] [PubMed] [Google Scholar]
  • [59].Powers JP, Li S, Jaen JC, Liu J, Walker NP, Wang Z, et al. , Discovery and initial SAR of inhibitors of interleukin-1 receptor-associated kinase-4, Bioorg. Med. Chem. Lett. 16 (2006) 2842–2845. [DOI] [PubMed] [Google Scholar]
  • [60].Srivastava R, Geng D, Liu Y, Zheng L, Li Z, Joseph MA, et al. , Augmentation of therapeutic responses in melanoma by inhibition of IRAK-1,−4, Cancer Res. 72 (2012) 6209–6216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [61].Rhyasen GW, Bolanos L, Fang J, Jerez A, Wunderlich M, Rigolino C, et al. , Targeting IRAK1 as a therapeutic approach for myelodysplastic syndrome, Cancer Cell 24 (2013) 90–104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [62].Behrens C, Feng L, Kadara H, Kim HJ, Lee JJ, Mehran R, et al. , Expression of interleukin-1 receptor-associated kinase-1 in non-small cell lung carcinoma and preneoplastic lesions, Clin. Cancer Res. 16 (2010) 34–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [63].Brookes MJ, Hughes S, Turner FE, Reynolds G, Sharma N, Ismail T, et al. , Modulation of iron transport proteins in human colorectal carcinogenesis, Gut 55 (2006) 1449–1460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [64].Liu Y, Lv L, Xue Q, Wan C, Ni T, Chen B, et al. , Vacuolar protein sorting 4B, an ATPase protein positively regulates the progression of NSCLC via promoting cell division, Mol. Cell. Biochem. 381 (2013) 163–171. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental figures tables
NIHMS1641174-supplement-Supplemental_figures_tables.pdf (833.1KB, pdf)

RESOURCES