Skip to main content
Mitochondrial DNA. Part B, Resources logoLink to Mitochondrial DNA. Part B, Resources
. 2019 Oct 7;4(2):3409–3411. doi: 10.1080/23802359.2019.1674708

The second complete mitogenome of Nemipterus virgatus to dissect control region structure and phylogenetic problem of the superfamily Sparoidea (Teleostei, Perciformes)

Ren-Xie Wu a, Yun Zhai a, Ben-Ben Miao a, Su-Fang Niu a,, Hao-Ran Zhang b, Fang Liu c, Chun-Xiao Ou c
PMCID: PMC7707243  PMID: 33366016

Abstract

In this study, we determined the complete mitogenome of Nemipterus virgatus of which the length was 17,073 bp, including 37 canonical mitochondrial genes and 2 non-coding regions. The control region contained termination associated sequence domain (TAS), central conserved domain (CSB-F, CSB-E, CSB-D, CSB-C, and CSB-A), conserved sequence block domain (CSB-1, CSB-2, and CSB-3), and tandem repeat sequence domain (TTD). Nine single nucleotide polymorphisms and three insertion of tandem repeat sequence (each length in 28 bp) were detected between two N. virgatus mitogenomes. The phylogenetic analysis showed that the families Nemipteridae, Sparidae, Centracanthidae, and Lethrinidae did not gather into a monophyly of superfamily Sparoidea in the neighbor-joining tree.

Keywords: Nemipterus virgatus, mitogenome, control region, Sparoidea


The golden threadfin bream Nemipterus virgatus (Houttuyn 1782) is one of the most widespread and abundant species of the family Nemipteridae (Teleostei, Perciformes), ranging from southern Japan to northwestern Australia and Arafura Sea (Russell 1990, p. 60). It is a benthic fish that usually inhabits muddy or sandy bottoms of the continental shelf at depths to 200 m, supporting an important commercial marine fishery in the southern part of the East China Sea and the northern South China Sea (Liu et al. 2016. p. 206). The previous studies of N. virgatus mainly reported on resource and fishery biology and little is known about its genetic background. Although the complete mitogenome of N. virgatus has been sequenced by Wu and Li (2016), its control region structure and the relationships of Nemipteridae and associated families were not analysed. Here we sequenced another complete mitogenome of N. virgatus to dissect control region structure and the phylogenetic problem of the superfamily Sparoidea.

One specimen of N. virgatus was obtained by longline fishing in October 2010 from Guangdong Leizhou Rare Marine Life National Nature Reserve, Beibu Gulf, the South China Sea (20°38′52″N, 109°43′28″E). It was preserved in 95% ethanol and deposited in Guangdong Ocean University (20101023059). The complete mitogenome of N. virgatus (GenBank accession number: KU933270) amplified by designing 15 primer pairs, and it was 17,073 bp in length with a slight bias towards A + T (GC ratio is 42.93%). It contained 13 protein-coding genes, 22 tRNA genes, and 2 rRNA genes, and 2 non-coding regions, with a similar gene order to other nemipterids (Li et al. 2016; Wu and Li 2016; Wu et al. 2016, 2017; Zhai et al. 2019). By comparing with previous N. virgatus mitogenome (KR701906; Wu and Li 2016), only 9 single nucleotide polymorphisms (SNPs) were identified, indicating the low level of genetic diversity in the species. Among them, one SNP was detected in each of 12SrRNA, 16S rRNA, ATPase6 and ND4 genes, but four SNPs were found in ND5 gene, suggesting that ND5 gene has higher variation than other mitochondrial protein-coding genes.

Four domains the termination associated sequence domain (TAS), the central conserved domain (CCD), the conserved sequence block domain (CSB) and tandem repeat sequence domain (TTD), were identified in the control region of N. virgatus. According to Guo et al. (2003) report, one extended terminal associated sequence (ETAS: TACATTACTATGTATTATCACCATATTATGTTTTTAACCA), two repeated TAS motif (TACAT) and one complementary TAS (cTAS) motif (ATGTA), were found in the TAS of N. virgatus. All the six conserved sequences of CCD, namely, CSB-F, CSB-E, CSB-D, CSB-C, CSB-B, CSB-A, can be identified in N. virgatus. The first three are easily identified according to their general sequences described by Lee et al. (1995), while the latter three are recognised according to their core sequences: GCATAAGTT, ATGGCG, CCATGCCGG, respectively. The CSB1 (ATAATTAGAATTCATGAGCATAA) in N. virgatus can be determined by its most conserved partial sequence among fishes, while the CSB2 and CSB3 were easily identified by containing two series of C-sequences at TA interval and riching in A and C characteristics, respectively. Nine tandem repeat sequences (TRS), each of 28 bp in length, were detected in the TTD, which were three more than those previously reported by Wu and Li (2016). Such genetic variation supports that the control region could be developed molecular markers for studying the intraspecific micro-evolutionary of N. virgatus.

To test the hypothesis that four families Nemipteridae, Sparidae, Centracanthidae, and Lethrinida are classified as a monophyletic group of superfamily Sparoidea (Johnson 1980; Russell 1990), a total of 32 complete mitogenome sequences of the Percoidei were used for constructing bootstrapped neighbor-joining (NJ) phylogenetic tree using MEGA6.06 programme (Tamura et al. 2013). In NJ tree (Figure 1), six species of Nemipterus and Scolopsis were grouped monophyly of family Nemipteridae at the basal position of Percoidei, while the three associated families (Sparidae, Centracanthidae, Lethrinidae) were gathered into another clade with other 4 families. Obviously, this study does not support the hypothesis that the four families should be classified as a superfamily Sparoidea, although they have morphological similarities.

Figure 1.

Figure 1.

The neighbor-joining phylogenetic tree of Nemipterus virgatus and other 30 species of the Percoidei based on their complete mitogenome sequences. The bootstrap value was given for each branch.

Disclosure statement

No potential conflict of interest was reported by the authors.

References

  1. Guo XH, Liu SJ, Liu Y. 2003. Comparative analysis of the mitochondrial DNA control region in cyprinids with different ploidy level. Aquaculture. 224:25–38. [Google Scholar]
  2. Houttuyn M. 1782. Beschrijving van eenige Japansche visschen en andere zeeschepselen. Verh Holland Maatsch Wet Haarlem. 20:311–350. [Google Scholar]
  3. Johnson GD. 1980. The limits and relationships of the Lutjanidae and associated families. Bull Scripps Inst Oceanogr. 24:1–114. [Google Scholar]
  4. Lee WJ, Conroy J, Howell WH, Kocher TD. 1995. Structure and evolution of teleost mitochondrial control regions. J Mol Evol. 41:54–66. [DOI] [PubMed] [Google Scholar]
  5. Li YL, Chen JH, Yan BL, Meng XP. 2016. The complete mitochondrial genome of the Japanese threadfin bream, Nemipterus japonicus (Teleostei, Nemipteridae). Mitochondr DNA A. 27:429–430. [DOI] [PubMed] [Google Scholar]
  6. Liu J, Wu RX, Kang B, Ma L. 2016. Fishes of Beibu Gulf. Beijing: Science Press. (Chinese) [Google Scholar]
  7. Russell BC. 1990. Nemipterid fishes of the world. (threadfin breams, whiptail breams, monocle breams, dwarf monocle breams, and coral breams). Family Nemipteridae. An annotated and illustrated catalogue of Nemipterid species known to date. FAO Fisheries Synopsis No. 125 Vol 12 Rome: FAO. [Google Scholar]
  8. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 30:2725–2729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Wu ZJ, Li XM. 2016. Complete mitochondrial genome of the Nemipterus virgatus (Perciformes: Nemipteridae). Mitochondr DNA A. 27:3485–3486. [DOI] [PubMed] [Google Scholar]
  10. Wu RX, Niu SF, Qin CX, Liu J. 2016. Complete mitochondrial genome of the yellowbelly threadfin bream, Nemipterus bathybius (Perciformes, Nemipteridae). Mitochondr DNA A. 27:4624–4626. [DOI] [PubMed] [Google Scholar]
  11. Wu RX, Liu J, Niu SF, Zheng J. 2017. The complete mitochondrial genome of Scolopsis vosmeri and phylogenetic relationship of genus Scolopsis. Mitochondr DNA A. 28:81–82. [DOI] [PubMed] [Google Scholar]
  12. Zhai Y, Niu SF, Wu RX, Miao BB, Liu F, Ou CX. 2019. Complete mitochondrial genome and phylogenetic relationship of ornate threadfin bream, Nemipterus hexodon (Perciformes, Nemipteridae). Mitochondr DNA B. 4:2506–2508. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Mitochondrial DNA. Part B, Resources are provided here courtesy of Taylor & Francis

RESOURCES