SATB1 PROMOTION OF TROPHOBLAST STEM CELL RENEWAL THROUGH REGULATION OF THREONINE DEHYDROGENASE

Abstract

BACKGROUND:

Trophoblast stem (TS) cell renewal and differentiation are essential processes in placentation. Special AT-rich binding protein 1 (SATB1) is a key regulator of the TS cell stem state. In this study, we identified SATB1 downstream targets and investigated their actions.

METHODS:

RNA-sequencing analysis was performed in Rcho-1 TS cells expressing control or Satb1 short hairpin RNAs (shRNAs) to identify candidate SATB1 targets. Differentially regulated transcripts were validated by reverse transcription-quantitative polymerase chain reaction. The role of a target of SATB1, L-threonine 3-dehydrogenase (TDH), in the regulation of trophoblast cell development was investigated using a loss-of-function approach.

RESULTS:

Among the differentially regulated transcripts in SATB1 knockdown TS cells, were downregulated transcripts known to affect the TS cell stem state and upregulated transcripts characteristic of trophoblast cell differentiation. Tdh expression was exquisitely responsive to SATB1 dysregulation. Tdh expression was high in the TS cell stem state and decreased as TS cells differentiated. Treatment of Rcho-1 TS cells with a TDH inhibitor or a TDH specific shRNA inhibited cell proliferation and attenuated the expression of TS cell stem state-associated transcripts and elevated the expression of trophoblast cell differentiation-associated transcripts. TDH disruption decreased TS cell colony size, Cdx2 expression, and blastocyst outgrowth.

CONCLUSIONS:

Our findings indicate that the actions of SATB1 on TS cell maintenance are mediated, at least in part, through the regulation and actions of TDH.

GENERAL SIGNIFICANCE:

Regulatory pathways controlling TS cell dynamics dictate the functionality of the placenta, pregnancy outcomes, and postnatal health.

1. Introduction

The placenta is a transient but essential organ for nourishing the fetus through the production of hormones targeting maternal tissues, the exchange of gas and nutrients, and immunoprotection between mother and fetus (1–3). These tasks are accomplished by specialized trophoblast cells differentiating from trophoblast stem (TS) cells (4, 5). TS cells arise from polar trophectoderm of the blastocyst or extraembryonic ectoderm, can be propagated in vitro, and maintained in a stem state or induced to differentiate (6–9). The TS cell stem state is known to be achieved by orchestrated regulatory networks involving key transcription factors, including caudal type homeobox 2 (CDX2), eomesodermin (EOMES), GATA binding protein 3 (GATA3), estrogen related receptor beta (ESRRB), TEA domain transcription factor 4 (TEAD4), and transcription factor AP-2 gamma (TFAP2C) (6–9). Dysregulation of these key factors leads to pregnancy loss due to extraembryonic hypoplasia (10–17). Therefore, understanding molecular mechanisms underlying TS cell renewal is important for proper extraembryonic and embryonic development.

Development is precisely regulated through the actions of transcription factors and also through higher order organization of chromatin (18–20). Special AT-rich binding protein 1 (SATB1) was first identified as a chromatin organizer in thymocytes (21–24). Subsequently, it was found that SATB1 functions in other tissues and cell types as a regulator of stem cells and cell transformation (25–27). In embryonic stem (ES) cells, SATB1 regulates the balance between self-renewal and differentiation by repressing Nanog homeobox (NANOG) expression (26). SATB1 depletion directs ES cell differentiation toward epiblast cells and hinders primitive endoderm lineage development (28). In the trophoblast cell lineage, SATB1 is highly expressed in trophoblast stem/progenitor cells of the ectoplacental cone and maintains TS cell renewal in mouse and rat TS cells and in the rat Rcho-1 TS cell model (27). Mechanisms underlying SATB1 action in TS cells are poorly understood.

In this study, we provide insights into SATB1 actions on trophoblast cell development. Rat Rcho-1 TS cells and ex vivo rat blastocysts were used as model systems to elucidate downstream SATB1 signaling. Rcho-1 TS cells can be maintained in a stem/undifferentiated state or induced to differentiate (29) and are exquisitely sensitive to SATB1 manipulation (27). L-threonine 3-dehydrogenase (TDH) was identified as a mediator of SATB1 actions on trophoblast cell development. TDH is the rate limiting enzyme responsible for the conversion of threonine into glycine and acetyl-coenzyme A (30) and is essential for maintenance of mouse embryonic stem cell self-renewal (30). The experimental findings described in this report demonstrate that TDH also contributes to SATB1 maintenance of the TS cell stem state.

2. Materials and methods

2.1. Animals

Holtzman Sprague-Dawley rats were obtained from Envigo (Indianapolis, IN). Animals were housed in an environmentally controlled facility with lights on from 0600 to 2000 h and were allowed free access to food and water. The presence of a seminal plug or sperm in the vaginal lavage was designated day 0.5 of pregnancy and blastocysts were collected by uterine flushing on day 4.5 of pregnancy. The University of Kansas Animal Care and Use Committee approved protocols for the care and use of animals.

2.2. Rcho-1 TS cells

Rcho-1 TS cells were maintained in stem state medium [RPMI-1640 culture medium (Life Technologies, Grand Island, NY) supplemented with 20% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO), 50 μM 2-mercaptoethanol (Sigma-Aldrich), 1 mM sodium pyruvate (Life Technologies), 100 μM penicillin, and 100 U/ml streptomycin (Life Technologies)] and passaged with trypsin-EDTA (Thermo Fisher, Pittsburgh, PA) (29, 31, 32). Differentiation was induced by replacing stem state medium with differentiation promoting medium [NCTC-135 medium (Sigma-Aldrich) supplemented with 1% horse serum (Life technologies), 50 μM 2-mercaptoethanol, 1 mM sodium pyruvate, 10 mM HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 38 mM sodium bicarbonate, 100 μM penicillin, and 100 U/ml streptomycin (Thermo Fisher)]. Stem state cells were collected within 48 h of subculture and differentiated cells were maintained for 8 days in differentiation medium prior to harvesting.

2.3. TDH inhibitor treatment

Rcho-1 TS cells or blastocysts were treated with Qc1, a TDH specific inhibitor (Calbiochem, San Diego CA) at 1, 10, 30, 90 nM concentrations. Dimethyl sulfoxide (DMSO) was used as vehicle for Qc1. Equivalent concentrations of DMSO were present in control or treated cell cultures (0.1% final concentration of DMSO).

2.4. Short hairpin RNA (shRNA) constructs and production of lentiviral particles

Two Satb1 shRNAs were designed and subcloned into pLKO.1 using AgeI and EcoRI restriction sites (27). A previously published Tdh shRNA sequence (33) was subcloned into pLKO.1 using AgeI and EcoRI restriction sites. A control shRNA that does not target any known mammalian gene, pLKO.1-shSCR (plasmid 1864), was obtained from Addgene (Cambridge, MA). Sequences representing the sense target site for each of the shRNAs used in the analyses are provided in Table 1. Second-generation lentiviral packaging vectors (Addgene) were used to produce lentiviral particles. Culture supernatants containing lentiviral particles were harvested every 24 h for two to three days, centrifuged to remove cell debris, filter sterilized, concentrated by Lenti-X concentrator (Clontech, Mountain View, CA), and stored at −80°C until used.

Table 1.

shRNA sequences

Target gene	Target sequence
Scr (Ctrl)	cctaaggttaagtcgccctc
Satb1 #1	ggtggtacaaacatttcaaga
Satb1 #2	ggaaatgaagcgtgctaaagt
Tdh	ctggcccatgattctagatga

2.5. In vitro lentiviral transduction

Rcho-1 TS cells were exposed to lentiviral particles, selected with puromycin dihydrochloride (Sigma-Aldrich; 3 μg/ml) for two days, and then removed during in vitro analysis.

2.6. Ex vivo blastocyst lentiviral transduction

Rat embryos were transduced with lentiviral particles as previously described (34–37). Blastocyst outgrowth analysis was performed as reported before (38, 39). Briefly, blastocysts were treated with Acid Tyrode’s solution (Millipore, Darmstadt, Germany) to remove the zona pellucida from each blastocyst and incubated with concentrated lentiviral particles for 4.5 h. Transduced blastocysts were cultured ex vivo in TS Cell Complete Medium [RPMI 1640 (Cellgro, Herndon, VA), 20% FBS (Atlanta Biologicals, Norcross, GA), 100 μM 2-mercaptoethanol (Sigma-Aldrich, St. Louis, MO), 1 mM sodium pyruvate (Cellgro, Herndon, VA), 50 μM penicillin and 50 U/ml streptomycin (Cellgro)] supplemented with 70% rat embryonic fibroblast conditioned medium, fibroblast growth factor 4 (25 ng/ml; Sigma-Aldrich) and heparin (1 μg/ml; Sigma-Aldrich) for blastocyst outgrowth analysis. After 4 days the attached blastocysts were either fixed in 4% paraformaldehyde solution, or collected for RNA isolation (Picopure RNA Isolation Kit, Thermo Fisher, Waltham, MA). The surface area of blastocyst outgrowth was visualized using light microscopy and measured using Image J software.

2.7. RNA-seq analysis

Transcriptomic profiles in control shRNA and Satb1 shRNA knockdown Rcho-1 TS cells (n=3 each) were performed using RNA-seq analysis. Complementary DNA libraries from total RNA samples were prepared with Illumina TruSeq RNA sample preparation kits (Illumina, San Diego, CA). Five hundred ng of total RNA were used as input. Polyadenylated RNAs were purified with oligo-deoxythymine-coated magnetic beads. RNA fragmentation, first and second strand cDNA synthesis, end repair, adaptor ligation, and PCR amplification were performed according to the manufacturer’s recommendations. The cDNA libraries were validated for RNA integrity using an Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA) before sequencing.

cDNA libraries were clustered onto a TruSeq paired-end flow cell, and sequenced (100 bp paired-end reads) using a TruSeq 200 cycle SBS kit (Illumina). Samples were run on an Illumina HiSeq2000 sequencer and sequenced in parallel with other samples to ensure the data generated for each run were accurately calibrated during data analysis. Following generation of sequencing images, the pixel-level raw data collection, image analysis, and base calling were performed by Real Time Analysis software (Illumina). The base call files (*.bcl) were converted to *.qseq files by Illumina’s BCL Converter, and the *.qseq files were subsequently converted to *.fastq files for downstream analysis. Reads from *.fastq files were mapped to the rat reference genome (Ensembl Rnor_5.0.78) using CLC Bio Genomics Workbench 7.0 (Qiagen, Redwood City, CA). The mRNA abundance was expressed in reads per kilobase of exon per million reads mapped (RPKM). Statistical significance was calculated by empirical analysis of digital gene expression in the CLC Bio Genomics Workbench. A corrected false discovery rate (FDR) of 0.05 was used as a cutoff for significant differential expression (control vs Satb1 knockdown). Functional patterns of transcript expression were further analyzed using Ingenuity Pathway Analysis (IPA, Qiagen). Results from the RNA-seq analysis were validated using RT-qPCR.

2.8. Cell proliferation analysis

Rcho-1 TS cells were plated at 1.25 × 10⁴ cells/cm² density. Cells treated with inhibitor or TDH knockdown were trypsinized and counted using hemocytometer at 24 h intervals.

2.9. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RNA was extracted using TRI reagent (Sigma-Aldrich) according to the manufacturer’s instructions. cDNAs were reverse transcribed from RNA by using High Capacity cDNA synthesis kit from Applied Biosystems (Foster City, CA) according to the manufacturer’s instructions. Power SYBR Green PCR Master Mix (Applied Biosystems) was used in the PCR. Reactions were processed using a 7500 Real-Time PCR system (Applied Biosystems). Conditions included an initial holding stage (50°C for 2 min and 95°C for 10 min) and 40 cycles (95°C for 15 s and 60°C for 1 min) followed by a dissociation stage (95°C for 15 s, 60°C for 1 min, and then 95°C for 15 s). Primers used in the analyses are provided in Table 2. The comparative cycle threshold method (ΔΔCT) was used for relative quantification of the amount of mRNA normalized to 18S RNA. Values are presented relative to controls for each gene.

Table 2.

Specific primer sequences used for RT-qPCR analysis

Target gene	Forward Primer	Reverse Primer	Accession Number
18s	gcaattattccccatgaacg	ggcctcactaaaccatccaa	NR_046237.1
Satb1	agatgcagggagtgccttta	tgctcctccttgcaatcata	NM_001012129.2
Tdh	acgattggagcctttggacc	gcagcgtggaaaatctggac	NM_001106044.1
Bambi	atggatcgccactccagcta	ccagagtggttttgggcctg	NM_139082.3
Adam15	gtgactgtggcttcccagat	cctctccactagcacaaggc	NM_020308.1
Bmp4	cgcagcttctctgagccttt	acgaccatcagcattcggtt	NM_012827.2
Id1	atcagtgccttggcggc	ctggaggctgaaaggtggag	NM_012797.2
Irx1	ggtgctccatggtgagaagg	ccccttaatcaggcagacg	NM_001107331.1
Esrp1	gggcactttaaatcgaaatggct	ctattaggcgaacctggggg	NM_001127564.2
S1pr1	cggatcgcgcggtgtaga	aaacgctagagggcgaggttg	NM_017301.2
Klf5	gctcacctgaggactcatacg	ttctggtggcgcttcatgtg	NM_053394.2
Eomes	ccacgtctacctgtgcaacc	ttgccctgcatgttattgtc	XM_008766711.1
Fgfr2	ccctgcggagacaggtaac	gcgtcagcttatctctgggg	NM_001109892.1
Cdx2	cgtccctaggaagccaagtg	ttggctctgcggttctgaaa	NM_023963.1
Zbtb7b	ctaagttcgctgcaccagga	tgcttccgcatgtggatctt	NM_001106446.1
Kctd15	tgtttgtgatctcagcagtgt	tgagtgacagccgggacata	NM_001109141.1
Dusp4	tctactcggctgtcatcgtct	tcagaagaaaacctctcatagcc	NM_022199.1
Esrrb	ggcgttcttcaagagaacca	cccactttgaggcatttcat	NM_001008516.2
Tpbpa	gcaagagcagaagggtaaagaagg	tttctatgtcgagctcctcctcct	NM_172073
Prl3d1	acgcccatgatcttgcttca	tggcaggggcttaacatcag	NM_012535.3
Prl7b1	tcatactgtctcagcacatcaat	atccttttggcttccttttctg	NM_153738.1
Cyp11a1	acaagctgcccttcaagaac	cgcagcatctcctgtacctt	NM_017286.2

2.10. Primary antibodies

Antibodies to CDX2 (ab76541, Abcam, Cambridge, MA), GATA3 (L50–823, BD Biosciences, San Jose, CA), ID1(ab134163, Abcam), OCT4 (C-10, Santa Cruz Biotechnologies, Santa Cruz, CA), SATB1 (P472, Cell Signaling Technologies, Danvers, MA), NANOG (MAB10091, Chemicon International, Temecula, CA), and TDH (40) were used for western blotting and/or immunocytochemistry.

2.11. Western blotting

Whole-cell lysates were prepared in lysate buffer (Cell Signaling Technology). Lysates were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Separated proteins were electrophoretically transferred to polyvinylidene difluoride membranes. Blots were probed with the designated antibodies overnight at 4°C, followed by incubation with horseradish peroxidase-conjugated secondary antibodies to rabbit (Cell Signaling Technology) for 1 h at room temperature. Reaction products were visualized by incubation with Luminata Western HRP Substrates according to the manufacturer’s instructions (Millipore).

2.12. Immunocytochemistry

Blastocysts were fixed in 4% paraformaldehyde, washed with phosphate buffered saline (PBS, pH 7.4), and permeabilized in PBS containing 0.25% Triton X100. Following a blocking step in 10% normal goat serum for 30 min, embryos were incubated with the designated primary antibodies overnight at 4°C and subsequently with secondary antibodies for an additional 30 min at room temperature. We used a secondary goat anti-rabbit antibody conjugated with Alexa Fluor® 488 (Thermo Fisher) or Alexa Fluor® 568 (Thermo Fisher). Fluorescence images were captured using a Leica DMI 4000 microscope equipped with a charge-coupled device camera (Leica Microsystems GMbH, Welzlar, Germany).

2.13. Statistical analyses

Values are expressed as the mean ± the standard error of the mean (SEM). All experiments were conducted at least in triplicate and were replicated two to three times. Statistical comparisons between two means were evaluated with Studen’s t test. Analysis of variance and Tukey’s post hoc tests were used in assessing differences among three or more means using GraphPad Prism (GraphPad Software Inc, La Jolla, CA).

3. Results

3.1. Identification of SATB1 targets

Specific SATB1 knockdown was achieved by lentiviral transduction of two different shRNAs targeting the Satb1 gene in Rcho-1 TS cells (27, Fig. 1A and B). Global expression analysis using RNA-sequencing (RNA-seq) was performed in SATB1 knockdown TS cells at four days (experimentally defined as “Acute”) and ten days (experimentally defined as “Chronic”) after transduction (Fig. 1C and D). Differentially regulated genes were identified in SATB1 knockdown TS cells (Fig. 1C). Transcripts identified by RNA-seq analysis were further validated by RT-qPCR (Fig. 1E). Downregulated-transcripts included TS cell stem state-associated transcripts (e.g. Tdh, Bambi, Adam15, Bmp4, Id1, Irx1, Esrp1, S1pr1, Klf5, Eomes, Fgfr2, Cdx2, Zbtb7b, Kctd15, Dusp4, and Esrrb) and were linked to pathways such as cell proliferation and survival. In contrast, upregulated-transcripts, included trophoblast cell differentiation-associated transcripts (e.g. Tpbpa, Prl3d1, Prl7b1, and Cyp11a1) and were linked to pathways such as cell movement and angiogenesis (Fig. 1D and E). Inhibition of stem state-associated transcripts occurred four days following initiation of SATB1 knockdown; however, evidence of a significant impact on differentiation-associated transcripts was not apparent until ten days following initiation of SATB1 knockdown.

Fig. 1. Identification of SATB1 downstream targets.

A,B) SATB1 knockdown efficiency was validated by RT-qPCR (A) or western blot (B) analyses in Rcho-1 TS cells expressing control (Ctrl) or Satb1 specific shRNAs. C–E) RNA-seq analysis identified transcripts responsive to acute or chronic SATB1 knockdown (C). D) Ingenuity Pathway Analysis categorized SATB1 downstream targets contributing to “cell proliferation”, “cell differentiation” and “cell survival”. E) Selected transcripts identified by RNA-seq analysis were validated by RT-qPCR. Bars represent the mean ± standard error of the mean (SEM). Values significantly different from controls are indicated with an asterisk (*P<0.05).

3.2. TDH expression

Among SATB1 downstream targets, Tdh expression was exquisitely responsive to SATB1 dysregulation (Fig. 1E). TDH catalyzes the conversion of threonine into glycine and acetyl-CoA and has been reported to regulate pluripotency in ES cells (30, 33, 40, 41). This prompted an evaluation of role of TDH in TS cells. First, we analyzed the expression of TDH in Rcho1-TS cells and rat blastocysts. Tdh expression was high in the stem state and decreased following trophoblast cell differentiation (Fig. 2A). Within blastocysts, TDH was expressed in both POU domain class 5 homeobox 1 (POU5F1, also called OCT4)-positive inner cell mass and the GATA3-positive trophectoderm (Fig. 2B and C). The latter placed TDH in a position to potentially regulate trophoblast cell lineage development.

Fig. 2. TDH expression in trophoblast cells and blastocysts.

A) Tdh expression by RT-qPCR in stem (Stem) or differentiated (Diff) Rcho-1 TS cells. B) Schematic depiction of a day 4.5 rat blastocyst. Trophectoderm constitutes the outer layer of the blastocyst (GATA3-positive). ICM, inner cell mass (OCT4-positive). C) Immunohistochemical analyses of TDH, OCT4, and GATA3 expression in rat blastocysts. The boxed areas are higher magnification and represented in the far-right panels. Arrows indicate TDH expression in OCT4-negative and GATA3-positive TS cells. Note; Both ICM and trophectoderm are TDH-positive. Scale bar=50 μm.

3.3. Functional analysis of TDH in trophoblast cells

The function of TDH in trophoblast cells was then investigated. Rcho-1 TS cells were treated with a TDH specific inhibitor, Qc1, at a range of concentrations. Inhibitor treatment inhibited trophoblast cell proliferation in a dose dependent manner (Fig. 3A and B). Trophoblast giant cells (differentiated trophoblast cell subtype) were observed in the TDH inhibitor treated cells (Fig. 3B see arrow). Expression analysis confirmed that TDH inhibitor treatment decreased TS cell stem state-associated transcript expression (Cdx2 and Eomes) and increased trophoblast differentiation-associated transcript expression (Tpbpa and Prl3d1) (Fig. 3C). A complementary loss-of-function approach using lentiviral transduction of shRNAs targeting Tdh was also performed (Fig. 3D). Similar to TDH inhibitor treatment, Tdh knockdown inhibited trophoblast cell proliferation and promoted trophoblast cell differentiation (Fig. 3E–G).

Fig. 3. TDH regulation of trophoblast cell proliferation.

A–C) Rcho-1 TS cells were plated at 12,500 cells/cm² and cultured for three days with 10, 30 or 90 μM of the TDH inhibitor (Qc1). DMSO was used as a vehicle control (Ctrl). A) Cell numbers were counted every 24 h. B) Representative images at 72 h of treatment. Scale bar=200 μm. C) Cdx2, Eomes, Tpbpa and Prl3d1 transcripts were measured by RT-qPCR. D–G) Gene specific knockdown of TDH was achieved by transduction of Rcho-1 TS cells with lentiviral vectors expressing control (Ctrl) or Tdh specific shRNAs. D) Tdh knockdown efficiency was validated by RT-qPCR analysis. E) Rcho-1 TS cells expressing control (Ctrl) or Tdh shRNAs were plated at 12,500 cells / cm² and cultured for three days. Cell numbers were counted every 24 h. F) Representative images at 72 h of culture. Scale bar=200 μm. G) Cdx2, Eomes, Tpbpa and Prl3d1 transcripts were measured by RT-qPCR. Bars represent the mean ± SEM. Values significantly different from controls are indicated with an asterisk (*P<0.05).

3.4. Effect of TDH on ex vivo blastocyst outgrowth

TDH actions were also investigated in an ex vivo blastocyst outgrowth assay. In this experiment, culture conditions were used that facilitate formation of CDX2- and ID1-positive TS cell colonies without sustaining OCT4- and NANOG-positive embryonic cells (Fig. 4A). TDH inhibitor treatment decreased blastocyst outgrowth and TS cell colony areas, and decreased TS cell stem state-associated transcript expression (Fig. 4B–E). Similarly, TDH knockdown suppressed TS cell colony area and TS cell stem state-associated transcript expression (Fig. 4F–I).

Fig. 4. TDH regulation of blastocyst outgrowth.

Rat blastocysts were cultured in Complete TS cell medium. They attached, expanded and formed TS cell colonies with partial cell differentiation. A) Immunohistochemical analysis confirmed that these TS cell colonies were positive for TS markers (CDX2 or ID1), but negative for ES markers (OCT4 or NANOG). Scale bar=100 μm. B-E) Blastocyst outgrowth assays were performed in TS medium containing 10 or 30 μM of the TDH inhibitor (Qc1). DMSO was used as a vehicle control (Ctrl). B) Representative images. Scale bar=100 μm. Blastocysts did not form TS cell colonies in the presence of 30 μM TDH inhibitor. C,D) Total area of blastocyst outgrowths (C) or the area of individual TS cell colonies (D) were measured. E) Cdx2 and Eomes expression were measured by RT-qPCR. F–I) Lentiviral control (Ctrl) or Tdh shRNAs were delivered to day 4.5 denuded blastocysts and blastocyst outgrowth assays were performed. F) Representative images. Scale bar=100 μm. G,H) Total area of blastocyst outgrowths (G) or the area of individual TS cell colonies (H) were measured. I) Cdx2 and Eomes expression were measured by RT-qPCR. Each bars is based on n=23 outgrowths and represents the mean ± SEM. Values significantly different from controls are indicated with an asterisk (*P<0.05).

Collectively, the results indicate that TDH acts downstream of SATB1 contributing to the maintenance of the TS cell stem state.

4. Discussion

Specific transcriptional networks essential for TS cell renewal have been identified (6, 7). SATB1 contributes to the regulation of the TS cell stem state through organizing transcriptional networks (27). We performed global transcriptome analysis in control and SATB1 knockdown Rcho-1 trophoblast cells to identify potential pathways controlling trophoblast cell development. SATB1 regulated transcripts essential for stem state maintenance consistent with the known actions of SATB1 in promoting trophoblast cell proliferation and inhibiting trophoblast cell differentiation (27). SATB1 regulated the expression of transcription factors known to be important in maintaining the TS cell stem state, such as Cdx2, Id2, and Eomes. We also identified putative mediators of SATB1 actions in trophoblast cells, including TDH. Silencing TDH via a small molecule inhibitor or a TDH-specific shRNA mimicked phenotypes of trophoblast cells treated with shRNAs to SATB1 (27). SATB1 and TDH contribute to the maintenance of the TS cell stem state and inhibit trophoblast cell differentiation (Fig. 5).

Fig. 5.

Schematic diagram showing SATB1 acts to promote maintenance of the TS cell stem state and inhibition of trophoblast cell differentiation through upregulation TDH.

SATB1 possesses profound actions on the TS cell transcriptome; however, the mechanism of its actions is not fully understood. SATB1 interacts with AT-rich regions of the genome to build scaffolds of chromatin structure that lead to optimal DNA replication and gene transcription (24). AT-rich regions are also the target of N⁶-methyladenine (N⁶-mA) modification (42). N⁶-adenine methylation inhibits the ability of SATB1 to interact with its target regions within the genome and interferes with SATB1 actions on TS cell development (43). alkB homolog 1, histone H2A, dioxygenase (ALKBH1) is an N⁶-mA demethylase that has also been shown to be critical for trophoblast cell development and placentation (43, 44). ALKBH1 appears to demethylate genomic regions critical for SATB1 action (43). Whether any of the regulatory regions of the downstream SATB1 target genes identified in our RNA-seq analysis, including Tdh, are subject to N⁶-adenine methylation is not known. We also do not know whether the actions of SATB1 on Tdh gene expression are through direct interaction with regulatory regions controlling the Tdh gene or are indirect through the regulation of other transcriptional regulators (e.g. Eomes, Id2, Cdx2).

Interfering with the actions of SATB1 or TDH in TS cells is not compatible with maintenance of the stem cell state. The cellular response to SATB1 or TDH knockdown was activation of the trophoblast giant cell differentiation program. This observation is similar to ‘compensatory and prioritized differentiation’ described when the stem state is interrupted in mouse embryonic stem cells and TS cells exposed to various cell stressors (45, 46).

The mechanism of TDH action on maintenance of the TS cell stem state is of interest. Some developmental regulators show restricted expression and action on trophectoderm or inner cell mass (ICM) cell lineages, such as CDX2 and OCT4, respectively (47), while others are expressed and act on both lineages, such as SATB1 and TDH (26–28, present study). Thus, context is important in understanding the actions of both SATB1 and TDH. It was previously reported that ES cell growth, as well as embryonic development, is dependent on threonine (30, 40). TDH catabolic generation of both glycine and acetyl coenzyme A are required for S-adenosylmethionine synthesis, which is a requisite co-substrate for histone methylation. Without threonine, ES cells lose histone 3 lysine 4 methylation, negatively impacting their capacity to proliferate and increasing terminal differentiation and cell death (30, 33, 40, 41). Consequently, similar to its actions in ES cells, TDH may contribute to maintenance of the TS cell stem state through the production of an essential co-substrate required for optimal epigenetic regulation. The overall importance of TDH within the spectrum of SATB1 actions on TS cell development is not apparent. Attempting to rescue the SATB1 compromised TS cell phenotype with TDH could be informative.

Proper trophoblast cell development is prerequisite for a successful pregnancy outcome. In this study, we identified TDH as a downstream target of SATB1 in trophoblast cells. Silencing either SATB1 or TDH directly leads to loss of the TS cell stem state and promotion of trophoblast differentiation. We conclude that SATB1 regulation of TS cells is mediated, at least in part, through the actions of TDH.

Highlights.

• Trophoblast stem cell expansion and differentiation are essential for placentation

• SATB1 promotes maintenance of the trophoblast stem cell stem state

• SATB1 regulates TDH expression in trophoblast stem cells

• TDH mediates some of the actions of SATB1 on trophoblast stem cells