Skip to main content
ZooKeys logoLink to ZooKeys
. 2020 Nov 24;996:1–18. doi: 10.3897/zookeys.996.54602

A report of a new species and new record of Cadlina (Nudibranchia, Cadlinidae) from South Korea

Thinh Dinh Do 1, Dae-Wui Jung 1, Hyun-Jong Kil 3, Chang-Bae Kim 1,
PMCID: PMC7710686  PMID: 33312043

Abstract

Of the four species in the genus Cadlina present in the northwestern Pacific region, C. japonica has been the only species recorded from South Korea. For the purpose of investigating Cadlina in Korean waters, specimens were collected from the Korean East Sea (Sea of Japan) by scuba diving. The radula and morphology of these specimens were examined by stereoscopic and scanning electron microscopy. Based on morphology, three species were identified in Korean waters, including the new species, Cadlina koreanasp. nov., C. umiushi (first record in South Korea), and C. japonica. Cadlina koreanasp. nov. somewhat resembles C. umiushi but differs in both its morphology as well as the structure of its radula. The background color of Cadlina koreanasp. nov. is translucent white, tubercles on the dorsum are opaque white and the yellow marginal band is absent. The radular formula of Cadlina koreanasp. nov. is 57 × 23.1.23 with a rectangular rachidian tooth. In addition, mitochondrial cytochrome c subunit 1 (COI), 16S ribosomal RNA (16S rRNA), and nuclear 28S ribosomal RNA (28S rRNA) gene sequences were generated and used for analysis of Automatic Barcode Gap Discovery (ABGD) and reconstruction of the phylogenetic tree. Morphological distinction and genetic analyses confirm that three Cadlina species are present in Korean waters of which Cadlina koreana is a new species.

Keywords: Cadlina koreana sp. nov., description, northwestern Pacific region, morphology, phylogeny

Introduction

Cadlina Bergh, 1879 is a genus of slow-moving and flattened dorid nudibranchs (Korshunova et al. 2020). Cadlina species are reported as common dorid nudibranchs in northern temperate waters but become remarkably scarcer in tropical regions (Schrödl 2000). Recently, the genus was extensively reviewed by Korshunova et al. (2020). In that study, the authors described four new species and re-described C. umiushi Korshunova et al., 2015 and C. kamchatica Korshunova et al., 2015. Their findings increase the understanding of Cadlina species in the northern seas, especially in the northwestern Pacific region. To date, there have been four Cadlina species recorded in the northwestern Pacific region: C. japonica Baba, 1937, C. kamchatica, C. umiushi, and C. paninaeKorshunova et al., 2020. Of these, only C. japonica was previously recorded from South Korea by Choe and Lee (1994). Potentially, there are more Cadlina species present in Korean waters awaiting discovery.

Members of the nudibranch genus Cadlina generally have similar body shapes and coloration so it is a difficult task to distinguish them based on their morphology (Korshunova et al. 2020). DNA barcoding is widely reported as an effective tool for both the identification of known species and the discovery of new species (Hebert et al. 2003). Because of the difficulty in identifying Cadlina species from morphology only, molecular markers have been analyzed to improve the accuracy of species discrimination (Korshunova et al. 2020). Mitochondrial and nuclear markers such as COI, 16S rRNA, and 28S rRNA genes are often selected for analysis. In previous studies of nudibranchs, these markers were used in combination with a morphological examination to discover new species and separate species complexes (Lindsay and Valdés 2016; Korshunova et al. 2020).

This study aimed to investigate Cadlina species in Korean waters. For this purpose, eight specimens were collected for species identification. In addition, fragments of COI, 16S rRNA, and 28S rRNA genes from these specimens were sequenced and analyzed to compare with the morphological examinations.

Materials and methods

Sample collection and morphological examination

Cadlina species were collected from the Korean East Sea (Sea of Japan) by scuba diving. Upon collection, specimens were preserved in 10% neutral buffered formalin for morphological examination. In addition, small sample of tissue from the foot was stored in 95% ethanol for DNA extraction. Sample collection data and depositories are presented in Suppl. material 1: Table S1. A stereoscopic microscope (Nikon SMZ800N) was used to examine the specimens. The buccal mass was extracted under a stereo microscope for radula extraction. The buccal mass was placed in 10% KOH for two days at room temperature to dissolve muscle. The radula was then carefully removed from the solution and placed in deionized water for 20 minutes to remove excess KOH. The radulae were examined under a JEOL JSM-6390LV scanning electron microscope (Jeol Inc., USA). The reproductive systems were dissected under a stereoscopic microscope and drawn with a camera lucida. Morphological comparison and species descriptions were prepared following previous guidelines (Schrödl 2000; Chichvarkhin 2016; Korshunova et al. 2020).

Molecular analysis

Total DNA was extracted from the foot of each specimen using E.Z.N.A. Mollusc DNA Kit (Omega Bio-tek, USA). The quality and concentration of the extracted DNA were checked using a MaestroNano spectrophotometer (Maestrogen, Taiwan). Polymerase chain reaction (PCR) analysis was performed for two mitochondrial markers (COI and 16S rRNA) and one nuclear marker (28S rRNA). The primer set for each marker is listed in Table 1.

Table 1.

Primer sets of COI and 16S rRNA and 28S rRNA genes used in this study.

Primer Gene Sequence (5’-3’) genes Annealing temperature Reference
LCO1490 COI GGTCAACAAATCATAAAGATATTGG 45° Folmer et al. 1994
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
16Sar-L 16S rRNA CGCCTGTTTATCAAAAACAT 48° Palumbi 1996
16S R CCGRTYTGAACTCAGCTCACG Puslednik and Serb 2008
28S C1 28S rRNA ACCCGCTGAATTTAAGCAT 48° Hassouna et al. 1984
28S C2 TGAACTCTCTCTTCAAAGTTCTTTTC Le et al. 1993

The 20 μl PCR reaction mixture contained 10 μl of 2X TOPsimple DyeMIX-Tenuto (Enzynomics, South Korea), 1 μl of each primer (10 pmoles/μl), 100 ng of DNA, and distilled water. The amplification protocol was as follows: initial denaturation at 95 °C for 5 minutes, followed by 35 cycles of denaturation at 95 °C for 45 seconds, variable annealing temperature for each primer set as listed in Table 1 for 45 seconds, extension at 72 °C for 1 minute, and final elongation at 72 °C for 5 minutes. The PCR products were checked by electrophoresis in 1% agarose gels in 1× TAE buffer. Sequencing was performed by an ABI 3730 DNA Analyzer (Applied Biosystems, USA).

Consensus sequences were generated from the forward and reverse sequences with Geneious software version 9.1.8 (Kearse et al. 2012). The obtained sequences were submitted to GenBank and the sequence accession numbers are listed in Suppl. material 1: Table S1. The sequences were compared with sequences in GenBank using the BLAST tool to search for related species. Additionally, sequences of the genus Cadlina were obtained from GenBank for Automatic Barcode Gap Discovery (ABGD) analysis and phylogenetic reconstruction. The ABGD webtool (https://bioinfo.mnhn.fr/abi/public/abgd/abgdweb.html) was applied to delineate putative species based on COI and 16S rRNA sequences (Puillandre et al. 2012). The distance matrices for COI and 16S rRNA were built in MEGA X software using the Kimura 2-parameter model (Kumar et al. 2018). The default settings used for analysis were Pmin = 0.001, Pmax = 0.1, Steps = 10, X = 1.5, Nb bins = 20. All three different distance models are available from the ABGD webtool: Simple Distance, Jukes-Cantor (JC69), and Kimura (K80) TS/TV were tested (Puillandre et al. 2012).

Phylogenetic reconstruction of Cadlina species was conducted based on the concatenation of three markers (COI, 16S rRNA, and 28S rRNA) or two markers (COI and 16S rRNA) because there were no 28S rRNA sequences for some species. Two species of the genus Aldisa, A. sanguinea and A. smaragdina, in the family Cadlinidae were used as the outgroup. Before concatenation, each marker was aligned using the ClustalW method in MEGA X software (Kumar et al. 2018) and poorly aligned regions were trimmed by GBlocks 0.91b (Castresana 2000). The Akaike Information Criterion in jModelTest 2.1.10 was used to search for the best model for phylogenetic tree reconstruction (Darriba et al. 2012). The phylogenetic trees were reconstructed using both the Maximum Likelihood (ML) and Bayesian Inference (BI) methods. The ML phylogenetic tree was constructed using the GTR+G+I model with 1000 bootstrap replicates in MEGA X software (Kumar et al. 2018). The BI tree was reconstructed in MrBayes ver. 3.2.7a with two runs for 10 million generations and a sampling interval of 1000 generations (Ronquist et al. 2012).

Results

Morphological results

Cadlina koreana sp. nov.

A5DEA3ED-F668-5D0B-8508-7C0E6D448F98

http://zoobank.org/BDAF5119-92FB-499A-BD02-63EB7077ABED

Figures 1 , 4A

Figure 1.

Figure 1.

Cadlina koreanaA body; Radula B rachidian teeth C central and lateral region D outer lateral region. Scale bars: 2 mm (A); 10 μm (B); 50 μm (C); 20 μm (D).

Figure 4.

Figure 4.

Reproductive systems of Cadlina species ACadlina koreana sp. nov. BCadlina umiushiCCadlina japonica. Abbreviations: a, ampulla; bc, bursa copulatrix; fgm, female gland mass; rs, receptaculum seminis; pr, prostate; sv, seminal vesicle; ud, uterine duct; v, vaginal duct; vd, vas deferens. Scale bars: 0.5 mm (A, B); 2 mm (C).

Type material.

Holotype. NIBRIV0000865970; South Korea, Gangwon-do, Goseong-gun, Jugwang-myeon, Munamjin-ri; 38°18'14.75"N, 128°34'1.05"E; collected on 02 June 2013 (COI GenBank number: MT420429). Paratype. NIBRIV0000865971; South Korea, Gangwon-do, Goseong-gun, Jugwang-myeon, Munamjin-ri; 38°18'14.75"N, 128°34'1.05"E; collected on 02 June 2013 (COI GenBank number: MT420430).

Other material.

Voucher: SMU00051; South Korea, Gangwon-do, Goseong-gun, Jugwang-myeon, Munamjin-ri; 38°18'14.75"N, 128°34'1.05"E; collected on 02 June 2013 (COI GenBank number: MT420431).

Diagnosis.

Ground color translucent white (Fig. 1A). Rhinophores and gills opaque white to translucent yellow. Entire dorsum covered by small rounded tubercles with white coloration. Radula formula 57 × 23.1.23. Rachidian tooth rectangular with four main sharp cusps (Fig. 1B). Innermost lateral teeth massive, wide base; cusp strong, slightly curved; two inner denticles and three to four outer denticles (Fig. 1C). Outer lateral teeth hamate, well-defined denticles (Fig. 1D).

Description.

Body elongated ovate; body lengths 10.3 mm (holotype), 14 mm (paratype), and 9 mm (additional specimen). Ground color translucent white (Fig. 1A). Dorsum broad in front and posteriorly. Mantle broad and wider than foot; thin at the edge. Numerous white specks present at mantle edge, lacking a yellow marginal band. Dorsum covered with numerous small white tubercles. Rhinophores opaque white to translucent yellow; clavus lamellate; cylindrical stalk smooth. Rhinophoral sheath smooth. Gills opaque white to yellow, six multi-pinnate branchial leaves, retractable into gill cavity. Gill sheath bears small nodules. Oral veil forms triangular, lateral sides. Foot anteriorly rounded and thickened. Radula formula: 57 × 23.1.23. Rachidian tooth rectangular with four sharp denticles; two central denticles slightly longer than two lateral denticles (Fig. 1B). Innermost lateral tooth massive with one large, slightly curved cusp; two short, inner denticles; and three to four outer denticles. Second lateral tooth with one cusp, no inner denticle and four or five outer denticles. Middle lateral tooth hamate with one large cusp and up to seven denticles (Fig. 1C). Outer lateral teeth hamate, comb-shaped with 5–7 clearly visible denticles (Fig. 1D). Reproductive system triaulic (Fig. 4A). Ampulla moderate, convoluted, and connects with female gland and prostate. Prostate long and narrow. Seminal vesicle slightly more swollen than prostate. Vas deferens narrow, smooth, and distinct. Penis armed with spines. Vagina relatively narrow and connects with bursa copulatrix. Bursa copulatrix ovate and ca. 1.5 × larger than receptaculum seminis. Uterine duct short and narrow, bifurcates into female gland and receptaculum seminis.

Remarks.

A comparison of Cadlina species recorded in the northwestern Pacific region is presented in Table 2. Cadlina koreana sp. nov. is most similar externally to C. paninae, differing in color variation of the rhinophores and gills as well as the structure of the radula. In C. paninae, the color of the rhinophores and gills are opaque white while in Cadlina koreana, color of the rhinophores can vary from opaque white to translucent yellow and that of the gills can vary from opaque white to yellow. Cadlina koreana also has fewer rows and fewer denticles on both the rachidian tooth and its lateral tooth compared to those of C. paninae. In addition, the rachidian tooth of C. paninae is often bifurcated at the tips while the rachidian tooth of Cadlina koreana is not bifurcated at the tips.

Table 2.

Morphological comparison among Cadlina species in the northwestern Pacific region.

Species Locality Size Morphology Radular formula Rachidian tooth First lateral teeth Mid-lateral teeth Outer lateral teeth Ampulla Vas deferens Vagina Bursa copulatrix and receptaculum seminis Source of information
Cadlina koreana Munamjin-ri, South Korea 9–14 mm Translucent white; dorsum covered with small white tubercles; small white specs present on mantle edge. No yellow marginal band 57 × 23.1.23 Rectangular, hook-shaped, 2 longer central denticles, and 2 shorter lateral denticles 1 cusp, 2 short inner denticles, and 3–4 outer denticles. Hamate, comb-shaped, up to 7 denticles Hamate, comb-shaped, 5–7 denticles. Moderate and convoluted Long and narrow Relatively long and narrow Ovate and ca. 1.5 × larger than receptaculum seminis This study
Cadlina umiushi Munamjin-ri, South Korea 8–9 mm White background; numerous small yellow tubercles; yellow marginal band 55 x 16.1.16 Trapezoid, hook-shaped, 2 central denticles, and 2 lateral denticles 1 cusp, 2 inner denticles, and 3 outer denticles Hamate, rather comb-shaped, 6–8 distinct outer denticles. Hamate to straight, up to 10 inconspicuous denticles Long and convoluted Relatively short Relatively short and broad Ovate and ca. 2 × larger than receptaculum seminis This study
Cadlina japonica Munamjin-ri and Yeonji-ri, South Korea 48–55 mm Yellowish with dark brown patches; small scattered yellow spots; yellow marginal band 88 x 71.1.71 Elongate, 2–4 lobe-like denticles 1 bigger cusp, 3–4 inner denticles, and 4–6 outer denticles Hook-shaped, no inner denticle and 3–5 outer denticles Hook-shaped, bearing up to 6 denticles Moderate and convoluted Long, narrow and distinct Relatively short and narrow Almost rectangular in shape, ca. 5 × larger than receptaculum seminis This study
Cadlina kamchatica Kamchatka, Starichkov Island, Russia 37 mm Creamy to dark yellow/light brown; small, low rounded yellow tubercles 82 × 35.1.35 Moderately high, trapezoid, 5–6 denticles, 2 middle usually larger than outer ones 1 cusp, 4–6 large inner denticles, 5–6 distinct outer denticles Hamate, comb-shaped, up to 17 distinct outer denticles only Hamate reduced, up to 19 sharp denticles Long and convoluted Relatively short Long and narrow Pear-shaped, 2 × larger than receptaculum seminis Korshunova et al. (2020)
Cadlina paninae Matua Islands, Middle Kurile Islands, Russia 29 mm Opaque whitish, sometimes with some yellowish shadow; low indistinct tubercles 90 × 38.1.38 Low rectangular, 3–5 distinct cusps, often bifurcated at tips 1 cusp, 2–3 inner denticles and 3–4 outer denticles Elongate hook-shaped, up to 20 comb-shaped denticles Hook-shaped, up to 20 comb-shaped denticles Relatively short and slightly convoluted Long and narrow Long and narrow Ovate, 1.5 × larger than receptaculum seminis Korshunova et al. (2020)

The external morphology of Cadlina koreana is relatively similar to C. umiushi, which also has small-sized tubercles on the dorsum. However, clear differences between these two species can be observed by comparing their coloration. The color pattern of Cadlina koreana is white without yellow tubercles or a yellow marginal band. In contrast, C. umiushi is semi-transparent white with yellow tubercles and a yellow marginal band. The rachidian tooth of Cadlina koreana is rectangular while it is trapezoid in C. umiushi. The inner denticles of the first lateral tooth of C. umiushi are half the length of the tooth body, but in Cadlina koreana it is less than half the length of the tooth body. Moreover, the outer lateral teeth of Cadlina koreana are hamate with clearly visible denticles. In contrast, the outer lateral teeth of C. umiushi are almost straight with inconspicuous denticles.

Cadlina japonica is distinguished from Cadlina koreana sp. nov. by brownish patches on the dorsum and an elongate rachidian tooth with lobe-like denticles. Cadlina kamchatica clearly differs from Cadlina koreana by its yellowish body color and the higher number of denticles on the rachidian tooth and lateral tooth. The common Cadlina species in the northeastern Pacific, C. luteomarginata MacFarland, 1966, differs from Cadlina koreana by yellow dots on the dorsum and a yellow rim to the mantle. The other species in this region, C. flavomaculata MacFarland, 1905, also has yellow dots on the dorsum that are not present in Cadlina koreana. The color of C. modesta MacFarland, 1966 is light yellowish to light brown while it is translucent white in Cadlina koreana. Compared to Cadlina koreana, three Cadlina species recently described by Korshunova et al. (2020), C. klasmalmbergi, C. jannanicholsae, and C. sylviaearleae have yellow mantle bands and yellow tubercles. In Cadlina koreana, the yellow mantle band is absent and the color of the tubercles is white. The maximum intraspecific distances in C. koreana are 0% for the COI marker and 0.23% for the 16S rRNA marker (Suppl. material 1: Table S3). The lowest COI interspecific distance of 5.78% is found between C. koreana and C. umiushi. The lowest 16S rRNA interspecific distance of 4.56% is found between C. koreana and C. paninae.

Etymology.

The species is named after the country of its type locality.

Distribution.

Cadlina koreana sp. nov. is currently known only from Munamjin-ri, South Korea.

Cadlina umiushi

Korshunova, Picton, Sanamyan & Martynov, 2015

7639246B-3F13-5A01-BA57-3DCB6CE6DEEB

Figures 2 , 4B

Figure 2.

Figure 2.

Cadlina umiushiA body; Radula B rachidian teeth C central and lateral region D outer lateral region. Scale bars: 2 mm (A); 10 μm (B); 50 μm (C); 20 μm (D).

Material examined.

One individual, voucher NIBRIV0000865972; South Korea, Gangwon-do, Goseong-gun, Jugwang-myeon, Munamjin-ri; 38°18'14.75"N, 128°34'1.05"E; collected on 02 June 2013 (COI GenBank number: MT420435). One individual, voucher SMU00060; South Korea, Gangwon-do, Goseong-gun, Jugwang-myeon, Munamjin-ri; 38°18'14.75"N, 128°34'1.05"E; collected on 02 June 2013 (COI GenBank number: MT420436).

Description.

Body ovate, 8 mm and 9 mm long. Living specimens with a translucent white dorsum (Fig. 2A). Small yellow glands are present on both sides of the dorsum margin. Thin yellow marginal band present. Dorsum broad, rounded anteriorly and posteriorly. Small yellow tubercles cover the entire dorsum. Rhinophores long and broad. Six multipinnate gills connected by a membrane into circle around anus. Gills retractable into gill cavity. Foot broad, anteriorly thickened. Radula formula: 55 × 16.1.16. Rachidian tooth moderately high, trapezoid, and bearing four denticles (Fig. 2B). Innermost lateral tooth massive with one cusp, two inner denticles, and three outer denticles. Second lateral tooth with one cusp, no inner denticles and three outer denticles. Mid-lateral tooth hamate, 6–8 distinct outer denticles (Fig. 2C). Outer lateral tooth almost straight, denticles small, inconspicuous (Fig. 2D). Reproductive system triaulic (Fig. 4B). Ampulla long, wide, convoluted. Prostate moderate in length and wide, transiting to vas deferens. Vas deferens relatively short. Penis armed with spines. Vagina relatively short and broad, connecting with oval bursa copulatrix. Bursa copulatrix ca. 2 × larger than receptaculum seminis. Uterine duct short and narrow, connecting from female gland mass to base of ovate receptaculum seminis.

Remarks.

Cadlina umiushi was first described in Martynov et al. (2015) from the holotype specimen collected in Peter the Great Bay, Russia. Cadlina olgae Chichvarkhin, 2016, described from specimens collected in south of Rudnaya Bay, Russia is considered a junior synonym of C. umiushi by Korshunova et al. (2020). This study records the presence of C. umiushi in Korean waters for the first time. Even though there were slight differences in the number of denticles of the rachidian and the first lateral tooth, and in the ampulla compartments of specimens collected from South Korea compared to the specimens collected from Russia, other morphological characteristics are similar. It should be noted that this difference is also observed between specimens in Russia collected by Chichvarkhin (2016) and Korshunova et al. (2020). The differences could be explained by the geographical distribution or maybe a different stage of development. The maximum intraspecific distances in C. umiushi are 1.56% for the COI marker and 1.37% for the 16S rRNA marker (Suppl. material 1: Table S3). The lowest COI interspecific distance of 4.33% is found between C. umiushi and C. laevis (Linnaeus, 1767). The lowest 16S rRNA interspecific distance of 1.37% is found between C. umiushi and C. kamchatica.

Distribution.

Northern part of Sea of Japan (Russia) to Munamjin-ri (South Korea).

Cadlina japonica

Baba, 1937

EE96E4F0-FDF2-57EC-8F76-BD051F5EADE6

Figures 3 , 4C

Figure 3.

Figure 3.

Cadlina japonicaA body; Radula B rachidian teeth C central and lateral region D outer lateral region. Scale bars: 1 cm (A); 20 μm (B); 100 μm (C); 50 μm (D).

Material examined.

Two individuals, vouchers: NIBRIV0000865973 and NIBRIV0000865974; South Korea, Gangwon-do, Goseong-gun, Jugwang-myeon, Munamjin-ri; 38°18'14.75"N, 128°34'1.05"E; collected on 02 June 2013 and 20 July 2019 (COI GenBank numbers: MT420432 and MT420433). One individual, voucher NIBRIV0000865975; South Korea, Gyeongsangbuk-do, Uljin-gun, Uljin-eup, Yeonji-ri; 37°00'0.59"N, 129°26'1.89"E; collected on 25 August 2011 (COI GenBank number: MT420434).

Description.

Size up to 55 mm long. Live specimens commonly opaque white with a yellowish ground color and several dark brownish patches present on the dorsum (Fig. 3A). Rhinophores yellowish like the ground color with bright yellow tips. Rhinophoral sheath bears small tubercles and yellow dots. Six multipinnate, translucent white gills with yellow tips. Yellow dots present irregularly on the dorsum, but often concentrated near the mantle margin. Continuous yellow band present on mantel edge. Oral tentacles short and triangular. Foot broad, anteriorly thickened to form a double edge. Radula formula: 88 × 71.1.71. Rachidian tooth elongate and bears 2–4 distinct lobe-like cusps (Fig. 3B). Innermost lateral tooth hamate with a relatively narrow base and short, strong cusp; three or four inner denticles and 4–6 outer denticles (Fig. 3B). Middle lateral teeth hook-shaped, no inner denticle and 3–5 outer denticles (Fig. 3C). Outer lateral teeth bear up to six denticles (Fig. 3D). Reproductive system triaulic (Fig. 4C). Ampulla is moderate and convoluted. Prostate long and narrow. Vas deferens long, narrow, convoluted. Penial spines absent. Vagina relatively short, narrow and connects with bursa copulatrix. Bursa copulatrix almost rectangular in shape, ca. 5 × larger than receptaculum seminis. Uterine duct short and narrow.

Remarks.

Cadlina japonica was first described by Baba (1937). Recently, this species was thoroughly reviewed by Korshunova et al. (2020). Morphologically, the C. japonica specimens collected in this study are consistent with C. japonica described in previous studies (Baba 1937; Choe and Lee 1994; Korshunova et al. 2020). Cadlina japonica is completely distinguishable from other species of the genus by several characteristics. Irregular brownish patches are present on the mantle, but these patches are absent on several small individuals. Its rachidian tooth is elongate and its first lateral tooth is hamate. In addition, compared to other Cadlina species in the region, C. japonica is large, with the sample in this study measuring up to 55 mm. The maximum intraspecific distances in C. japonica are 0.78% for the COI marker and 0.23% for the 16S rRNA marker (Suppl. material 1: Table S3). The lowest COI interspecific distance of 7.97% is found between C. japonica and C. jannanicholsaeKorshunova et al., 2020. The lowest 16S rRNA interspecific distance of 1.87% is found between C. japonica and C. klasmalmbergi.

Distribution.

Southern Hokkaido to southern Honshu (Japan) and East Sea, South Korea (Sea of Japan).

Molecular analyses

Analyses of the three molecular markers also demonstrated differences between Cadlina koreana sp. nov. and other Cadlina species recorded in GenBank. The BLAST results showed that C. umiushi is the closest species to Cadlina koreana with 93.8% and 95.3% similarity in the COI and 16S rRNA genes, respectively. The number of taxonomic groups based on ABGD analysis for COI varied from 11 to 13, depending on the intraspecific divergence prior (p) value (Suppl. material 1: Table S4). In the 11-groups partition, all input species including three species in this study and species in Suppl. material 1: Table S3 were recovered, and each species corresponded to a distinct group. In the 12- and 13-groups partition, Cadlina koreana sequences were always clustered together. The same pattern was also observed for C. japonica. Meanwhile, C. umiushi sequences were partitioned into two or three groups, depending on the p value. ABGD analysis for 16S rRNA revealed 9–5 groups (Suppl. material 1: Table S5). Similar to the COI analysis, in the 11-group partition, all input species were recovered. Cadlina koreana sequences always formed a distinct group for all partitions. Similarly, C. japonica sequences also formed a group, except in the 15-group partition. In this partition, the p value was minimum and two groups of C. japonica were observed. In the 9-group partition, C. umiushi was grouped with C. kamchatica and C. paninae. When the p value decreased, the total number of groups increased to 15 and C. umiushi sequences were divided into three groups.

A phylogenetic tree of three concatenated markers (COI, 16S rRNA, and 28S rRNA) was reconstructed to determine the positions of the three species of Cadlina found in South Korea (Fig. 5) while the phylogenetic tree of two concatenated markers (COI and 16S rRNA) was reconstructed to resolve the relationship of as many species in the genus Cadlina as possible (Suppl. material 2: Fig. S1). The ML and BI trees based on the three concatenated markers show a similar pattern (Fig. 5). The phylogenetic tree of the three concatenated markers indicates that Cadlina koreana specimens form an independent branch that is sister to a group that includes C. umiushi, C. kamchatica, C. paninae, and C. laevis. Moreover, the C. umiushi specimens were clustered together and formed two groups, a Russian group from Peter the Great Bay and a South Korean group from Munamjin-ri. Meanwhile, C. japonica was clustered with sequences from the same species available in GenBank (Fig. 5). The ML and BI trees of two concatenated markers (COI and 16S rRNA) had slightly different topology patterns (Suppl. material 2: Fig. S1A, S1B). However, both trees showed a separated position of Cadlina koreana. In the tree from three concatenated markers, the C. umiushi specimens from south of Rudnaya, Russia were added for analysis due to the availability of COI and 16S rRNA sequences. As a result, C. umiushi formed three branches according to geographical distributions, including two Russian branches (Peter the Great Bay and south of Rudnaya Bay) and one South Korean branch (Munamjin-ri). Both trees of two concatenated markers and three concatenated markers showed that C. japonica specimens were clustered with sequences from GenBank, and no clear separated groups were observed (Fig. 5; Suppl. material 2: Fig. S1).

Figure 5.

Figure 5.

Phylogenetic tree based on concatenation of COI, 16S rRNA, and 28S rRNA markers. Sequences generated in this study are marked with back squares; the remaining sequences were obtained from GenBank. Accession numbers of COI sequences appear in front of species names to identify specific specimens as in Suppl. material 1: Tables S1, S2. The tree was constructed using the Maximum Likelihood method with 1000 bootstrap replicates in MEGA X software and Bayesian Inference in MrBayes software. Aldisa sanguinea and A. smaragdina were used as the outgroup. Numbers at each node indicated bootstrap (right) and posterior probability (left) values. The values > 50 (BS) and 0.5 (PP) are provided.

Discussion

Species of the genus Cadlina are widely distributed in the northern temperate regions. Cadlina japonica, the first species of this genus reported from the northwestern Pacific region (Baba 1937), was described based on specimens collected in Japan; this species was also recorded in South Korea (Baba 1937; Choe and Lee 1994). Compared to other the Cadlina species, C. japonica is easily recognized by its distinct brownish patches on the mantle and distinct morphology of the rachidian and lateral teeth; the specimens examined in this work are similar to previous descriptions. The second and third species found in the region, C. umiushi and C. kamchatica, were described by Martynov et al. (2015). The latest species, and most similar to our new species, C. paninae, was recently described by Korshunova et al. (2020). With unambiguous evidence from morphological and molecular analyses, the present study identified three species in Korean waters: C. japonica, C. umiushi, and a new species named Cadlina koreana.

Cadlina koreana is the fifth species recorded in the northwestern Pacific region. The new species can be differentiated from all previously described species by a combination of morphological and molecular markers. Similar to most Cadlina species, the ground color of Cadlina koreana is white. However, the distinct characteristics of Cadlina koreana are the absence of both the yellow tubercles on the dorsum and a yellow marginal band, two features present in most Cadlina species found in the northern Pacific (Korshunova et al. 2020). The observations of radulae by SEM also support the distinction of Cadlina koreana: the shape of the rachidian and lateral teeth as well as the radula formula distinguishes it from the other species.

Moreover, the presence of C. umiushi in Korean waters is described for the first time. The morphology of C. umiushi collected in the present study resembled that of other specimens described in previous studies (Chichvarkhin 2016; Korshunova et al. 2020). Similar to those reports, the dorsum of C. umiushi in this study was broad with small yellow tubercles. Also, there was a yellow mantle band on the specimens. The radula of specimens collected from Munamjin-ri, South Korea showed almost perfect resemblance with those of specimens described by Chichvarkhin (2016) and Korshunova et al. (2020), except for slight differences in the radular formulae and the numbers of denticles in the rachidian and first lateral teeth (Table 2). The radula formula (55 × 16.1.16) in this study was closer to the specimens from Chichvarkhin (2016) (55–60 × 13.1.13) than the specimen from Korshunova et al. (2020) (70 × 30.1.30). For the rachidian tooth of the radula, both Chichvarkhin (2016) and Korshunova et al. (2020) reported five or six denticles while there were four denticles in the specimens collected from South Korea. For the first lateral tooth, the specimens in this study included two inner denticles, a distinct cusp, and three outer denticles that were closest to the specimens reported by Korshunova et al. (2020) with two or three inner denticles, a distinct cusp, and 4–6 outer denticles. Also, the morphology of the reproductive system of the specimens collected from the three sites was similar except for the ampulla: even though all specimens showed long and convoluted ampullae, the specimens from Munamjin-ri and south of Rudnaya Bay had two folds, while several compartments were seen in the specimens from Peter the Great Bay (Chichvarkhin 2016; Korshunova et al. 2020).

It is challenging to identify Cadlina species based on morphology because of similar characteristics and morphological conservatism. Molecular markers are well known as a useful tool to support the identification of this group (Korshunova et al. 2020). In this study, three molecular markers COI, 16S rRNA, and 28S rRNA were used together with morphological examination. Our molecular analysis confirmed the findings of our morphological study: Cadlina koreana sp. nov. and C. japonica are distinct species based on ABGD analyses. For both markers, C. umiushi sequences were partitioned into a distinct group at a specific p value. For the COI marker, C. umiushi sequences were not grouped with any other species. All COI sequences of C. umiushi were grouped together or partitioned into two or three groups when the p value decreased. For the 16S rRNA marker, C. umiushi sequences can be partitioned into up to three groups, depending on the p value. When the p value was high, all C. umiushi sequences formed a group with C. kamchatica and C. paninae. This finding showed a high intraspecific distance within C. umiushi and low interspecific distances between C. umiushi, C. kamchatica and C. paninae. Our results are concordant with a previous study that observed a small gap between the maximum intraspecific distance and the minimum interspecific distance of 16S rRNA sequences of C. umiushi (Korshunova et al. 2020), which were 1.18% and 1.41%, respectively. In the present study, when more 16S rRNA sequences from Korean waters were added for estimation, the intraspecific distance within C. umiushi became larger (1.37%) and comparable to the distance between C. umiushi, C. kamchatica, and C. paninae. In contrast, even though the COI sequences from our C. umiushi specimens were added, C. umiushi were not grouped with other Cadlina species. In a previous study of aeolid nudibranchs, the COI gene was proven to be better than 16S rRNA gene in resolving the relationship at the species level (Cella et al. 2016).

According to the phylogenetic tree, Cadlina koreana sp. nov., C. japonica, and C. umiushi formed independent clusters. Interestingly, three separate groups of C. umiushi were observed that corresponded with the three geographical collection sites. The ABGD and phylogenetic analyses showed some distances within C. umiushi among the collection sites. This result was congruent with the morphological examination discussed above and could indicate a possible hidden diversity within this species. It is worth noting that the number of specimens in this study as well as in the surveys of Martynov et al. (2015), Chichvarkhin (2016), and Korshunova et al. (2020) are limited. More C. umiushi specimens from different geographical localities must be collected to further elucidate the population structure and speciation of this species.

Based on morphology and analyses of three molecular markers, three Cadlina species are identified from South Korea: Cadlina koreana sp. nov., C. umiushi (a new record for South Korea), and C. japonica. These results demonstrate the usefulness of the combination of morphological examination and molecular analyses in species identification, termed integrative taxonomy by Dayrat (2005). This approach should be applied for any future works that deal with the taxonomy of Cadlina species. Further studies are necessary to investigate the taxonomy and distribution of Cadlina species in the region. This is fundamental to improving our understanding of Cadlina diversity and systematics.

Supplementary Material

XML Treatment for Cadlina koreana
XML Treatment for Cadlina umiushi
XML Treatment for Cadlina japonica

Acknowledgments

This work was supported by a National Research Foundation of South Korea (NRF) grant funded by the South Korean Government (MSIP) (No. NRF-2018R1D1A1B07042858) and a grant from the National Institute of Biological Resource (NIBR) funded by the Ministry of Environment (MOE) of South Korea (NIBR No. 2016-02-001). We thank Mr. Jung-il Kim (Department of Biotechnology, Sangmyung University) for his support in the preparation and examination of radulae.

Citation

Do TD, Jung D-W, Kil H-J, Kim C-B (2020) A report of a new species and new record of Cadlina (Nudibranchia, Cadlinidae) from South Korea. ZooKeys 996: 1–18. https://doi.org/10.3897/zookeys.996.54602

Funding Statement

National Research Foundation of Korea and the National Institute of Biological Resource (NIBR)

Supplementary materials

Supplementary material 1

Tables S1–S3

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Thinh Dinh Do, Dae-Wui Jung, Hyun-Jong Kil, Chang-Bae Kim

Data type

molecular data

Explanation note

Table S1. Collection information and Genbank accession numbers of samples. Table S2. Sequences obtained from GenBank used in the present study. Table S3. Intraspecific and interspecific distances (%) of Cadlina species based on COI and 16S rRNA sequences. Species with multiple sequences available for each marker were targeted for analysis. Table S4.ABGD analysis for COI sequences of Cadlina species. Table S5.ABGD analysis for 16S rRNA sequences of Cadlina species.

zookeys-996-001-s001.docx (35.8KB, docx)
Supplementary material 2

Figure S1

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Thinh Dinh Do, Dae-Wui Jung, Hyun-Jong Kil, Chang-Bae Kim

Data type

molecular data

Explanation note

Phylogenetic tree based on concatenation of COI and 16S rRNA markers. Sequences generated in this study are marked with black squares; the remaining sequences were obtained from GenBank. Accession numbers of COI sequences appear in front of species names to identify specific specimens listed in Table S1 and Table S2. The tree was constructed using the Maximum Likelihood method with 1000 bootstrap replicates in MEGA X software (A) and Bayesian Inference in MrBayes software (B). Aldisa sanguinea and A. smaragdina were used as the outgroup. Numbers at nodes indicate bootstrap and posterior probability values. The values > 50 (BS) and 0.5 (PP) are provided.

References

  1. Baba K. (1937) Two new species of the nudibranchiate genus Cadlina from Sagami Bay, Japan. Venus, Japanese Journal of Malacology 7: 75–80. [Google Scholar]
  2. Baba K. (1949) Opisthobranchia of Sagami Bay Collected by His Majesty the Emperor of Japan. Iwanami Shoten, Tokyo, 207 pp. [Google Scholar]
  3. Castresana J. (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17: 540–552. 10.1093/oxfordjournals.molbev.a026334 [DOI] [PubMed] [Google Scholar]
  4. Cella K, Carmona L, Ekimova I, Chichvarkhin A, Schepetov D, Gosliner TM. (2016) A radical solution: the phylogeny of the nudibranch family Fionidae PLoS ONE 11: e0167800. 10.1371/journal.pone.0167800 [DOI] [PMC free article] [PubMed]
  5. Chichvarkhin A. (2016) Shallow water sea slugs (Gastropoda: Heterobranchia) from the northwestern coast of the Sea of Japan, north of Peter the Great Bay, Russia. PeerJ 4: e2774. 10.7717/peerj.2774 [DOI] [PMC free article] [PubMed]
  6. Choe BL, Lee JR. (1994) Opisthobranchs (Mollusca: Gastropoda) from Ullung and Dog-do Islands, Korea. Korean Journal of Zoology 37: 352–376. [Google Scholar]
  7. Darriba D, Taboada GL, Doallo R, Posada D. (2012) jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9(8): e772. 10.1038/nmeth.2109 [DOI] [PMC free article] [PubMed]
  8. Dayrat B. (2005) Towards integrative taxonomy. Biological Journal of the Linnean Society 85: 407–415. 10.1111/j.1095-8312.2005.00503.x [DOI] [Google Scholar]
  9. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. [PubMed] [Google Scholar]
  10. Hassouna N, Michot B, Bachellerie JP. (1984) The complete nucleotide sequence of mouse 28S rRNA gene. Implications for the process of size increase of the large subunit rRNA in higher eukaryotes. Nucleic Acids Research 12: 3563–3583. 10.1093/nar/12.8.3563 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hebert PD, Ratnasingham S, de Waard JR. (2003) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London B: Biological Sciences 270: S96–S99. 10.1098/rsbl.2003.0025 [DOI] [PMC free article] [PubMed]
  12. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. 10.1093/bioinformatics/bts199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Korshunova TA, Fletcher K, Picton B, Lundin K, Kashio S, Sanamyan N, Sanamyan K, Padula V, Schrödl M, Martynov A. (2020) The Emperor’s Cadlina, hidden diversity and gill cavity evolution: new insights for the taxonomy and phylogeny of dorid nudibranchs (Mollusca: Gastropoda). Zoological Journal of the Linnean Society 20: 1–66. 10.1093/zoolinnean/zlz126 [DOI] [Google Scholar]
  14. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. (2018) MEGA X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution 35: 1547–1549. 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Le HLV, Lecointre G, Perasso R. (1993) A 28S rRNA based phylogeny of the Gnathostomes: First steps in the analysis of conflict and congruence with morphologically based cladograms. Molecular Biology and Evolution 2: 31–51. 10.1006/mpev.1993.1005 [DOI] [PubMed] [Google Scholar]
  16. Lindsay T, Valdés Á. (2016) The model organism Hermissenda crassicornis (Gastropoda: Heterobranchia) is a species complex. PLoS ONE 11: e0154265. 10.1371/journal.pone.0154265 [DOI] [PMC free article] [PubMed]
  17. Martynov AV, Sanamyan NP, Korshunova TA. (2015) Review of the opisthobranch mollusc fauna of Russian Far Eastern seas: Pleurobranchomorpha, Doridida and Nudibranchia. Bulletin of Kamchatka State Technical University 34: 62–87. 10.17217/2079-0333-2015-34-62-87 [DOI] [Google Scholar]
  18. Nakano R. (2018) Field Guide to Sea Slugs and Nudibranchs of Japan. Bun-ichi Co. Ltd., Tokyo, 544 pp. [Google Scholar]
  19. Palumbi SR. (1996) Nucleic acids II: The polymerase chain reaction. In: Hillis DM, Moritz C, Mable BK. (Eds) Molecular Systematics.Sinauer Associates, Sunderland, 205–247.
  20. Puillandre N, Lambert A, Brouillet S, Achaz G. (2012) ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Molecular Ecology 21: 1864–1877. 10.1111/j.1365-294X.2011.05239.x [DOI] [PubMed] [Google Scholar]
  21. Puslednik L, Serb JM. (2008) Molecular phylogenetics of the Pectinidae (Mollusca: Bivalvia) and effect of increased taxon sampling and outgroup selection on tree topology. Molecular Biology and Evolution 48: 1178–1188. 10.1016/j.ympev.2008.05.006 [DOI] [PubMed] [Google Scholar]
  22. Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Schrödl M. (2000) Revision of the nudibranch genus Cadlina (Gastropoda: Opisthobranchia) from the Southern Ocean. Journal of the Marine Biological Association of the United Kingdom 80: 299–309. 10.1017/S0025315499001873 [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Cadlina koreana
XML Treatment for Cadlina umiushi
XML Treatment for Cadlina japonica
Supplementary material 1

Tables S1–S3

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Thinh Dinh Do, Dae-Wui Jung, Hyun-Jong Kil, Chang-Bae Kim

Data type

molecular data

Explanation note

Table S1. Collection information and Genbank accession numbers of samples. Table S2. Sequences obtained from GenBank used in the present study. Table S3. Intraspecific and interspecific distances (%) of Cadlina species based on COI and 16S rRNA sequences. Species with multiple sequences available for each marker were targeted for analysis. Table S4.ABGD analysis for COI sequences of Cadlina species. Table S5.ABGD analysis for 16S rRNA sequences of Cadlina species.

zookeys-996-001-s001.docx (35.8KB, docx)
Supplementary material 2

Figure S1

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Thinh Dinh Do, Dae-Wui Jung, Hyun-Jong Kil, Chang-Bae Kim

Data type

molecular data

Explanation note

Phylogenetic tree based on concatenation of COI and 16S rRNA markers. Sequences generated in this study are marked with black squares; the remaining sequences were obtained from GenBank. Accession numbers of COI sequences appear in front of species names to identify specific specimens listed in Table S1 and Table S2. The tree was constructed using the Maximum Likelihood method with 1000 bootstrap replicates in MEGA X software (A) and Bayesian Inference in MrBayes software (B). Aldisa sanguinea and A. smaragdina were used as the outgroup. Numbers at nodes indicate bootstrap and posterior probability values. The values > 50 (BS) and 0.5 (PP) are provided.


Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES