Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Dec 4.
Published in final edited form as: Cell Rep. 2020 Nov 17;33(7):108403. doi: 10.1016/j.celrep.2020.108403

Cyclin D3 Governs Clonal Expansion of Dark Zone Germinal Center B Cells

Parham Ramezani-Rad 1,2,3,*, Cindi Chen 1, Zilu Zhu 1, Robert C Rickert 1
PMCID: PMC7714654  NIHMSID: NIHMS1647647  PMID: 33207194

SUMMARY

Germinal center (GC) B cells surge in their proliferative capacity, which poses a direct risk for B cell malignancies. G1- to S-phase transition is dependent on the expression and stability of D-type cyclins. We show that cyclin D3 expression specifically regulates dark zone (DZ) GC B cell proliferation. B cell receptor (BCR) stimulation of GC B cells downregulates cyclin D3 but induces c-Myc, which subsequently requires cyclin D3 to exert GC expansion. Control of DZ proliferation requires degradation of cyclin D3, which is dependent on phosphorylation of residue Thr283 and can be bypassed by cyclin D3T283A hyperstabilization as observed in B cell lymphoma. Thereby, selected GC B cells in the light zone potentially require disengagement from BCR signaling to accumulate cyclin D3 and undergo clonal expansion in the DZ.

Graphical Abstract

graphic file with name nihms-1647647-f0001.jpg

In Brief

Mutations of cyclin D3 occur in B cell lymphomas, which derive from highly proliferating germinal center (GC) B cells. Ramezani-Rad et al. show that cyclin D3 in GC B cells is controlled by B cell receptor signaling and is required for proliferation of dark zone GC B cells.

INTRODUCTION

The human immune system is the warden of local and global cellular fitness, protecting the health of bodily functions. B cells act at the forefront of providing lifelong immunity to pathogens through memory B cells and the secretion of protective antibodies by plasma cells (Akkaya et al., 2019). More than a hundred immunoglobulin (Ig) gene segments stochastically assemble a membrane-bound antibody in the form of a B cell receptor (BCR) during B cell development (Schatz and Ji, 2011). These genetic recombination events generate a broad spectrum of BCR specificity to virtually any antigen. Only B cells that express a functional non-autoreactive BCR are tolerated to survive (Nemazee, 2017). After successful completion, B cells egress the bone marrow expressing two Ig isotypes, namely IgM and IgD. Both isotypes are expressed through alternative splicing and possess identical specificity. Upon antigen encounter through their BCR, these naive resting B cells are activated and subsequently seed the germinal center (GC) to engage in an immune response. Clonal expansion is pivotal for the functional response of GC B cells, yielding optimal numbers of few selected cells. The pathways and molecules controlling proliferative responses are essential for understanding GC biology, and this knowledge is elementary to modulate immune responses for effective vaccine strategies, control autoimmune disorders, and treat B cell malignancies.

The D-type cyclins (cyclin D1, D2, and D3) facilitate the earliest step of commitment in G1- to S-phase of the cell cycle in all mammalian tissues. The D-type cyclins are best characterized for regulating the catalytic activity of cyclin-dependent kinases 4 and 6 (CDK4/6), which leads to the degradation of retinoblastoma protein (RB) to drive S-phase entry (Sherr, 1995). In B cells, cyclins D2 and D3 are central mediators of proliferative responses with partially redundant, but also distinct, roles among B cell stages. Early B cell development in the bone marrow specifically requires cyclin D3 for proliferative expansion of pre-B cells (Cooper et al., 2006), whereas in mature B cells cyclin D2 participates in proliferative responses (Solvason et al., 2000). In GC B cells, cyclin D3 is crucial for GC development (Cato et al., 2011; Peled et al., 2010); however, the specific regulatory pathways and contribution of cyclin D3 in GC B cells remain elusive. We show cyclin D3 expression is restricted to the dark zone (DZ) of GC B cells mediating clonal expansion and is downregulated by BCR signaling (occurring in light zone [LZ] GC B cells). Thereby, cyclin D3 is the driving force of DZ GC expansion, making it a critical factor during immune responses and in B cell lymphomas.

RESULTS

cyclin D3 Is Required for GC B Cell Proliferation in the DZ

To investigate the loss of cyclin D3 in GC B cells, we crossed conditional cyclin D3 (Ccnd3fl/fl) mice (Choi et al., 2012) with Cγ1-Cre (Ighg1Cre/+) mice (Casola et al., 2006). Ccnd3fl/fl Cγ1-Cre and Ccnd3+/+ mice were immunized with sheep red blood cells (SRBCs) to induce GC responses and were analyzed after 7 days. The frequency of GC B cells was drastically reduced in Ccnd3fl/fl Cγ1-Cre mice (Figures 1A and 1B). Contrary to wild-type GC B cells, the majority of Ccnd3fl/fl Cγ1-Cre GC B cells were present in the LZ (CXCR4loCD86hi), with much lower quantities of DZ GC B cells (CXCR4hiCD86lo) (Figures 1C and 1D). Administration of bromodeoxyuridine (BrdU) for a brief pulse during the GC response highlighted the reduced proliferation of Ccnd3fl/fl Cγ1-Cre GC B cells through lower BrdU incorporation into these cells (Figure 1E, top). Among the BrdU+ GC B cells, Ccnd3fl/fl Cγ1-Cre GC B cells had much lower DZ GC B cell proliferation compared with wild-type controls and most of the BrdU incorporation was present in GC B cells of the LZ (Figure 1E, bottom).

Figure 1. Loss of cyclin D3 in GC B Cells Reduces Proliferation in the DZ.

Figure 1.

Open in a new tab

(A) Deletion of cyclin D3 (Ccnd3) in GC B cells. Ccnd3fl/fl Cγ1-Cre mice were compared with Ccnd3+/+ mice. Splenocytes after SRBC immunization on day 7 were analyzed. Single cells were gated on B cells (B220+) to determine GC B cell frequency based on GL7+FAS+ expression. See also Figures S1A and S1B.

(B) Quantification of GC B cell frequency (shown in A) (n = 4).

(C) Zonal distribution of GC B cells (shown in A) based on relative expression of CXCR4hiCD86lo (DZ) and CXCR4loCD86hi (LZ).

(D) Quantification of respective DZ/LZ ratio of GC B cells (shown in C) (n = 4).

(E) Administration of BrdU for 2 h on day 10 after SRBC immunization. (Top) Total frequency of BrdU incorporation is shown in GC B cells (B220+GL7+FAS+). (Bottom) Distribution of total BrdU+ GC B cells of control and knockout mice in the DZ and LZ. Error bars indicate mean + SD (n = 4). See also Figure S1C.

Data are representative of two to three independent experiments.

Mutant cyclin D3 Exceeds Normal Limits of DZ GC B Cells

Gain-of-function mutations in CCND3 are found in particularly aggressive forms of B cell non-Hodgkin lymphoma (B-NHL) (Ramezani-Rad and Rickert, 2017). The majority of these mutations are heterozygous and affect the PEST domain of cyclin D3 (Richter et al., 2012; Schmitz et al., 2012). In particular, phosphorylation of Thr283 in cyclin D3 is crucial for proteasomal degradation and the T283A mutation effectively prevents degradation, leading to the hyperstabilization of cyclin D3 (Naderi et al., 2004). We CRISPR-engineered knockin mice carrying cyclin D3T283A in the native Ccnd3 locus by microinjecting C57BL/6 zygotes with Cas9 mRNA, Ccnd3 single guide RNA (sgRNA), and a donor single-stranded oligodeoxynucleotide (ssODN) template with a single point mutation for Ccnd3T283A (Figure 2A). Of 35 pups, ~40% showed editing in the Ccnd3 locus; however, one mouse success-fully repaired the CRISPR-induced DNA damage by homologous recombination and presented with substitution of adenine (A) for guanine (G) (ACT to GCT), which resulted in a heterozygous Ccnd3T283A/+ mouse (Figures S2A and 2B). Animals with Ccnd3T283A/+ were comparable in appearance to wild-type animals; however, they did not breed very effectively and occurred at a much lower Mendelian frequency (Figure S2B). The B splenocytes from Ccnd3T283A/+ mice had much greater cyclin D3 protein levels compared with wild-type mice(Figure2C). To investigate the effects of this cyclin D3 mutant during the GC response, we reconstituted C57BL/6 recipient mice with bone marrow from either Ccnd3+/+ or Ccnd3T283A/+ mice. Total B splenocytes were slightly reduced, showing lower follicular B cell (IgDhiIgMlo) frequencies (Figure S2C). However, the GC B cell frequency was significantly upregulated in Ccnd3T283A/+ mice after SRBC immunization (Figures 2D and 2E). Notably, DZ GC B cells were vastly enriched in Ccnd3T283A/+ mice (Figures 2F and 2G). Similar results were obtained in mixed bone marrow chimeras using μMT mice (Kitamura et al., 1991) with either Ccnd3+/+ or Ccnd3T283A/+ mice (Figures S2D–S2G). Furthermore, Ccnd3T283A/+ mice showed a modest increase in antibody responses (Figure 2H). Immunofluorescence of splenic follicles showed normal architecture of the spleen and the GC reaction (Figure 2I).

Figure 2. CRISPR-Engineered Hyperstabilized cyclin D3 Mutant Mice Increase DZ Expansion.

Figure 2.

Open in a new tab

(A) Generation of Ccnd3T283A/+ mice was achieved by microinjection of Cas9 mRNA, Ccnd3 sgRNA, and Ccnd3T283A ssODN into zygotes from superovulated C57BL/6 female mice.

(B) DNA sequencing chromatogram shows the point mutation and resulting amino acid change in a heterozygous animal for Ccnd3T283A/+.

(C) Assessment of cyclin D3 protein levels in Ccnd3T283A/+ mice. The B splenocytes from Ccnd3T283A/+ or Ccnd3+/+ mice were cultured in the presence of indicated stimulants for 16 h, and cell lysates were probed for cyclin D3 (and β-actin as a loading control). Data are representative of two independent experiments.

(D) Irradiated (10 Gy) C57BL/6 recipient mice were reconstituted with bone marrow from Ccnd3+/+ or Ccnd3T283A/+ mice. After 6 weeks, mice were immunized with SRBCs and analyzed 10 days later. Single cells were gated on B splenocytes (B220+) to determine GC B cell frequency based on GL7+FAS+ expression.

(E) Quantification of (D) GC B cells in Ccnd3T283A/+ mice compared with Ccnd3+/+ control mice (n = 8).

(F) Zonal distribution of GC B cells (shown in D) based on relative expression of CXCR4hiCD86lo (DZ) and CXCR4loCD86hi (LZ).

(G) Quantification of (F) GC B cells respective DZ/LZ ratio (n = 8).

(H) Antibody titers of SRBC-specific IgM or IgG1 in sera from Ccnd3+/+ or Ccnd3T283A/+ mice (n = 8).

(I) Immunofluorescence of GC reaction in Ccnd3T283A/+ and Ccnd3+/+ mice. Mice were immunized with NP-CGG and analyzed on day 14. Splenic follicles with B cells (B220+) and GC B cells (PNA+) are shown. CD35 expression on follicular dendritic cells depicts the LZ of the GC. Scale bar, 100 μm. Data are representative of three independent experiments.

cyclin D3 Is Modulated by BCR Signaling in GC B Cells

The regulatory pathways that control cyclin D3, specifically in the GC, are not well described and critical for the understanding of GC B cell dynamics. GC stimuli (CD40, interleukin-4 [IL-4], and BAFF) induced higher proliferation in B cells from mutant Ccnd3T283A/+ mice compared with wild-type controls, whereas cyclin D3-deficient B cells (Ccnd3fl/fl crossed to Mb1Cre/+ [Hobeika et al., 2006]) proliferated much lower than both (Figure 3A). Interestingly, BCR stimulation (via IgM) also increased proliferation in Ccnd3T283A/+ mice, but it was comparable in wild-type and Ccnd3fl/fl Mb1Cre/+ mice, highlighting the specific requirement of cyclin D3 during CD40-driven responses. We hypothesized that cyclin D3 expression is functionally restricted in DZ GC B cells and potentially inhibited in LZ GC B cells. During LZ GC B cell selection, cells bearing a functional BCR compete for antigen (BCR signaling) and T follicular helper cell signals (CD40 signaling; but also IL-4 and IL-21) (Mesin et al., 2016). Positively selected GC B cells induce transient and restricted c-Myc expression in the LZ (Calado et al., 2012; Dominguez-Sola et al., 2012). To study the control of the signaling patterns in the small population of selected LZ GC B cells, we generated in-vitro-derived GC B cells (Nojima et al., 2011). For this, B splenocytes were propagated in the presence of IL-4 and on a feeder layer providing CD40L and BAFF (40LB cells). After 5 days in culture, B cells upregulated GC markers (GL7 and FAS) and underwent class switching, expressing cells with either IgM or IgG1 (Figure S3A). BCR stimulation of in-vitro-derived GC B cells robustly induced c-Myc protein and sharply downregulated cyclin D3 (Figure 3B). In contrast to cyclin D3, BCR stimulation induced cyclin D2 (Figure 3C), which is a known target of c-Myc (Bouchard et al., 1999) and is specifically enriched in c-Myc-expressing GC B cells by transcript (Calado et al., 2012; Dominguez-Sola et al., 2012). Interestingly, we found higher cyclin D2 protein levels in B cells from mice with ectopic expression of c-MYC (LSLMYC/MYC [Calado et al., 2012] crossed to Cd19Cre/+ [Rickert et al., 1997]), particularly via IgM/CD40 stimulation (Figure S3C). Also, BCR stimulation of in-vitro-derived GC B cells downregulated FOXO1, which is antagonized by phosphatidylinositol 3-kinase (PI3K)-AKT signaling in LZ GC B cells (Dominguez-Sola et al., 2015; Sander et al., 2015). Consistently, phosphorylation of AktS473 was induced upon BCR signaling (Figure 3C). In order to validate the regulation of cyclin D3 in bona fide GC B cells, we purified untouched GC B cells from immunized mice, which largely expressed BCRs with κ light chains (Figure S3B). BCR stimulation of GC B cells induced c-Myc and downregulated cyclin D3 (Figures 3D and 3E). FOXO1 levels did not appear to be downregulated; however, phosphorylation of FOXO1T24 increased, which is important for nuclear export and subsequent degradation. Since FOXO1 has been implicated to regulate cyclin D3 in GC B cells (Dominguez-Sola et al., 2015), we tested whether FOXO1 mediates cyclin D3 expression. The B splenocytes from nuclear trapped FOXO1 (Foxo1fl/fl(T24A)) mice (Zhu et al., 2019) crossed to Cd19Cre/+ mice were cultured with various stimulants. Notably, cyclin D3 protein expression was upregulated in Foxo1fl/fl(T24A) Cd19Cre/+ cells compared with controls (Figure 3F).

Figure 3. BCR Signaling Downregulates cyclin D3 in GC B Cells.

Figure 3.

Open in a new tab

(A) The B splenocytes from Ccnd3T283A/+, Ccnd3fl/fl Mb1Cre/+, or Ccnd3+/+ mice were cultured in the presence of indicated stimulants for 3 days. Proliferation of cells was assessed through dilution of eFluor670 in daughter cells. Data are representative of three independent experiments.

(B) Wild-type B splenocytes were cultured for 5 days on 40LB cells plus IL-4. The resulting in-vitro-derived GC B cells were stimulated with anti-IgM or anti-IgG for 4 h and lysed. Cell lysates were probed for c-Myc, cyclin D3, and FOXO1 (β-actin serves as loading control). Data are representative of three independent experiments.

(C) Cell lysates from in-vitro-derived GC B cells (generated as described in B) were probed for cyclin D2 and phospho-AktS473 (β-actin serves as loading control). Data are representative of two to three independent experiments.

(D and E) Wild-type mice were immunized with SRBCs, and GC B cells were purified on day 7. GC B cells were stimulated with anti-κ for 2 h (D) or 3 h (E) and lysed. Cell lysates were probed for c-Myc, cyclin D3, FOXO1, and phospho-FOXO1T24 (β-actin serves as loading control). Data are representative of three independent experiments.

(F) The B splenocytes from Foxo1fl/fl(T24A) Cd19Cre/+ mice and corresponding controls were cultured in the presence of indicated stimulants for 24 h. Cell lysates were probed for cyclin D3 (β-actin serves as loading control). Data are representative of three independent experiments.

c-Myc Requires cyclin D3 for Proliferative Expansion of GC B Cells

Our results indicated that cyclin D3 is the major D-type cyclin that controls GC B cell proliferation. However, the specific protein dosage of c-Myc dictates the relative proliferative expansion of DZ GC B cells (Finkin et al., 2019). To test the relevance of cyclin D3 in this process, we posited the question whether ectopic c-MYC protein can overcome the proliferative defects of cyclin D3-deficient GC B cells. For this, we crossed Ccnd3fl/fl Cγ1-Cre mice to LSLMYC mice to ablate cyclin D3 and induce c-MYC simultaneously in ongoing GC responses. When we immunized these mice with SRBCs, we found no difference in the GC frequency compared with cyclin D3 deficiency alone (Ccnd3fl/fl Cγ1-Cre) (Figures 4A and 4B). Also, the zonal ratio between DZ and LZ GC B cells was not changed in these mice (Figure 4C). However, c-MYC control mice (Ccnd3+/+ LSLMYC Cγ1-Cre) had higher GC B cells compared with mice without c-MYC (Ccnd3+/+ Cγ1-Cre), which was consistent with earlier reports (Sander et al., 2012). Furthermore, c-MYC-induced hCD2 reporter expression was significantly lower in Ccnd3fl/fl LSLMYC Cγ1-Cre mice than in Ccnd3+/+ LSLMYC Cγ1-Cre mice, highlighting Cre-mediated induction of c-MYC in these GC B cells, but lower accumulation of c-MYC+ cells upon cyclin D3 loss (Figure 4D).

Figure 4. Enforced c-MYC Expression in GC B Cells Does Not Overcome cyclin D3 Deficiency.

Figure 4.

Open in a new tab

(A) Ectopic expression of c-MYC in Ccnd3fl/fl Cγ1-Cre GC B cells compared with Ccnd3+/+ Cγ1-Cre controls. Splenocytes after SRBC immunization on day 10 were analyzed. Single cells were gated on B cells (B220+) to determine GC B cell frequency based on GL7+FAS+ expression.

(B) Quantification of (A) overall GC B cell frequency (n = 3).

(C) Quantification of respective DZ/LZ ratio of GC B cells based on relative expression of CXCR4hiCD86lo (DZ) and CXCR4loCD86hi (LZ) (n = 3). See also Figure S4A.

(D) Reporter expression of hCD2 in Ccnd3fl/fl LSLMYC Cγ1-Cre was compared with Ccnd3+/+ LSLMYC Cγ1-Cre (n = 3). See also Figure S4B. Data are representative of two to three independent experiments.

DISCUSSION

cyclin D3 Is the Preferred and Indispensable D-Type cyclin during GC Expansion

Our data indicate that cyclin D3 is crucial for DZ GC B cell proliferation. Although cyclins D1, D2, and D3 can bind interchangeably to CDK4/6, it has been shown that substrate specificities are quite different in cyclin D3:CDK6 compared with cyclin D1:CDK4 complexes (Anders et al., 2011; Sarcevic et al., 1997). In human GC B cells, it has been shown that cyclin D3 mostly functions with CDK6, whereas in murine B cells this appears to be via CDK4 (Tanguay et al., 2001; Wagner et al., 1998). Furthermore, kinase-independent roles of D-type cyclins highlight unique features among its members, including cyclin D1 regulating DNA repair through interaction with Rad51 (Jirawatnotai et al., 2011; Musgrove et al., 2011). Although high homology among D-type cyclins exists, specific cyclin D2 expression under the control of the Ccnd3 locus still fails to compensate for the loss of cyclin D3 during B and T lymphopoiesis (Sawai et al., 2012), suggesting that non-overlapping roles appear to occur due to distinct regions in the protein rather than expression patterns. However, cyclin D3 can compensate for the loss of cyclin D2 in B cells (Lam et al., 2000). Thereby, cyclin D3 appears to show functional redundancy with cyclin D2 but possesses unique roles irreplaceable by cyclin D2 in B cells.

BCR Signaling Impedes FOXO1-cyclin D3 Signaling in GC B Cells

We show that BCR signaling in GC B cells, which typically occurs in LZ GC B cells, controls cyclin D3 protein (Figures 3D and 3E). We have previously shown that GSK3 is involved in the control of cyclin D3 protein in GC B cells (Cato et al., 2011). However, this role might be less prominent in LZ GC B cells as AKT appears to inhibit GSK3 (phospho-GSK3βS9), which overlaps with c-Myc-expressing cells in GC B cells (Jellusova et al., 2017). AKT also mediates the nuclear export and degradation of FOXO1 via phosphorylation of Thr24 in GC B cells (Luo et al., 2018), which is consistent with our results (Figure 3E). Nuclear trapped FOXO1T24A mutant showed higher levels of cyclin D3 protein (Figure 3F) and transcripts (Figure S3D) in stimulated B cells. FOXO1 has been shown to regulate cyclin D3 expression in malignant B cells (Gehringer et al., 2019; Wang et al., 2018); however, several studies did not observe proliferative defects in GC B cells in the absence of FOXO1 (Dengler et al., 2008; Dominguez-Sola et al., 2015; Sander et al., 2015). Although Inoue et al. (2017) showed lower proliferation in FOXO1-deficient GC B cells, this effect was enhanced in competition to wild-type cells and more modest alone. It is not clear how proliferation in FOXO1-deficient GC B cells is controlled. Our results suggest that cyclin D3 expression in the DZ is in part regulated by FOXO1, which is inhibited by BCR signaling in the LZ. However, additional factors downstream of BCR signaling might be involved in the regulation of cyclin D3. The regulation of cyclin D3 in LZ GC B cells may act as a brake to DZ-to-LZ transitioning cells for proper selection, as DZ GC cells could arrive to the LZ being in late G1 phase (Stewart et al., 2018), but it requires further investigations to clarify the functional relevance of this process.

c-Myc Requires cyclin D3 Signaling to Relay DZ GC B Cell Expansion

Enforced levels of c-MYC could not overcome the expansion deficits of cyclin D3-deficient GC B cells (Figure 4). During GC B cells selection, the expression of c-Myc is integral and loss of c-Myc leads to the collapse of the GC B cell reaction (Calado et al., 2012). The expression of c-Myc is restricted to LZ GC B cells, and it has been shown that c-Myc induces AP4, which persists after c-Myc decay and regulates cyclin D3 expression (Chou et al., 2016). However, several findings indicate that GC B cells can start S phase in the LZ before entering the DZ for extended expansion (Gitlin et al., 2014; Hauser et al., 2007; Victora et al., 2010). It is possible that c-Myc initiates this step via cyclin D2, which then displaces the positively selected cell from BCR signaling, permitting FOXO1 accumulation to induce CXCR4 for DZ entry and cyclin D3 expression for DZ expansion. Overall, our findings indicate the dependency of c-Myc on cyclin D3 to relay the positive expansion signal from the LZ to the DZ.

cyclin D3 Is Functionally Relevant in B Cell Malignancies

Our study highlights that control of cyclin D3 is required for proper proliferation of GC B cells but also can act as an efficient brake to halt improper GC expansion. The normal biology of GC B cells has profound implications for B cell malignancies, in particular for GC-derived lymphomas. Among patients with diffuse large B cell lymphoma (DLBCL), ~3.3% (33/1,001) have CCND3 mutation, which occur frequently in exon 5, leading to a premature stop or missense mutations affecting Thr283 or nearby residues (Reddy et al., 2017). DLBCL patients with oncogenic NOTCH pathway aberration appear to have the highest enrichment for CCND3 mutations (Schmitz et al., 2018). In Burkitt lymphoma (BL), all subtypes are characterized by MYC deregulation, but CCND3 mutations predominantly occur in the sporadic BL subtype (Panea et al., 2019; Schmitz et al., 2012). Given its unique role in B cell biology and wide involvement in B cell malignancies, it is worthwhile to understand how cyclin D3 is specifically involved in the pathogenesis of B cell lymphomas. We CRISPR-engineered mutant mice with hyper-stabilized cyclin D3, which have increased GC B cell frequencies (Figure 2). In our mouse cohort, we also maintained mice under continuous antigenic challenge for up to a year, but we did not observe malignant transformation of GC B cells (data not shown). Interestingly, enforced cyclin D3 expression can induce lymphomagenesis in combination with other oncogenic factors. Mice reconstituted with hematopoietic progenitor cells from VavP-BCL2 mice, which are prone to lymphomagenesis, have shortened disease onset when transduced with cyclin D3T283A (Oricchio et al., 2014). In in-vitro-derived GC B cells, four factors (i.e., c-MYC, TCF3, AKT, and TCL1A) in addition to cyclin D3T283A induced the occurrence of tumors (Arita et al., 2014). In human B cells, cyclin D3 in combination with gains in BCL2, BCL6, and dominant-negative p53 lead to tumor formation (Caeser et al., 2019). These reports and our results highlight the potential requirement of other factors for cyclin D3 (or cyclin D3T283A) during lymphomagenesis to exert an oncogenic function. Beyond lymphoma, cyclin D3T283A occurrence in B cells may also contribute to the pathogenesis of autoimmune disorders (Singh et al., 2020). Overall, cyclin D3 plays a crucial and unique role during normal GC biology and its control is critical to prevent GC-derived diseases.

STAR★METHODS

RESOURCE AVAILABILITY

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Parham Ramezani-Rad (prad@sbp.edu).

Materials Availability

All unique reagents generated in this study are available from the Lead Contact and may require completion of a Materials Transfer Agreement.

Data and Code Availability

This study did not generate any unique datasets or code.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Mice

Ccnd3fl/fl, Foxo1fl/fl(T24A), Cγ1-Cre, Mb1Cre, LSLMYC, μMT and Cd19Cre were all kept on a C57BL/6 background. Mouse crossings are indicated in the figures and text. The following activity of Cre recombinase occurs in these mouse lines: Mb1Cre (pro-B cells), Cd19Cre (pro-B to mature B cells) and Cγ1-Cre (upon onset of germ-line Cγ1 transcription in activated B cells/GC B cells). Female and male experimental animals over 6 weeks of age were age-matched without gender bias. Animals were housed under specific-pathogen-free conditions and a 12 h light/12 h dark cycle in the animal facility of SBP. Experimental procedures were in accordance with IACUC regulations.

CRISPR-engineered knockin mice

To generate knockin mice with a cyclin D3 missense mutation (Thr to Ala substitution at residue 283; T283A) in the native Ccnd3 locus, appropriate guides with close proximity to exon 7 in the murine Ccnd3 locus were first selected with Feng Zhang’s lab CRISPR Design tool (discontinued https://zlab.bio/guide-design-resources). The guide with the lowest off-target binding using Cas-OFFinder (http://www.rgenome.net/cas-offinder) was selected. The complete Ccnd3 sgRNA (spacer and scaffold) was transcribed with HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs). A donor template with a single point mutation for Ccnd3T283A (substitution of adenine (A) for guanine (G): ACT to GCT) in the center and homologous flanking arms (to the native Ccnd3 locus) was synthesized as a single-stranded oligodeoxynucleotide (ssODN) (Integrated DNA Technologies). A master mixture of Cas9 mRNA (50ng/μl) (Thermo Fisher Scientific), Ccnd3 sgRNA (25ng/μl) and Ccnd3T283A ssODN (100ng/μl) was prepared and microinjected into the cytoplasm of zygotes from superovulated female C57BL/6 mice and cultured until the two-cell stage to be then implanted in the oviduct of pseudopregnant female mice. Resulting pups were screened for editing efficiency by PCR amplification of the genomic region and direct sequencing of amplicons. Potential mosaicism or further validation was confirmed by sequencing of individual amplicons using the Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific).

Cell culture

B splenocytes were MACS-purified, collecting the negative fraction of CD43 Microbeads (Miltenyi Biotec). GC B cells were MACS-purified, collecting the negative fraction of CD43 Microbeads, CD38 (90) Biotin (Thermo Fisher Scientific), CD11c (N418) Biotin (Thermo Fisher Scientific) and anti-Biotin Microbeads (Miltenyi Biotec). Cells were cultured in RPMI 1640 (Corning) supplemented with 10% FBS (MilliporeSigma and Thermo Fisher Scientific), 1x Penicillin-Streptomycin, 1x MEM Nonessential Amino Acids (Corning), 1mM Sodium Pyruvate, 2mM GlutaMax, and 55 μM 2-Mercaptoethanol (Thermo Fisher Scientific). Cells were stimulated with the following reagents: 10μg/ml goat anti-mouse IgM F(ab’)2, 10μg/ml goat anti-mouse IgG F(ab’)2 (Jackson ImmunoResearch Labs), 10μg/ml goat anti-mouse κ F(ab’)2 (SouthernBiotech), 10ng/ml mouse rBaff (R&D Systems), 5μg/ml rat anti-mouse CD40 (1C10) and 10ng/ml mouse rIL-4 (Thermo Fisher Scientific). For in vitro-derived GC B cell cultures, B splenocytes were cultured on 40LB cells (3T3 fibroblasts expressing CD40L and secreting BAFF) with addition of 1ng/ml mouse rIL-4.

METHOD DETAILS

Immunization

Mice were immunized i.p. or i.v. with 100μl of PBS-washed citrated SRBCs (Colorado Serum Company) or i.p. with 50μg NP20-CGG (Biosearch Technologies) plus Imject Alum Adjuvant (ThermoFisher Scientific) in 100μl PBS. For SRBC-specific antibody titers, serum was collected on indicated days and bound to SRBCs and detected with IgM (II/41) APC (Thermo Fisher Scientific) and IgG1 (A85–1) PE (BD Biosciences) by flow cytometry. For BrdU pulse experiments, mice were injected i.p. with 2mg BrdU in 200μl PBS and sacrificed 2 h later. Incorporation of BrdU was detected using the BrdU Flow Kit (BD Biosciences) according to manufacturer’s instructions and BrdU (BU20A) PE (Thermo Fisher Scientific).

Flow cytometry

Single cell suspensions from tissues were ACK lysed and stained in 1% FBS in PBS containing 0.05% sodium azide. Cells were gated according to size and granularity based on FSC-A and SSC-A. Doublets were excluded by FSC-A versus FSC-H gating. Non-antigen-specific binding was blocked with CD16/CD32 (2.4G2) (BD Biosciences). The following antibodies were used for staining: B220 (RA3–6B2) APC-eFluor780, IgM (II/41) APC, IgD (11–26c) FITC, CD86 (PO3.1) PE, hCD2 (RPA-2.10) APC (Thermo Fisher Scientific), CXCR4 (L276F12) APC, CD86 (GL1) PerCP Cy5.5 (BioLegend), κ (187.1) FITC, CD19 (1D3) APC-Cy7, FAS (Jo2) PE-Cy7, GL7 FITC and IgG1 (A85–1) FITC (BD Biosciences). Cell proliferation was analyzed using the eBioscience Cell Proliferation Dye eFluor670 (Thermo Fisher Scientific). Samples were acquired on a FACSCanto (BD Biosciences) and analyzed with Flowjo (Becton, Dickinson and Company).

Immunofluorescence

Spleens embedded in Tissue TEK O.C.T. (Sakura Finetek) were sectioned on a Microtome Cryostat HM 505 E (Microm). Sections were fixed with acetone and blocked with 5% FBS in PBS. Fluorescent images were acquired on an Axio Imager.M1 (Zeiss) microscope equipped with an Orca-ER (Hamamatsu) camera. SlideBook (3i) was used as the imaging software. Gimp (GNU Image Manipulation Program) was used for image editing. The following antibodies/reagents were used: B220 (RA3–6B2) APC, CD21/CD35 (4E3) FITC (Thermo Fisher Scientific), PNA Biotin (Vector Laboratories) and Streptavidin-Cy3 (Jackson ImmunoResearch Labs).

qRT-PCR

RNA was extracted with RNeasy Mini Kit (QIAGEN), cDNA was synthesized with iScript cDNA Synthesis Kit and reactions were run with iTaq Universal SYBR green (Bio-Rad) on a LightCycler 96 (Roche). The following program was used: preincubation at 95°C for 5 mins, 2-step amplification of 40 cycles at 95°C for 10 s and 60°C for 40 s.

Immunoblotting

Cells were lysed either in CelLytic M (Millipore Sigma) with Protease/Phosphatase Inhibitor Cocktail (Cell Signaling Technology) or in 1% SDS buffer. Immunoblotting was performed following standard procedures. PVDF membranes were blocked with 5% Milk in TBST and probed with primary antibodies overnight on a rotating platform at 4°C. The following antibodies were used: c-Myc (D84C12), cyclin D2 (D52F9), cyclin D3 (DCS22), FOXO1 (C29H4), phospho-FOXO1T24, phospho-AktS473 (D9E), β-actin (13E5) (Cell Signaling Technology) and cyclin D2 (Santa Cruz Biotechnology). The following horseradish-peroxidase-coupled antibodies were used as secondaries: donkey anti-rabbit IgG and goat anti-mouse IgG (Jackson ImmunoResearch Labs). Protein signal was detected by film or on a ChemiDoc Imaging System (Bio-Rad).

QUANTIFICATION AND STATISTICAL ANALYSIS

The sample size (n) indicated in the figure legends defines the number of mice used for each experimental group. The statistical analysis was performed by Prism 8 (Graphpad Software). The p value was calculated using an unpaired t test and is shown in the figures.

Supplementary Material

1
2

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Goat anti-mouse IgM F(ab’)2 Jackson ImmunoResearch Labs Cat# 115-006-075: RRID:AB_2338474
Goat anti-mouse IgG F(ab’)2 Jackson ImmunoResearch Labs Cat# 115-006-062; RRID:AB_2338470
Goat anti-mouse κ F(ab’)2 SouthernBiotech Cat# 1052-01; RRID:AB_2794386
Rat anti-mouse CD40 (clone 1C10) Thermo Fisher Scientific Cat# 16-0401-86; RRID:AB_468943
Rat anti-CD16/CD32 (clone: 2.4G2) BD Biosciences Cat# 553142; RRID:AB_394657
Rat anti-B220 (clone: RA3–6B2) APC-eFluor780 Thermo Fisher Scientific Cat# 47-0452-82; RRID:AB_1518810
Rat anti-CD19 (clone: 1D3) APC-Cy7 BD Biosciences Cat# 557655; RRID:AB_396770
Rat anti-IgM (clone: II/41) APC Thermo Fisher Scientific Cat# 17-5790-82; RRID:AB_469458
Rat anti-IgD (clone: 11–26c) FITC Thermo Fisher Scientific Cat# 11-5993-85; RRID:AB_465347
Rat anti-κ (clone: 187.1) FITC BD Biosciences Cat# 550003; RRID:AB_393527
Rat anti-CXCR4 (clone: L276F12) APC BioLegend Cat# 146507; RRID:AB_2562784
Rat anti-CD86 (clone: GL1) PerCP Cy5.5 BioLegend Cat# 105028; RRID:AB_2074994
Rat anti-CD86 (clone: PO3.1) PE Thermo Fisher Scientific Cat# 12-0861-82; RRID:AB_465765
Armenian hamster anti-FAS (clone: Jo2) PE-Cy7 BD Biosciences Cat# 557653; RRID:AB_396768
Rat anti-mouse T- and B Cell Activation Antigen (clone: GL7) FITC BD Biosciences Cat# 553666; RRID:AB_394981
Mouse anti-BrdU (clone: BU20A) PE Thermo Fisher Scientific Cat# 12-5071-42; RRID:AB_11149499
Rat anti-IgG1 (clone: A85–1) FITC BD Biosciences Cat# 553443; RRID:AB_394862
Rat anti-IgG1 (clone: A85–1) PE BD Biosciences Cat# 550083; RRID:AB_393553
Rat anti-B220 (clone: RA3–6B2) APC Thermo Fisher Scientific Cat# 17-0452-82; RRID:AB_469395
Rat anti-CD21/CD35 (clone: 4E3) FITC Thermo Fisher Scientific Cat# 11-0212-82; RRID:AB_464976
Mouse anti-hCD2 (clone: RPA-2.10) APC Thermo Fisher Scientific Cat# 17-0029-42; RRID:AB_10805740
Rabbit anti-c-Myc (clone: D84C12) Cell Signaling Technology Cat# 5605; RRID:AB_1903938
Rabbit anti-cyclin D2 (clone: D52F9) Cell Signaling Technology Cat# 3741; RRID:AB_2070685
Mouse anti-cyclin D3 (clone: DCS22) Cell Signaling Technology Cat# 2936; RRID:AB_2070801
Rabbit anti-FOXO1 (clone: C29H4) Cell Signaling Technology Cat# 2880; RRID:AB_2106495
Rabbit anti-phospho-FOXO1/FOXO3a (T24/T32) Cell Signaling Technology Cat# 9464; RRID:AB_329842
Rabbit anti-phospho-Akt (S473) (clone: D9E) Cell Signaling Technology Cat# 4060; RRID:AB_2315049
Rabbit anti-β-Actin (clone: 13E5) Cell Signaling Technology Cat# 4970; RRID:AB_2223172
Rabbit anti-cyclin D2 Santa Cruz Biotechnology Cat# sc-593; RRID:AB_2070794
Donkey anti-rabbit IgG HRP Jackson ImmunoResearch Labs Cat# 711-035-152; RRID:AB_10015282
Goat anti-mouse IgG HRP Jackson ImmunoResearch Labs Cat# 115-035-003; RRID:AB_10015289
Rat anti-CD43 MicroBeads Miltenyi Biotec Cat# 130-049-801
Rat anti-CD38 (clone: 90) Biotin Thermo Fisher Scientific Cat# 13-0381-81; RRID:AB_466427
Armenian hamster anti-CD11c (clone: N418) Biotin Thermo Fisher Scientific Cat# 13-0114-85; RRID:AB_466364
Mouse anti-Biotin MicroBeads Miltenyi Biotec Cat# 130-090-485; RRID:AB_244365
Biological Samples
Citrated sheep red blood cells Colorado Serum Company Cat# 31102
Chemicals, Peptides, and Recombinant Proteins
Mouse rBaff R&D Systems Cat# 2106-BF; 8876-BF
Mouse rIL-4 Thermo Fisher Scientific Cat# PMC0045
Cell Proliferation Dye eFluor670 Thermo Fisher Scientific Cat# 65-0840-85
NP20-CGG Biosearch Technologies Cat# N-5055C-5
Imject Alum Adjuvant Thermo Fisher Scientific Cat# 77161
PNA Biotin Vector Laboratories Cat# B-1075; RRID:AB_2313597
Streptavidin-Cy3 Jackson ImmunoResearch Labs Cat# 016-160-084; RRID:AB_2337244
Critical Commercial Assays
BrdU Flow Kit BD Biosciences Cat# 559619; RRID:AB_2617060
Zero Blunt TOPO PCR Cloning Kit Thermo Fisher Scientific Cat# 45-0031
HiScribe T7 Quick High Yield RNA Synthesis Kit New England Biolabs Cat# E2050S
iScript cDNA Synthesis Kit Bio-Rad Cat# 1708891
iTaq Universal SYBR green Bio-Rad Cat# 1725121
Experimental Models: Cell Lines
Mouse: 40LB cells Nojima et al., 2011 N/A
Experimental Models: Organisms/Strains
Mouse: Ccnd3fl/fl: Ccnd3tm2.1Pisc Choi et al., 2012 MGI:5468337
Mouse: Ccnd3T283A This study N/A
Mouse: Cγ1-Cre: B6.129P2(Cg)-Ighg1tm1(cre)Cgn/J Casola et al., 2006 IMSR Cat# JAX:010611; RRID:IMSR_JAX:010611
Mouse: Foxo1fl/fll(T24A) Zhu et al., 2019 N/A
Mouse: Mb1Cre: B6.C(Cg)-Cd79atm1(cre)Reth/EhobJ Hobeika et al., 2006 IMSR Cat# JAX:020505; RRID:IMSR_JAX:020505
Mouse: LSLMYC: C57BL/6N-Gt(ROSA) 26Sortm13(CAG-MYC,-CD2*)Rsky/J Calado et al., 2012 IMSR Cat# JAX:020458; RRID:IMSR_JAX:020458
Mouse: μMT: B6.129S2-Ighmtm1Cgn/J Kitamura et al., 1991 IMSR Cat# JAX:002288; RRID:IMSR_JAX:002288
Mouse: Cd19Cre: B6.129P2(C)-Cd19tm1(cre)Cgn/J Rickert et al., 1997 IMSR Cat# JAX:006785; RRID:IMSR_JAX:006785
Oligonucleotides
Ccnd3 sgRNA template: GCTAGAGCCCCGGGGGGCTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT Integrated DNA Technologies N/A
Ccnd3T283A ssODN donor template: GAGAGCCTCAGGGAAGCTGCTCAGACAGCCCCCAGCCCAGTGCCCAAAGCCCCCCGGGGCTCTAGCAGCCAGGGGCCCAGTCAGACCAGCGCTCCCACAGATGTCACAGCCATTCACCTGTAGCTTGAGACAGGCCCTCTCAGGCCACCAAGCAGAGGAGGGGCCCCTGCCACCCCCTCCCTG Integrated DNA Technologies N/A
Cas9 mRNA Thermo Fisher Scientific Cat# A29378
Primer: Ccnd3 locus for sequencing Forward: TGAAGGACACTTGGCATGTAGA Integrated DNA Technologies N/A
Primer: Ccnd3 locus for sequencing Reverse: GAGGGACTCAAAAGAAATGCTG Integrated DNA Technologies N/A
Primer: Actb for qRT-PCR Forward: GGCTGTATTCCC CTCCATCG Integrated DNA Technologies N/A
Primer: Actb for qRT-PCR Reverse: CCAGTTGGTAAC AATGCCATGT Integrated DNA Technologies N/A
Primer: Ccnd3 for qRT-PCR Forward: CAGAGTTTACT CCGCCTGGA Integrated DNA Technologies N/A
Primer: Ccnd3 for qRT-PCR Reverse: AGCCAGAGGG AAGACATCCT Integrated DNA Technologies N/A
Software and Algorithms
FlowJo 10 Becton, Dickinson and Company https://www.flowjo.com/
Prism 8 GraphPad Software https://www.graphpad.com/scientific-software/prism/
GIMP The GIMP Team https://www.gimp.org/
Open in a new tab

Highlights.

  • Dark zone germinal center (GC) B cells are diminished upon cyclin D3 loss

  • Hyperstabilized cyclin D3T283A mutant drives dark zone GC B cell expansion

  • B cell receptor signaling in GC B cells suppresses cyclin D3

  • c-Myc requires cyclin D3 for GC B cell expansion

ACKNOWLEDGMENTS

We would like to thank Peter (Piotr) Sicinski for providing the Ccnd3fl/fl mice and Daisuke Kitamura for providing the 40LB cells. We further thank Ella Kothari and Jun Zhao at the UCSD Transgenic Mouse Core for microinjections into murine zygotes and the SBP animal facility (Diana Sandoval and Buddy Charbono) for maintenance of our mouse colonies. Also, we thank the Rickert laboratory for discussions. This work was supported by National Institutes of Health grants R01AI041649 and R01AI122344 (to R.C.R.) and a postdoctoral fellowship from the Cancer Centers Council (C3) (to P.R.R.).

Footnotes

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at https://doi.org/10.1016/j.celrep.2020.108403.

DECLARATION OF INTERESTS

The authors declare no competing interests.

REFERENCES

  1. Akkaya M, Kwak K, and Pierce SK (2019). B cell memory: building two walls of protection against pathogens. Nat. Rev. Immunol 20, 229–238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anders L, Ke N, Hydbring P, Choi YJ, Widlund HR, Chick JM, Zhai H, Vidal M, Gygi SP, Braun P, and Sicinski P (2011). A systematic screen for CDK4/6 substrates links FOXM1 phosphorylation to senescence suppression in cancer cells. Cancer Cell 20, 620–634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arita K, Tsuzuki S, Ohshima K, Sugiyama T, and Seto M (2014). Synergy of Myc, cell cycle regulators and the Akt pathway in the development of aggressive B-cell lymphoma in a mouse model. Leukemia 28, 2270–2272. [DOI] [PubMed] [Google Scholar]
  4. Bouchard C, Thieke K, Maier A, Saffrich R, Hanley-Hyde J, Ansorge W, Reed S, Sicinski P, Bartek J, and Eilers M (1999). Direct induction of cyclin D2 by Myc contributes to cell cycle progression and sequestration of p27. EMBO J. 18, 5321–5333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke SL, Fenner R, Usheva Z, Runge HFP, et al. (2019). Genetic modification of primary human B cells to model high-grade lymphoma. Nat. Commun 10, 4543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Calado DP, Sasaki Y, Godinho SA, Pellerin A, Köchert K, Sleckman BP, de Alborán IM, Janz M, Rodig S, and Rajewsky K (2012). The cell-cycle regulator c-Myc is essential for the formation and maintenance of germinal centers. Nat. Immunol 13, 1092–1100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Casola S, Cattoretti G, Uyttersprot N, Koralov SB, Seagal J, Hao Z, Waisman A, Egert A, Ghitza D, and Rajewsky K (2006). Tracking germinal center B cells expressing germ-line immunoglobulin gamma1 transcripts by conditional gene targeting. Proc. Natl. Acad. Sci. USA 103, 7396–7401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cato MH, Chintalapati SK, Yau IW, Omori SA, and Rickert RC (2011). Cyclin D3 is selectively required for proliferative expansion of germinal center B cells. Mol. Cell. Biol 31, 127–137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Choi YJ, Li X, Hydbring P, Sanda T, Stefano J, Christie AL, Signoretti S, Look AT, Kung AL, von Boehmer H, and Sicinski P (2012). The requirement for cyclin D function in tumor maintenance. Cancer Cell 22, 438–451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chou C, Verbaro DJ, Tonc E, Holmgren M, Cella M, Colonna M, Bhattacharya D, and Egawa T (2016). The Transcription Factor AP4 Mediates Resolution of Chronic Viral Infection through Amplification of Germinal Center B Cell Responses. Immunity 45, 570–582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cooper AB, Sawai CM, Sicinska E, Powers SE, Sicinski P, Clark MR, and Aifantis I (2006). A unique function for cyclin D3 in early B cell development. Nat. Immunol 7, 489–497. [DOI] [PubMed] [Google Scholar]
  12. Dengler HS, Baracho GV, Omori SA, Bruckner S, Arden KC, Castrillon DH, DePinho RA, and Rickert RC (2008). Distinct functions for the transcription factor Foxo1 at various stages of B cell differentiation. Nat. Immunol 9, 1388–1398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dominguez-Sola D, Victora GD, Ying CY, Phan RT, Saito M, Nussenzweig MC, and Dalla-Favera R (2012). The proto-oncogene MYC is required for selection in the germinal center and cyclic reentry. Nat. Immunol 13, 1083–1091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dominguez-Sola D, Kung J, Holmes AB, Wells VA, Mo T, Basso K, and Dalla-Favera R (2015). The FOXO1 Transcription Factor Instructs the Germinal Center Dark Zone Program. Immunity 43, 1064–1074. [DOI] [PubMed] [Google Scholar]
  15. Finkin S, Hartweger H, Oliveira TY, Kara EE, and Nussenzweig MC (2019). Protein Amounts of the MYC Transcription Factor Determine Germinal Center B Cell Division Capacity. Immunity 51, 324–336.e5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gehringer F, Weissinger SE, Swier LJ, Möller P, Wirth T, and Ushmorov A (2019). FOXO1 Confers Maintenance of the Dark Zone Proliferation and Survival Program and Can Be Pharmacologically Targeted in Burkitt Lymphoma. Cancers (Basel) 11, 1427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gitlin AD, Shulman Z, and Nussenzweig MC (2014). Clonal selection in the germinal centre by regulated proliferation and hypermutation. Nature 509, 637–640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hauser AE, Junt T, Mempel TR, Sneddon MW, Kleinstein SH, Henrickson SE, von Andrian UH, Shlomchik MJ, and Haberman AM (2007). Definition of germinal-center B cell migration in vivo reveals predominant intrazonal circulation patterns. Immunity 26, 655–667. [DOI] [PubMed] [Google Scholar]
  19. Hobeika E, Thiemann S, Storch B, Jumaa H, Nielsen PJ, Pelanda R, and Reth M (2006). Testing gene function early in the B cell lineage in mb1-cre mice. Proc. Natl. Acad. Sci. USA 103, 13789–13794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Inoue T, Shinnakasu R, Ise W, Kawai C, Egawa T, and Kurosaki T (2017). The transcription factor Foxo1 controls germinal center B cell proliferation in response to T cell help. J. Exp. Med 214, 1181–1198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jellusova J, Cato MH, Apgar JR, Ramezani-Rad P, Leung CR, Chen C, Richardson AD, Conner EM, Benschop RJ, Woodgett JR, and Rickert RC (2017). Gsk3 is a metabolic checkpoint regulator in B cells. Nat. Immunol 18, 303–312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jirawatnotai S, Hu Y, Michowski W, Elias JE, Becks L, Bienvenu F, Zagozdzon A, Goswami T, Wang YE, Clark AB, et al. (2011). A function for cyclin D1 in DNA repair uncovered by protein interactome analyses in human cancers. Nature 474, 230–234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kitamura D, Roes J, Kühn R, and Rajewsky K (1991). A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin mu chain gene. Nature 350, 423–426. [DOI] [PubMed] [Google Scholar]
  24. Lam EW, Glassford J, Banerji L, Thomas NS, Sicinski P, and Klaus GG (2000). Cyclin D3 compensates for loss of cyclin D2 in mouse B-lymphocytes activated via the antigen receptor and CD40. J. Biol. Chem 275, 3479–3484. [DOI] [PubMed] [Google Scholar]
  25. Luo W, Weisel F, and Shlomchik MJ (2018). B Cell Receptor and CD40 Signaling Are Rewired for Synergistic Induction of the c-Myc Transcription Factor in Germinal Center B Cells. Immunity 48, 313–326.e5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Mesin L, Ersching J, and Victora GD (2016). Germinal Center B Cell Dynamics. Immunity 45, 471–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Musgrove EA, Caldon CE, Barraclough J, Stone A, and Sutherland RL (2011). Cyclin D as a therapeutic target in cancer. Nat. Rev. Cancer 11, 558–572. [DOI] [PubMed] [Google Scholar]
  28. Naderi S, Gutzkow KB, Låhne HU, Lefdal S, Ryves WJ, Harwood AJ, and Blomhoff HK (2004). cAMP-induced degradation of cyclin D3 through association with GSK-3beta. J. Cell Sci 117, 3769–3783. [DOI] [PubMed] [Google Scholar]
  29. Nemazee D (2017). Mechanisms of central tolerance for B cells. Nat. Rev. Immunol 17, 281–294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nojima T, Haniuda K, Moutai T, Matsudaira M, Mizokawa S, Shiratori I, Azuma T, and Kitamura D (2011). In-vitro derived germinal centre B cells differentially generate memory B or plasma cells in vivo. Nat. Commun 2, 465. [DOI] [PubMed] [Google Scholar]
  31. Oricchio E, Ciriello G, Jiang M, Boice MH, Schatz JH, Heguy A, Viale A, de Stanchina E, Teruya-Feldstein J, Bouska A, et al. (2014). Frequent disruption of the RB pathway in indolent follicular lymphoma suggests a new combination therapy. J. Exp. Med 211, 1379–1391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Panea RI, Love CL, Shingleton JR, Reddy A, Bailey JA, Moormann AM, Otieno JA, Ong’echa JM, Oduor CI, Schroeder KMS, et al. (2019). The whole-genome landscape of Burkitt lymphoma subtypes. Blood 134, 1598–1607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Peled JU, Yu JJ, Venkatesh J, Bi E, Ding BB, Krupski-Downs M, Shaknovich R, Sicinski P, Diamond B, Scharff MD, and Ye BH (2010). Requirement for cyclin D3 in germinal center formation and function. Cell Res. 20, 631–646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ramezani-Rad P, and Rickert RC (2017). Murine models of germinal center derived-lymphomas. Curr. Opin. Immunol 45, 31–36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Reddy A, Zhang J, Davis NS, Moffitt AB, Love CL, Waldrop A, Leppa S, Pasanen A, Meriranta L, Karjalainen-Lindsberg ML, et al. (2017). Genetic and Functional Drivers of Diffuse Large B Cell Lymphoma. Cell 171, 481–494.e15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Richter J, Schlesner M, Hoffmann S, Kreuz M, Leich E, Burkhardt B, Rosolowski M, Ammerpohl O, Wagener R, Bernhart SH, et al. ; ICGC MMML-Seq Project (2012). Recurrent mutation of the ID3 gene in Burkitt lymphoma identified by integrated genome, exome and transcriptome sequencing. Nat. Genet 44, 1316–1320. [DOI] [PubMed] [Google Scholar]
  37. Rickert RC, Roes J, and Rajewsky K (1997). B lymphocyte-specific, Cre-mediated mutagenesis in mice. Nucleic Acids Res. 25, 1317–1318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Sander S, Calado DP, Srinivasan L, Köchert K, Zhang B, Rosolowski M, Rodig SJ, Holzmann K, Stilgenbauer S, Siebert R, et al. (2012). Synergy between PI3K signaling and MYC in Burkitt lymphomagenesis. Cancer Cell 22, 167–179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sander S, Chu VT, Yasuda T, Franklin A, Graf R, Calado DP, Li S, Imami K, Selbach M, Di Virgilio M, et al. (2015). PI3 Kinase and FOXO1 Transcription Factor Activity Differentially Control B Cells in the Germinal Center Light and Dark Zones. Immunity 43, 1075–1086. [DOI] [PubMed] [Google Scholar]
  40. Sarcevic B, Lilischkis R, and Sutherland RL (1997). Differential phosphorylation of T-47D human breast cancer cell substrates by D1-, D3-, E-, and A-type cyclin-CDK complexes. J. Biol. Chem 272, 33327–33337. [DOI] [PubMed] [Google Scholar]
  41. Sawai CM, Freund J, Oh P, Ndiaye-Lobry D, Bretz JC, Strikoudis A, Genesca L, Trimarchi T, Kelliher MA, Clark M, et al. (2012). Therapeutic targeting of the cyclin D3:CDK4/6 complex in T cell leukemia. Cancer Cell 22, 452–465. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Schatz DG, and Ji Y (2011). Recombination centres and the orchestration of V(D)J recombination. Nat. Rev. Immunol 11, 251–263. [DOI] [PubMed] [Google Scholar]
  43. Schmitz R, Young RM, Ceribelli M, Jhavar S, Xiao W, Zhang M, Wright G, Shaffer AL, Hodson DJ, Buras E, et al. (2012). Burkitt lymphoma pathogenesis and therapeutic targets from structural and functional genomics. Nature 490, 116–120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Schmitz R, Wright GW, Huang DW, Johnson CA, Phelan JD, Wang JQ, Roulland S, Kasbekar M, Young RM, Shaffer AL, et al. (2018). Genetics and Pathogenesis of Diffuse Large B-Cell Lymphoma. N. Engl. J. Med 378, 1396–1407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Sherr CJ (1995). D-type cyclins. Trends Biochem. Sci 20, 187–190. [DOI] [PubMed] [Google Scholar]
  46. Singh M, Jackson KJL, Wang JJ, Schofield P, Field MA, Koppstein D, Peters TJ, Burnett DL, Rizzetto S, Nevoltris D, et al. (2020). Lymphoma Driver Mutations in the Pathogenic Evolution of an Iconic Human Auto-antibody. Cell 180, 878–894.e19. [DOI] [PubMed] [Google Scholar]
  47. Solvason N, Wu WW, Parry D, Mahony D, Lam EW, Glassford J, Klaus GG, Sicinski P, Weinberg R, Liu YJ, et al. (2000). Cyclin D2 is essential for BCR-mediated proliferation and CD5 B cell development. Int. Immunol 12, 631–638. [DOI] [PubMed] [Google Scholar]
  48. Stewart I, Radtke D, Phillips B, McGowan SJ, and Bannard O (2018). Germinal Center B Cells Replace Their Antigen Receptors in Dark Zones and Fail Light Zone Entry when Immunoglobulin Gene Mutations are Damaging. Immunity 49, 477–489.e7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Tanguay DA, Colarusso TP, Doughty C, Pavlovic-Ewers S, Rothstein TL, and Chiles TC (2001). Cutting edge: differential signaling requirements for activation of assembled cyclin D3-cdk4 complexes in B-1 and B-2 lymphocyte subsets. J. Immunol 166, 4273–4277. [DOI] [PubMed] [Google Scholar]
  50. Victora GD, Schwickert TA, Fooksman DR, Kamphorst AO, Meyer-Hermann M, Dustin ML, and Nussenzweig MC (2010). Germinal center dynamics revealed by multiphoton microscopy with a photoactivatable fluorescent reporter. Cell 143, 592–605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wagner EF, Hleb M, Hanna N, and Sharma S (1998). A pivotal role of cyclin D3 and cyclin-dependent kinase inhibitor p27 in the regulation of IL-2-, IL-4-, or IL-10-mediated human B cell proliferation. J. Immunol 161, 1123–1131. [PubMed] [Google Scholar]
  52. Wang F, Demir S, Gehringer F, Osswald CD, Seyfried F, Enzenmüller S, Eckhoff SM, Maier T, Holzmann K, Debatin KM, et al. (2018). Tight regulation of FOXO1 is essential for maintenance of B-cell precursor acute lymphoblastic leukemia. Blood 131, 2929–2942. [DOI] [PubMed] [Google Scholar]
  53. Zhu Z, Shukla A, Ramezani-Rad P, Apgar JR, and Rickert RC (2019). The AKT isoforms 1 and 2 drive B cell fate decisions during the germinal center response. Life Sci. Alliance 25, e201900506. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1647647-supplement-1.pdf (1.5MB, pdf)
2
NIHMS1647647-supplement-2.pdf (3.5MB, pdf)

Data Availability Statement

This study did not generate any unique datasets or code.

RESOURCES