Abstract
Colorectal cancers (CRC) with microsatellite instability (MSI) or mismatch repair-deficiency (dMMR), but without detectable MMR germline mutations are termed Lynch-like syndrome (LLS). We assess the clinicopathologic and molecular characteristics of LLS tumors and the proportion in LLS, which remain poorly investigated in China. We enrolled 404 CRC patients with surgery in our institution from 2014 to 2018. LLS tumors were detected by a molecular stratification based on MMR protein expression, MLH1 methylation and MMR gene mutation. LLS tumors were profiled for germline mutations in 425 cancer-relevant genes. Among 42 MMR-deficient tumors, 7 (16.7%) were attributable to MLH1 methylation and 7 (16.7%) to germline mutations, leaving 28 LLS cases (66.6%). LLS tumors were diagnosed at a mean age of 60.7 years, had an almost equivalent ratio among rectum, left colon and right colon, and had high rates of lymph node metastases (50%, 4/28 N2). Most MMR gene mutations (88.2%, 15/17) in LLS tumors were variants of unknown significance (VUS). Two novel frameshift mutations were detected in ATM and ARID1A, which are emerging as candidate responsible genes for LLS. In this study, 28 (66.6%) MMRd tumors were classified as LLS, which were significantly higher than reports of western countries. LLS tumors were more likely to carry lymph node metastases. However, it’s hard to differentiated LLS tumors from LS through family history, tumor location, histological type of tumors, immunohistochemistry (IHC) for MMR proteins and MSI analysis.
Keywords: Colorectal cancer, Lynch-like syndrome (LLS), microsatellite instability, molecular screening, Chinese
Introduction
About 15% of colorectal cancers (CRCs) with more than 700 subtle mutations are considered as the hypermutated tumors [1]. While 75% of these hypermutated tumors are mainly caused by defects of DNA mismatch repair (MMR) system. These defects result in errors in repetitive DNA nucleotide sequences and mutations in the coding and non-coding microsatellites, which are termed microsatellite instability (MSI) [2]. Recent reports showing that MSI is a predictive biomarker for immunotherapy, which has increased the clinical gene test on CRCs with mismatch repair deficiency [3]. Identification and screening of MSI are of great significance, as patients can benefit from life-saving and cancer-related intensive surveillance [4].
Lynch syndrome (LS) is the most common CRC with MSI, accounting for approximately 1-4% of all cases [5]. MSH2 and MLH1 mutations account for most of the LS-associated CRCs, but PMS2 and MSH6 mutations are actually more prevalent on a population basis. China has the largest estimated number of LS carriers than any other country. The incidence of LS-related extraintestinal tumors has a clear upward trend [6]. Current clinical screening of LS is mainly based on the Amsterdam Standard (I/II). However, the family scale has decreased due to the family planning policy in China. This makes it a higher false negative rate when only applied family history screening [5,7]. Therefore, clinical diagnosis needs to combine molecular detection methods to improve the accuracy for LS screening. At present, most molecular tests of LS in China are lack of uniform standards and comprehensive molecular detection methods [8].
The rest MSI-CRCs traditionally were thought to be sporadic cancer through hypermethylation of its promoter region [9]. However, approximately 30% of CRCs with MSI carrying neither MLH1 methylation nor germline mutation of MMR gene are termed Lynch-like syndrome (LLS) [10]. By far, there is no consensus on management of patients with LLS because of unknown mechanism for the formation of MSI and unconfirmed suspicions of hereditary cancers [11]. Besides, there haven’t been any related reports about LLS in China till now. It’s significant to differentiate them from LS, assess their family risk and determine the appropriate surveillance approach. Hence, it is extremely urgent to strengthen the collection of clinical and genetic information of LLS patients in China.
In this study, we analyzed a large and well-annotated cohort of CRC patients in a tertiary referral center of China to assess the proportion and related clinicopathologic characteristics of LLS through the universal molecular testing strategies.
Materials and methods
Study design and patients
This retrospective study was conducted in Affiliated Hospital of Nanjing University of Chinese Medicine. Patients diagnosed with CRC were identified from the database of the Department of Pathology between October 2014 and October 2018. The overall analytical flow chart is shown in Figure 1. The ethics committee of the Affiliated Hospital of Nanjing University of Chinese Medicine approved this study (2014NL-093-02). Informed consents were obtained from all patients.
Figure 1.
Flow chart of analytical strategy. A flow chart to stratify 404 colorectal carcinomas first into pMMR & MMR (SCRC) and MSI +/- dMMR groups and the latter further into SCRC, LS, and LLS subgroups.
Clinical characteristics and pathology review
Clinical information, such as sex, age, family history and tumor location, were collected from medical records. Patients and their first-degree or second-degree relatives diagnosed with CRC or LS-associated extraintestinal cancers were considered to have a family history [8]. Pathologic information was documented from pathology reports and assessed according to the AJCC classification atlas-2ed edition [12], including the size and morphology of tumor, histological type and differentiation of tumor, stage at diagnosis (TNM), lymph nodes, vascular tumor emboli, nerve invasion and tumor deposit (TD).
Immunohistochemistry (IHC) for MMR proteins
All samples used for molecular studies were formalin-fixed paraffin embedded (FFPE) specimens. IHC analysis of 4 MMR proteins including MLH1 (ES05-IR079; Dako), MSH2 (FE11-IR085; Dako), MSH6 (EP49-IR086; Dako), and PMS2 (EP51-IR087; Dako) was performed according to the previous protocol [7]. Samples with deficient expression of one or more of the MMR proteins compared to positive controls were considered MMR deficient (dMMR), whereas tumors exhibiting normal positive staining for all four genes were MMR proficient (pMMR) [13].
MSI and BRAF V600E mutation analysis
MSI was detected on tumor-normal DNA samples using five microsatellite markers (BAT26, BAT25, D2S123, D5S346 and D17S250) [7]. Genomic DNA was extracted from paraffin-embedded tissue by Ex-DNA FFPE Genome (Cat No. T165; TIANLONG, Xian, China) following the manufacturer’s instructions. Fragments were analyzed on the Hitachi 3500 Genetic Analyzer (Applied Biosystems, Tokyo, Japan). Tumors with two or more mutated markers were identified with MSI-H. Tumors with no instable makers was called MSS.
BRAF V600E analysis was used fluorescent polymerase chain reaction (PCR). Amplicons were detected on an Agilent Mx3000P (Applied Biosystems, Paloalto, CA, USA).
Targeted panel sequencing (TPS) and data analysis
Tumors with dMMR and/or MSI were considered as MMRd-CRCs. Samples with MMRd were screened for germline variants in TPS. Sequencing was conducted in Shihe Gene Biotechnology Ltd (Nanjing, China). Hybridization-based target enrichment was carried out with 425 cancer-related genes (GeneseeqOneTM pan-cancer gene panel), including 7 MMR genes (MLH1, MLH3, MSH2, MSH6, PMS1, PMS2, EPCAM) and 418 non-MMR genes (see Table S1). FFPE samples were de-paraffinized with xylene followed by genomic DNA extraction using QIAamp DNA FFPE Tissue Kit (Qiagen) following the manufacturer’s instruction. In brief, 1 μg of fragmented genomic DNA underwent end-repairing, A-tailing and ligation with indexed adapters sequentially, followed by size selection using Agencourt AMPure XP beads (Beckman Coulter). Libraries were prepared using the KAPA Hyper Prep kit (KAPA Biosystems). Captured libraries by Dynabeads M-270 (Life Technologies) were amplified in KAPA HiFi HotStart ReadyMix (KAPA Biosystems) and quantified by qPCR using the KAPA Library Quantification 160 kit (KAPA Biosystems) for sequencing. Paired-end sequencing was on Illumina HiSeq4000 NGS platforms (Illumina) according to the manufacturer’s instructions. The mean coverage depth was >100× for tumor tissues. Trimmomatic [14] was used for FASTQ file quality control (below 15 or N bases were removed). Reads were then mapped to the reference genes using Burrows-Wheeler Aligner (BWA-mem, v0.7.12) (https://github.com/lh3/bwa/tree/master/bwakit). Local realignment around the indels and base quality score recalibration was applied with the Genome Analysis Toolkit (GATK 3.4.0) (https://software.broadinstitute.org/gatk/), which was also applied to detect germline mutations. Detected variants were subsequently annotated using ANNOVAR [15]. Interpretation of sequence variants was according to ACMG guidelines [16]. Mutations in genes with class5 & 4 were considered as pathogenic variants.
MLH1 promoter methylation analysis
MMRd tumors without germline mutations were accepted bisulfite-specific PCR (BSP) [17] to rule out MLH1 promoter methylation at the Cyagen commercial laboratory. Samples with cutoff percentage of 10% were considered to be methylated [17]. Genomic DNA was extracted and bisulfite treatment was followed by EpiTect Fast FFPE Bisulfite Kit (Cat No./ID: 59844; QIAGEN). BSP was carried out with validated PCR primers specific to MLH1 promoter sequences: ME022-hMLH1-F2: 5’-TTTTTTTTAGGAGTGAAGGAGGTTA-3’; ME022-hMLH1-R1: 5’-TTAACCCTACTCTTATAACCTCCC-3’. Forty-cycle PCR was performed as follows: denaturation 94°, 30 s; annealing 55°, 30 s; extension 40 s, 5 min. The PCR products were analyzed using a 1.5% agarose gel.
Statistical analysis
Data are analyzed by IBM SPSS statistics software 23.0 (Chicago, IL, USA). Fisher exact test, Chi-Square test and Bonferroni test are used to analyze the categorical variables for comparison of clinicopathological characteristics among LLS, LS and SCRC subgroups, while continuous variables among different groups are compared using Kruskal-Wallis test or Median test. All p-values less than 0.05 are considered to be statistically significant.
Results
A total of 563 patients with CRC were identified. One hundred and fifty-nine patients were excluded: 1) 143 outpatients only received colonoscopy examination without surgical operations in our center; 2) 13 patients received local resection without enough tissue for molecular testing; 3) the postoperative pathology of 3 patients manifested to be adenoma or anal carcinoma. Finally, 404 patients were included (Figure 1).
Molecular stratification of colorectal carcinomas
After molecular testing of IHC and MSI, 362 (89.6%) tumors with MSS & pMMR were classified as sporadic colorectal cancer (SCRC). Thirty-five tumors showed abnormal expression of MMR proteins by IHC: 9 (25.7%) failed to express MLH1 and PMS2; 3 (8.6%) showed isolated loss of MLH1; 13 (37.1%) evidenced isolated loss of PMS2; 1 (2.9%) carried the loss of MSH2 and MSH6; 1 (2.9%) evidenced isolated loss of MSH2; 5 (14.3%) showed isolated loss of MSH6; 2 (5.7%) showed loss of MSH2 and MLH1. Specially, 1 tumor (2.9%) was observed with loss of MLH1, PMS2 and MSH6. Among 35 dMMR tumors, 21 tumors were identified with MSI-H and 14 tumors with MSS. Besides, 7 MSI-H CRCs showed normal expression of MMR proteins (Figure 2). Totally, 42 tumors were classified as MMRd-CRCs.
Figure 2.
Results of universal molecular screening in 42 MMRd-tumors. Three hundred and sixty-two (89.6%) tumors were identified with MSS & pMMR; 14 (3.5%) tumors were classified as MSS & dMMR, 1 tumor with loss of MLH1 protein and MLH1 promoter methylation was diagnosed as SCRC; 7 (1.7%) tumors were diagnosed as MSI-H & pMMR, 1 tumor was identified with SCRC and 1 tumor were identified with MSH6 germline mutation; 21 (5.2%) tumors were diagnosed as MSI-H & dMMR, 5 tumors were diagnosed as SCRC, 6 tumors were identified with germline mutations (LS), including 2 MLH1 genes, 2 PMS2 genes, 1 MSH6 gene and 1 EPCAM gene respectively.
All MMRd tumors were checked by the TPS, resulting in the diagnosis of LS in seven (7/42, 16.7%). Seven (7/42, 16.7%) tumors with MLH1 methylation were also classified as SCRC, including 4 tumors with MLH1-deficiency, 1 MMR-proficient tumor with BRAF V600E mutation and 2 PMS2-deficient tumors with wild BRAF V600E. The remaining 28 (66.7%) MMRd-CRCs without MMR/EPCAM germline mutations and MLH1 promoter methylation were classified as LLS (Figures 1 and 2).
Clinicopathological characteristics of LLS tumors
There were some clinicopathological characteristics which were significantly different among patients with LLS, LS and SCRCs (Table 1). LLS were diagnosed at the mean age of 60.7 (SD 11.6) years vs 44.7 (SD 11.1) years in the LS (P=0.035), and 62.3 (SD 11.3) years in the SCRCs (P=0.246). The cumulative percentage of patients against their age of onset of CRC in LLS, LS and SCRC was summarized in Figure 3. Obviously, the diagnostic age of LLS patients was older than that of LS patients, but younger than SCRC patients. Two patients in LS (2/7, 28.6%) were found to have family history. While LLS patients with family history were six (6/28, 21.4%), which were significantly more than SCRC patients (30/362, 8.1%) (P=0.013). LLS tumors had an almost equivalent ratio among rectum, left colon and right colon, whereas LS tumors occurred in left colon (4/7, 57.1%) and right colon (3/7, 42.9%), and SCRC tumors occurred mainly in the rectum (256/369, 69.4%) (P<0.001). Mucinous carcinoma or signet ring cell carcinoma was more often in LS tumors (4/7, 57.1%), compared with 35.7% in LLS (10/28) and 14.6% in SCRC (54/369) (P=0.002). 50% of patients with LLS had lymph node metastases (14/28 N2), which were significantly higher than LS and SCRC (28.6%, 2/7 N1 and 39.3%, 145/369 N+) (P<0.001).
Table 1.
Clinicopathological characteristics of LLS, LS and SCRC subgroups
| Characteristics | LLS (n=28, 6.9%) | LS (n=7, 1.8%) | SCRC (n=369, 91.3%) | P¶ |
|---|---|---|---|---|
|
| ||||
| No. of cases (%) | No. of cases (%) | No. of cases (%) | ||
| Sex | 0.328 | |||
| Male | 15 (53.6) | 3 (42.9) | 234 (63.4) | |
| Female | 13 (46.4) | 4 (57.1) | 135 (36.6) | |
| Age at diagnosis, y | 0.002§ | |||
| <50 | 3 (10.7)a | 5 (71.4)b | 48 (13)a | |
| 50-60 | 11 (39.3)a | 1 (14.3)b | 93 (25.2)a | |
| ≥60 | 14 (50)a | 1 (14.3)b | 228 (61.8)a | |
| Mean (SD) | 60.7 (11.6) | 44.7 (11.1) | 62.3 (11.3) | 0.246∮ |
| Median (range) | 59 (52, 68.5) | 46 (36, 51) | 63 (24, 91) | 0.158￡ |
| Family history | 0.013§ | |||
| yes | 6 (21.4)a | 2 (28.6)a,b | 30 (8.1)b | |
| no | 22 (78.6)a | 5 (71.4)a,b | 339 (91.9)b | |
| Tumor location | <0.001§ | |||
| Rectum | 11 (39.3)a | 0 (0)a | 256 (69.4)b | |
| Left colon | 7 (25)a | 4 (57.1)a | 81 (22)b | |
| Right colon | 10 (35.7)a | 3 (42.9)a | 32 (8.6)b | |
| Tumor size | 0.322 | |||
| <5 cm | 18 (64.3) | 4 (57.1) | 274 (74.3) | |
| ≥5 cm | 10 (35.7) | 3 (42.9) | 95 (25.7) | |
| Tumor morphology | 0.163 | |||
| Protrude type | 13 (46.4) | 4 (57.1) | 104 (28.2) | |
| Ulcerative type | 14 (50) | 3 (42.9) | 240 (65) | |
| Infiltrative type | 1 (3.6) | 0 (0) | 25 (6.8) | |
| Histological differentiation | 0.452 | |||
| Low | 13 (46.4) | 3 (42.9) | 107 (29) | |
| Moderate | 15 (53.6) | 4 (57.1) | 252 (68.3) | |
| High | 0 (0) | 0 (0) | 6 (1.6) | |
| Missing | 0 (0) | 0 (0) | 4 (1.1) | |
| Histological type | 0.002§ | |||
| Adenocarcinoma | 18 (64.3)a | 3 (42.9)a,b | 314 (85.1)b | |
| Mucinous carcinoma/Signet ring cell carcinoma | 10 (35.7)a | 4 (57.1)a,b | 54 (14.6)b | |
| Neruoendocrine neoplasm | 0 (0)a | 0 (0)a,b | 1 (0.3)b | |
| Stage at diagnosis (TNM) | 0.585 | |||
| I+II | 14 (50) | 5 (71.4) | 206 (55.8) | |
| III+IV | 14 (50) | 2 (28.6) | 163 (44.2) | |
| Serosa infiltration | 0.513 | |||
| Present | 2 (7.1) | 0 (0) | 15 (4.1) | |
| Absent | 26 (92.9) | 7 (100) | 354 (95.9) | |
| Lymph nodes | <0.001§ | |||
| N0 | 14 (50)a | 5 (71.4)b | 224 (60.7)b | |
| N1 | 0 (0)a | 2 (28.6)b | 77 (20.9)b | |
| N2 | 14 (50)a | 0 (0)b | 68 (18.4)b | |
| Vascular tumor emboli | 0.282 | |||
| Present | 8 (28.6) | 0 (0) | 92 (24.9) | |
| Absent | 20 (71.4) | 7 (100) | 277 (75.1) | |
| Nerve invasion | 0.218 | |||
| Present | 3 (10.7) | 0 (0) | 72 (19.5) | |
| Absent | 25 (89.3) | 7 (100) | 297 (80.5) | |
| Tumor deposit (TD) | 0.312 | |||
| Present | 3 (10.7) | 0 (0) | 65 (17.6) | |
| Absent | 25 (89.3) | 7 (100) | 304 (82.4) | |
Comparison among groups is by Fisher’s exact test or Chi-square test.
Comparison between two groups respectively among variables with significantly different P-values is by Fisher’s exact test or Chi-Square Test and adjusted by Bonferroni test.
Statistically significant differences between two groups are identified if the superscript letters are a and b different, vice versa.
Comparison among groups is by Kruskal-Wallis test.
Comparison among groups is by Median test.
Abbreviations: LS, Lynch syndrome; LLS, Lynch-like syndrome; SCRC, sporadic colorectal cancer.
Figure 3.
The cumulative percentage of patients against their age of onset of CRC in patients with LLS, LS and SCRC.
Variants of unknown significance (VUS) of MMR genes in LLS tumors
A total of 15 VUS in MMR genes were seen in 10 LLS tumors. The most common MMR genes in which VUS were identified was MSH2 (n=5), followed by MSH6 (n=3), MLH1 (n=3), MLH3 (n=3), PMS2 (n=1). Specially, a fusion of PMS2 with USP42 on chromosome 7 (6160707) had been identified (USP42: exon3~PMS2: exon10) (Table 2).
Table 2.
Molecular characteristics and distribution of MMR genes mutations in tumors of LLS patients
| NO. | Sex | Age | Family history | Tumor location | Stage | Histological differentiation | Expression of MMR proteins by IHC | MSI status | BRAF V600E Mutation analysis | MLH1 Methylation (%) | MMR gene mutations | ACMG | AF |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | Male | 48 | No | Rectum | I | Adenocarcinoma | pMMR | MSI-H | WT | 1.9 | NR | NR | NR |
| 2 | Female | 53 | No | Rectum | I | Adenocarcinoma | PMS2 (-) | MSS | WT | 6.5 | NR | NR | NR |
| 3 | Male | 57 | No | Right colon | II | Adenocarcinoma | PMS2 (-) | MSI-H | WT | 0 | NR | NR | NR |
| 4 | Male | 72 | No | Rectum | III | Mucinous carcinoma | pMMR | MSI-H | WT | 0.3 | NR | NR | NR |
| 5 | Male | 52 | Yes | Rectum | III | Adenocarcinoma | PMS2 (-) | MSS | WT | 2.6 | NR | NR | NR |
| 6 | Female | 60 | No | Right colon | II | Adenocarcinoma | PMS2 (-) | MSI-H | WT | 0.3 | NR | NR | NR |
| 7 | Female | 64 | No | Rectum | I | Adenocarcinoma | PMS2 (-) | MSS | WT | 0.6 | NR | NR | NR |
| 8 | Male | 88 | No | Left colon | II | Adenocarcinoma | MLH1, MSH2 (-) | MSI-H | MT | 0 | NR | NR | NR |
| 9 | Female | 51 | No | Right colon | II | Mucinous carcinoma | MLH1, MSH6, PMS2 (-) | MSI-H | WT | 3.5 | MLH1: Intron11 (c.1039-1G>T) | VUS | 47.37% |
| MSH6: exon5 p.P1082S (c.3244C>T) | VUS | 47.99% | |||||||||||
| 10 | Male | 58 | Yes | Rectum | III | Adenocarcinoma | MLH1, PMS2 (-) | MSS | WT | 3.2 | NR | NR | NR |
| 11 | Female | 62 | No | Rectum | III | Adenocarcinoma | MLH1 (-) | MSS | WT | 1.3 | MSH2: exon1 p.P5Q (c.14C>A) | VUS | 46.67% |
| 12 | Male | 53 | Yes | Right colon | II | Mucinous carcinoma | MSH6 (-) | MSS | WT | 1 | MLH3: exon2 p.V207I (c.619G>A) | VUS | 1.00% |
| 13* | Male | 73 | No | Right colon | III | Mucinous carcinoma | MSH6 (-) | MSS | WT | 0.6 | MSH6: exon5 p.G1105E (c.3314G>A) | VUS | 46.63% |
| 14# | Female | 79 | No | Left colon | I | Adenocarcinoma | MLH1, MSH2 (-) | MSS | WT | 0.3 | MLH1: exon19 p.R725C (c.2173C>T) | VUS | 50.37% |
| MLH1: intron13 (c.1558+1G>A) | VUS | 1.36% | |||||||||||
| MSH2: exon13 p.R680X (c.2038C>T) | VUS | 1.97% | |||||||||||
| MSH6: exon4 p.V215I (c.643G>A) | Likely benign | 13.37% | |||||||||||
| 15 | Male | 69 | Yes | Left colon | I | Mucinous carcinoma | MSH6 (-) | MSI-H | WT | 1.9 | MLH3: exon2 p.F627L (c.1879T>C) | VUS | 52.17% |
| MSH2: exon3 p.V161F (c.481G>T) | VUS | 50.69% | |||||||||||
| 16 | Female | 67 | Yes | Right colon | I | Signet ring cell carcinoma | MSH2, MSH6 (-) | MSI-H | WT | 1.6 | MLH3: exon10 p.L1315F (c.3943C>T) | VUS | 48.89% |
| MSH6: exon5 p.P1082S (c.3244C>T) | VUS | 47.83% | |||||||||||
| 17 | Male | 60 | No | Right colon | II | Mucinous carcinoma | PMS2 (-) | MSI-H | WT | 0 | USP42: exon3~PMS2: exon10 | SV | 3.92% |
| 18 | Male | 80 | No | Rectum | I | Adenocarcinoma | pMMR | MSI-H | WT | 1 | NR | NR | NR |
| 19 | Female | 60 | No | Rectum | III | Mucinous carcinoma | Pmmr | MSI-H | WT | 1.3 | NR | NR | NR |
| 20 | Male | 67 | No | Rectum | III | Adenocarcinoma | PMS2 (-) | MSI-H | WT | 0.6 | NR | NR | NR |
| 21 | Female | 79 | No | Right colon | III | Adenocarcinoma | pMMR | MSI-H | WT | 0.3 | NR | NR | NR |
| 22 | Male | 46 | No | Right colon | III | Signet ring cell carcinoma | MLH1 (-) | MSS | WT | 3.2 | NR | NR | NR |
| 23 | Female | 54 | No | Left colon | III | Adenocarcinoma | PMS2 (-) | MSS | WT | 0 | MSH2: exon12 p.V655I (c.1963G>A) | VUS | 1.30% |
| 24 | Female | 50 | No | Right colon | III | Adenocarcinoma | MLH1, PMS2 (-) | MSS | WT | 0 | NR | NR | NR |
| 25 | Female | 52 | Yes | Left colon | III | Mucinous carcinoma | MLH1 (-) | MSI-H | WT | 0.6 | NR | NR | NR |
| 26 | Male | 43 | No | Left colon | III | Adenocarcinoma | MSH6 (-) | MSS | WT | 0.6 | PMS2: exon11 p.E667K (c.1999G>A) | VUS | 52.89% |
| 27 | Male | 52 | No | Rectum | III | Adenocarcinoma | PMS2 (-) | MSS | WT | 1.6 | NR | NR | NR |
| 28 | Female | 51 | Yes | Left colon | II | Adenocarcinoma | MLH1, PMS2 (-) | MSI-H | WT | 8.4 | MSH2: exon12 p.V655I (c.1963G>A) | VUS | 1.26% |
Abbreviations: IHC, immunohistochemistry; WT, wild type; MT, mutation type; AF, allele frequency; VUS, variants of unknown significance; SV, structural variation; NR, not reported.
The patient carried frameshift duplication of c.8432dupA in chr11:108216476 of ATM gene.
The patient carried frameshift deletion c.19_44delCCCGCCGCCGCCAGCAGCCTGGGCAA in chr1:27022913 of ARID1A gene.
Pathogenic mutations of non-MMR genes in LLS tumors
Nine (32.1%) of 28 LLS patients were found to have 13 pathogenic mutations in non-MMR genes (Figure 4). Two had mutations in TP53 (Hereditary cancer-predisposing syndrome), 6 in APC (familial adenomatous polyposis), 1 in ATM (DNA damage signaling regulator), 1 in ARID1A (chromatin remodeling), 1 in NSD1 (Sotos syndrome 1), 1 in PTEN (Hereditary cancer-predisposing syndrome) and 1 in TSC2 (Tuberous sclerosis syndrome). Frameshift duplication of c.8432dupA in ATM and frameshift deletion c.19_44delCCCGCCGCCGCCAGCAGCCTGGGCAA in ARID1A were 2 novel mutations, which are emerging as candidate responsible genes for LLS. The exonuclease domain indicating the location of ATM and ARID1A variants was showed in Figure 5. The clinicopathological characteristics of tumor in patient (No. 13 Table 2) with ATM mutation showed low differentiation, lymph nodes invasion and MSH6 protein deficiency, while that of patient (No. 14 Table 2) with ARID1A mutation was moderate differentiation, no lymph nodes metastasis and loss of MLH1/MSH2 proteins. Both tumors were carried with MSS and wild BRAF phenotype.
Figure 4.
Distribution of 13 pathogenic mutations in 7 non-MMR genes of LLS tumors. Interpretation of sequence variants was according to ACMG guidelines. Mutations in genes with class5 classification (ACMG) were considered as pathogenic variants.
Figure 5.
Location of variants in the ATM and ARID1A gene.
Discussion
To best of our knowledge, although with a relatively small sample size, this is the first study in a cohort of Chinese LLS patients with TP sequencing. In this study, we determine the frequency of LS, LLS and SCRCs among 404 CRCs in a tertiary-referral center of China during 2014-2018. Forty-two patients (10.4%, 42/404) were diagnosed with MMRd. Seven patients (7/42, 16.7%) were diagnosed with LS, which was also consistent with the previous studies in China, but lower than western countries [18,19]. Interestingly, we found 66.7% (28/42) CRC patients with MMRd were diagnosed with LLS, and this incidence was significantly higher than the literature reports. In some population-based studies of western countries, the prevalence of LLS ranged from 13% to 56% [20,21]. This demonstrates that the proportion of LLS in Chinese people may be rather higher than western countries.
So far, the preventive management of LLS patients and their relatives are uncertain. There hasn’t been any consensus about whether LLS should be considered as a likely hereditary disease or a sporadic condition. Besides, there were no hereditary clinical origin, molecular markers or germline mutations, which were able to differentiate LLS patients from other patients with MSI or loss of expression of MMR proteins. Buchanan pointed that LS had the highest risk of CRC; LLS patients together with their first-degree relatives were considered to have an intermediate risk of developing CRC compared with sporadic MMR deficient CRC [22]. In this study, we found that patients with family history in LLS, LS or SCRCs were consistent with previous studies (21.4%, 28.6% and 8.1%, P=0.013).
In a previous study, Mas-Moya found LLS patients only had a higher percentage of right-colon location than LS patients (93% versus 45%; P<0.002) [23]. However, we found that most patients with LLS had an almost equivalent distribution among rectum, left colon and right colon, compared to patients with LS in colon (100%) and SCRC in rectum (69.4%, P<0.001). According to Shia J, mucinous type appeared to be more frequent in HNPCC tumors other than LLS tumors, which is consistent with our study [24]. Surgical resection remains the most effective therapy for colorectal cancer. The presence of lymph node metastases in surgical resection specimens is inextricably linked to the prognosis of the disease [25,26]. Positive lymph nodes have been identified as a highly effective predictor of adverse outcomes. MSI tumors are distinct from MSS tumors, and have an immunologically active phenotype which could reduce positive rates of lymph nodes and distant metastases [26]. However, compared to the patients with LS and SCRCs, we found that patients with LLS had a higher rate of lymphatic metastasis (50%), which was much higher than the patients with LS (28.6%) and MSS (39.8%) in our dataset.
In our study, 65.4% mutations of MMR genes were VUS (17/26) (see Tables 2 and S2), which was more than that in literature with the prevalence ranged from 10% to 43.2% [27,28]. But the variant interpretation and classification benefit from quantitative and qualitative analyses. So, in the future, the final proportion of VUS still need to combine functional characterization and the actual level of evidence that the scientific community will deem as acceptable to classify a variant as causal.
Noteworthy, we identified 2 novel frameshift mutations in non-MMR genes in this cohort, including 1 frameshift duplication in ATM and 1 frameshift deletion in ARID1A. ATM, as a DNA damage sensor, could regulate the phosphorylation of ARP8 to maintain the fidelity of DNA repair and to prevent chromosome abnormalities. Besides, it may suppress tumor neoplasia [29]. According to Sriramulu S, complete loss of ATM expression could lead to the poor survival, but ATM gene mutation cannot change the age of onset in HNPCC patients [30]. Xiong H used quantitative real-time PCR to detect the expression of ATM in tumor tissues of CRC patients [31]. They found the level of ATM mRNA was higher expressed in tumor tissues than in normal mucosa tissues. So, it might consider the mutated ATM gene as the predicted biomarker in LLS patients. ARID1A, as a novel tumor suppressor gene, was related to transcription regulation and repression of select genes in the way of chromatin remodeling. The frequency of ARID1A mutation in CRC patients ranged from 8.9%-39% [32-35]. Some reports pointed out that ARID1A mutations and the deficiency of its protein expression were significantly involved in advanced tumor depth, poor differentiation, lymphatic metastasis, BRAF V600E mutation, MMR deficiency and MSI phenotype in tumors of CRC patients, which were similar in our research. However, there was no significance of overall survival in CRC patients with ARID1A mutation [33-35]. Specially, Chou A found ARID1A gene was mutated in all LS patients [33]. Niedermaier reported depletion of ARID1B increased radiosensitivity and may improve outcomes in ARID1A-mutat CRC patients [36]. So far, non-related studies had reported ATM and ARID1A mutations in LLS tumors. In the future, it will be critical to explore molecular mechanism of ATM and ARID1A mutation in LLS tumor transformation. Besides, high penetrance cancer predisposition gene mutations in this study, including TP53, APC, PTEN, implied alternative hereditary genes that would impact on genetic counselling and subsequent management.
This study had certain limitations. First, this study is composed of hospital-based patients other than population-based patients, which may introduce patient selection bias. Second, this is a single-center study with a relatively small sample size which can’t fully represent the Chinese population. Third and most important, we performed a clinical description of these cases with LLS but lack of molecular information about somatic mutations in the LLS cases, In the future, we expect well-designed, multi-center and population-based studies to find out the applicable and valid screening of LS and explore the real world of LLS in China.
Conclusions
In this study, 28 (66.6%) MMRd tumors were classified as LLS, which were significantly higher than reports of western countries. LLS tumors were more likely to carry lymph node metastases. Two novel mutations in ARID1A and ATM genes of LLS carriers were identified. However, it was hard to differentiated LLS tumors from LS through family history, tumor location, histological type of tumors, immunohistochemistry (IHC) for MMR proteins and MSI analysis.
Acknowledgements
This study was supported by Jiangsu Provincial Special Program of Medical Science (Grant No. BL2014100), National Natural Science Foundation of China (Grant No. 81473679) and Developing Program for High level Academic Talent in Jiangsu Hospital of TCM (Grant No. y2018rc16). The funders had no role in the study design, data collection and analysis, decision to publish or preparation of the manuscript.
Disclosure of conflict of interest
None.
Supporting Information
References
- 1.Vogelstein B, Papadopoulos N, Velculescu VE, Zhou SB, Diaz LA Jr, Kinzler KW. Cancer genome landscapes. Science. 2013;339:1546–1558. doi: 10.1126/science.1235122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gatalica Z, Vranic S, Xiu J, Swensen J, Reddy S. High microsatellite instability (MSI-H) colorectal carcinoma: a brief review of predictive biomarkers in the era of personalized medicine. Fam Cancer. 2016;15:405–412. doi: 10.1007/s10689-016-9884-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Le DT, Durham JN, Smith KN, Wang H, Bartlett BR, Aulakh LK, Lu S, Kemberling H, Wilt C, Luber BS, Wong F, Azad NS, Rucki AA, Laheru D, Donehower R, Zaheer A, Fisher GA, Crocenzi TS, Lee JJ, Greten TF, Duffy AG, Ciombor KK, Eyring AD, Lam BH, Joe A, Kang SP, Holdhoff M, Danilova L, Cope L, Meyer C, Zhou S, Goldberg RM, Armstrong DK, Bever KM, Fader AN, Taube J, Housseau F, Spetzler D, Xiao N, Pardoll DM, Papadopoulos N, Kinzler KW, Eshleman JR, Vogelstein B, Anders RA, Diaz LA Jr. Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade. Science. 2017;357:409–413. doi: 10.1126/science.aan6733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Järvinen HJ, Aarnio M, Mustonen H, Aktan-Collan K, Aaltonen LA, Peltomäki P, De La Chapelle A, Mecklin JP. Controlled 15-year trial on screening for colorectal cancer in families with hereditary nonpolyposis colorectal cancer. Gastroenterology. 2000;118:829–834. doi: 10.1016/s0016-5085(00)70168-5. [DOI] [PubMed] [Google Scholar]
- 5.Hampel H, Frankel W, Martin E, Arnold M, Khanduja K, Kuebler P, Nakagawa H, Sotamaa K, Prior TW, Westman J, Panescu J, Fix D, Lockman J, Comeras I, de la Chapelle A. Screening for the Lynch syndrome (hereditary nonpolyposis colorectal cancer) N Engl J Med. 2005;352:1851–1860. doi: 10.1056/NEJMoa043146. [DOI] [PubMed] [Google Scholar]
- 6.Vasen HF. The Lynch syndrome (hereditary nonpolyposis colorectal cancer) Aliment Pharmacol Ther. 2007;26:113–126. doi: 10.1111/j.1365-2036.2007.03479.x. [DOI] [PubMed] [Google Scholar]
- 7.Ryan E, Sheahan K, Creavin B, Mohan HM, Winter DC. The current value of determining the mismatch repair status of colorectal cancer: a rationale for routine testing. Crit Rev Oncol Hemat. 2017;116:38–57. doi: 10.1016/j.critrevonc.2017.05.006. [DOI] [PubMed] [Google Scholar]
- 8.Liu F, Yang L, Zhou X, Sheng W, Cai S, Liu L, Nan P, Xu Y. Clinicopathological and genetic features of Chinese hereditary nonpolyposis colorectal cancer (HNPCC) Med Oncol. 2014;31:223–229. doi: 10.1007/s12032-014-0223-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Geurts-Giele WR, Leenen CH, Dubbink HJ, Meijssen IC, Post E, Sleddens HF, Kuipers EJ, Goverde A, van den Ouweland AM, van Lier MG, Steyerberg EW, van Leerdam ME, Wagner A, Dinjens WN. Somatic aberrations of mismatch repair genes as a cause of microsatellite-unstable cancers. J Pathol. 2014;234:548–559. doi: 10.1002/path.4419. [DOI] [PubMed] [Google Scholar]
- 10.Pérez-Carbonell L, Ruiz-Ponte C, Guarinos C, Alenda C, Payá A, Brea A, Egoavil CM, Castillejo A, Barberá VM, Bessa X, Xicola RM, Rodríguez-Soler M, Sánchez-Fortún C, Acame N, Castellví-Bel S, Piñol V, Balaguer F, Bujanda L, De-Castro ML, Llor X, Andreu M, Carracedo A, Soto JL, Castells A, Jover R. Comparison between universal molecular screening for Lynch syndrome and revised Bethesda guidelines in a large population-based cohort of patients with colorectal cancer. Gut. 2012;61:865–872. doi: 10.1136/gutjnl-2011-300041. [DOI] [PubMed] [Google Scholar]
- 11.Antelo M, Golubicki M, Roca E, Mendez G, Carballido M, Iseas S, Cuatrecasas M, Moreira L, Sanchez A, Carballal S, Castells A, Boland CR, Goel A, Balaguer F. Lynch-like syndrome is as frequent as Lynch syndrome in early-onset nonfamilial nonpolyposis colorectal cancer. Int J Cancer. 2019;145:705–713. doi: 10.1002/ijc.32160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Compton CC, Byrd DR, Garcia-Aguilar J, Kurtzman SH, Olawaiye A, Washington MK. In: Compton CC, Byrd DR, Garcia-Aguilar J, Kurtzman SH, Olawaiye A, Washington MK, editors. AJCC cancer staging atlas. 2nd edition. New York: Springer; 2012. p. 627. [Google Scholar]
- 13.Cushman-Vokoun AM, Stover DG, Zhao Z, Koehler EA, Berlin JD, Vnencak-Jones CL. Clinical utility of KRAS and BRAF mutations in a cohort of patients with colorectal neoplasms submitted for microsatellite instability testing. Clin Colorectal Canc. 2013;12:168–178. doi: 10.1016/j.clcc.2013.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high502 throughput sequencing data. Nucleic Acids Res. 2010;38:e164. doi: 10.1093/nar/gkq603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL ACMG Laboratory Quality Assurance Committee. Standards and Guidelines for the Interpretation of Sequence Variants: a Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17:405–424. doi: 10.1038/gim.2015.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Adar T, Rodgers LH, Shannon KM, Yoshida M, Ma T, Mattia A, Lauwers GY, Iafrate AJ, Chung DC. A tailored approach to BRAF and MLH1methylation testing in a universal screening program for Lynch syndrome. Modern Pathol. 2017;30:440–447. doi: 10.1038/modpathol.2016.211. [DOI] [PubMed] [Google Scholar]
- 18.Chang SC, Lin PC, Yang SH, Wang HS, Liang WY, Lin JK. Taiwan hospital-based detection of Lynch syndrome distinguishes 2 types of microsatellite instabilities in colorectal cancers. Surgery. 2010;147:720–728. doi: 10.1016/j.surg.2009.10.069. [DOI] [PubMed] [Google Scholar]
- 19.Ricker CN, Hanna DL, Peng C, Nguyen NT, Stern MC, Schmit SL, Idos GE, Patel R, Tsai S, Ramirez V, Lin S, Shamasunadara V, Barzi A, Lenz HJ, Figueiredo JC. DNA mismatch repair deficiency and hereditary syndromes in Latino patients with colorectal cancer. Cancer. 2017;123:3732–3743. doi: 10.1002/cncr.30790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Porkka N, Lahtinen L, Ahtiainen M, Böhm JP, Kuopio T, Eldfors S, Mecklin JP, Seppälä TT, Peltomäki P. Epidemiological, clinical and molecular characterization of Lynch-like syndrome: a population-based study. Int J Cancer. 2019;145:87–98. doi: 10.1002/ijc.32085. [DOI] [PubMed] [Google Scholar]
- 21.Win AK, Buchanan DD, Rosty C, MacInnis RJ, Dowty JG, Dite GS, Giles GG, Southey MC, Young JP, Clendenning M, Walsh MD, Walters RJ, Boussioutas A, Smyrk TC, Thibodeau SN, Baron JA, Potter JD, Newcomb PA, Le Marchand L, Haile RW, Gallinger S, Lindor NM, Hopper JL, Ahnen DJ, Jenkins MA. Role of tumour molecular and pathology features to estimate colorectal cancer risk for first-degree relatives. Gut. 2015;64:101–110. doi: 10.1136/gutjnl-2013-306567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Buchanan DD, Rosty C, Clendenning M, Spurdle AB, Win AK. Clinical problems of colorectal cancer and endometrial cancer cases with unknown cause of tumor mismatch repair deficiency (suspected Lynch syndrome) Appl Clin Genet. 2014;7:183–193. doi: 10.2147/TACG.S48625. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Mas-Moya J, Dudley B, Brand RE, Thull D, Bahary N, Nikiforova MN, Pai RK. Clinicopathological comparison of colorectal and endometrial carcinomas in patients with Lynch-like syndrome versus patients with Lynch syndrome. Hum Pathol. 2015;46:1616–1625. doi: 10.1016/j.humpath.2015.06.022. [DOI] [PubMed] [Google Scholar]
- 24.Shia J, Ellis NA, Paty PB, Nash GM, Qin J, Offit K, Zhang XM, Markowitz AJ, Nafa K, Guillem JG, Wong WD, Gerald WL, Klimstra DS. Value of histopathology in predicting microsatellite instability in hereditary nonpolyposis colorectal cancer and sporadic colorectal cancer. Am J Surg Pathol. 2003;27:1407–1417. doi: 10.1097/00000478-200311000-00002. [DOI] [PubMed] [Google Scholar]
- 25.Horne J, Bateman AC, Carr NJ. Lymph node revealing solutions in colorectal cancer: should they be used routinely? J Clin Pathol. 2014;67:383–388. doi: 10.1136/jclinpath-2013-202146. [DOI] [PubMed] [Google Scholar]
- 26.Malesci A, Laghi L, Bianchi P, Delconte G, Randolph A, Torri V, Carnaghi C, Doci R, Rosati R, Montorsi M, Roncalli M, Gennari L, Santoro A. Reduced likelihood of metastases in patients with microsatellite-unstable colorectal cancer. Clin Cancer Res. 2007;13:3831–3839. doi: 10.1158/1078-0432.CCR-07-0366. [DOI] [PubMed] [Google Scholar]
- 27.Chubb D, Broderick P, Frampton M, Kinnersley B, Sherborne A, Penegar S, Lloyd A, Ma YP, Dobbins SE, Houlston RS. Genetic diagnosis of high-penetrance susceptibility for colorectal cancer (CRC) is achievable for a high proportion of familial CRC by exome sequencing. J. Clin. Oncol. 2015;33:426–432. doi: 10.1200/JCO.2014.56.5689. [DOI] [PubMed] [Google Scholar]
- 28.Ricker C, Culver JO, Lowstuter K, Sturgeon D, Sturgeon JD, Chanock CR, Gauderman WJ, McDonnell KJ, Idos GE, Gruber SB. Increased yield of actionable mutations using multi-gene panels to assess hereditary cancer susceptibility in an ethnically diverse clinical cohort. Cancer Genet. 2016;209:130–137. doi: 10.1016/j.cancergen.2015.12.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Sun J, Shi L, Kinomura A, Fukuto A, Horikoshi Y, Oma Y, Harata M, Ikura M, Ikura T, Kanaar R, Tashiro S. Distinct roles of ATM and ATR in the regulation of ARP8 phosphorylation to prevent chromosome translocations. Elife. 2018;7:e32222. doi: 10.7554/eLife.32222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Sriramulu S, Ramachandran M, Subramanian S, Kannan R, Gopinath M, Sollano J, Bissi L, Banerjee A, Marotta F, Pathak S. A review on role of ATM gene in hereditary transfer of colorectal cancer. Acta Biomed. 2019;89:463–469. doi: 10.23750/abm.v89i4.6095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Xiong H, Zhang J. Expression and clinical significance of ATM and PUMA gene in patients with colorectal cancer. Oncol Lett. 2017;14:7825–7828. doi: 10.3892/ol.2017.7181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Cajuso T, Hänninen UA, Kondelin J, Gylfe AE, Tanskanen T, Katainen R, Pitkänen E, Ristolainen H, Kaasinen E, Taipale M, Taipale J, Böhm J, Renkonen-Sinisalo L, Mecklin JP, Järvinen H, Tuupanen S, Kilpivaara O, Vahteristo P. Exome sequencing reveals frequent inactivating mutations in ARID1A, ARID1B, ARID2 and ARID4A in microsatellite unstable colorectal cancer. Int J Cancer. 2014;135:611–623. doi: 10.1002/ijc.28705. [DOI] [PubMed] [Google Scholar]
- 33.Chou A, Toon CW, Clarkson A, Sioson L, Houang M, Watson N, DeSilva K, Gill AJ. Loss of ARID1A expression in colorectal carcinoma is strongly associated with mismatch repair deficiency. Hum Pathol. 2014;45:1697–1703. doi: 10.1016/j.humpath.2014.04.009. [DOI] [PubMed] [Google Scholar]
- 34.Kim YS, Jeong H, Choi JW, Oh HE, Lee JH. Unique characteristics of ARID1A mutation and protein level in gastric and colorectal cancer: A meta-analysis. Saudi J Gastroentero. 2017;23:268–274. doi: 10.4103/sjg.SJG_184_17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Lee LH, Sadot E, Ivelja S, Vakiani E, Hechtman JF, Sevinsky CJ, Klimstra DS, Ginty F, Shia J. ARID1A expression in early stage colorectal adenocarcinoma: an exploration of its prognostic significance. Hum Pathol. 2016;53:97–104. doi: 10.1016/j.humpath.2016.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Niedermaier B, Sak A, Zernickel E, Xu S, Groneberg M, Stuschke M. Targeting ARID1A-mutant colorectal cancer: depletion of ARID1B increases radiosensitivity and modulates DNA damage response. Sci Rep. 2019;9:1820. doi: 10.1038/s41598-019-54757-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.