Skip to main content
Biomicrofluidics logoLink to Biomicrofluidics
. 2020 Dec 8;14(6):061504. doi: 10.1063/5.0031406

Microfluidic-based approaches for COVID-19 diagnosis

Hsuan-Yu Mu 1, Yu-Lun Lu 1, Tzu-Hung Hsiao 2,3,4, Jen-Huang Huang 1,a)
PMCID: PMC7725537  PMID: 33343780

Abstract

Novel coronavirus, COVID-19, erupted in Wuhan, China, in 2019 and has now spread to almost all countries in the world. Until the end of November 2020, there were over 50 × 106 people diagnosed with COVID-19 worldwide and it caused at least 1 × 106 deaths. These numbers are still increasing. To control the spread of the pandemic and to choose a suitable treatment plan, a fast, accurate, effective, and ready-to-use diagnostic method has become an important prerequisite. In this Review, we introduce the principles of multiple off-site and on-site detection methods for virus diagnosis, including qPCR-based, ELISA-based, CRISPR-based methods, etc. All of these methods have been successfully implanted on the microfluidic platform for rapid screening. We also summarize currently available diagnostic methods for the detection of SARS, MERS, and COVID-19. Some of them not only can be used to analyze the SARS and MERS but also have the potential for COVID-19 detection after modifications. Finally, we hope that understanding of current microfluidic-based detection approaches can help physicians and researchers to develop advanced, rapid, and appropriate clinical detection techniques that reduce the financial expenditure of the society, accelerate the examination process, increase the accuracy of diagnosis, and eventually suppress the worldwide pandemic.

I. INTRODUCTION

In December 2019, coronavirus disease 2019 (COVID-19) was found in the Wuhan City, Hubei Province, China,1,2 and quickly spread to various provinces in China. This outbreak, in turn, affected over 200 countries/regions, more than 50 × 106 people have been diagnosed, and at least 1 × 106 people have passed away due to COVID-19 infection as of November 2020. COVID-19 infection usually leads to several respiratory symptoms, including fever (88.7%), cough (67.8%), fatigue (38.1%), sputum production (33.4%), shortness of breath (18.6%), sore throat (13.9%), and headache (13.6%), and even the death rate was around 3.4%.3–7 Meanwhile, many people have asymptomatic infections,8,9 making it difficult to stop the widespread of the virus.10 Besides, as the number of infected people soars, those who need to detect whether they are infected with viruses also increase. At present, the global outbreak is not well controlled and the vaccine for this infection is still under development.11,12 Vaccine and diagnostic technology are equally important because, under the goal of controlling the pandemic, a fast and accurate diagnostic platform can make patients aware of the disease early. Therefore, developing a novel, fast, and accurate detection method becomes an emerging and priority task.13

The principles of the detection methods usually can be divided into two major groups normally relying on the analysis targets: antibody and nucleic acid. The acquisition of antibodies usually requires the drawing of blood from the patient's arm followed by purifying the serum to accurately detect the presence of antibodies, while the nucleic acid can be collected not only from the blood drawn but also from the saliva by using the throat swab. There are already several existing diagnosis approaches to detect COVID-19.14–16 For example, reverse transcription polymerase chain reaction (RT-PCR) testing is adopted uniformly across the world, and it is conducted by contract laboratories through throat swab collection.17 This test is the direct detection of viruses with the highest accuracy.14 However, the detection time still requires at least 2–4 h.18 Once the epidemic expands and the number of inspectors grows rapidly, the laboratory may not have sufficient capacity to identify positive results, leading to the delay of treatment. In this case, a quick screening test is necessary to speed up screening.

Lab-on-a-chip, also called a microfluidic chip, is an ideal tool for simplifying complex laboratory processes on a tiny device.19,20 It involves the integration of sample processing and analysis on a chip such as transportation, separation, concentration, detection, heating, coloring, etc.21–24 Moreover, the microfluidic chip can serve as a fast, accurate, and automated operating platform for the detection of viral nucleic acids, the number of antibodies in the serum, and the presence or absence of antibodies after reasonable and appropriate design.25–27 Therefore, the use of the chips can achieve the goals that traditional biomedical testing cannot fulfill. It can also resolve the issue of long processing time for PCR detection.18,28

Herein, we review multiple approaches for the diagnosis of COVID-19 on-site and off-site depending on the use of instrument and sample preparation (Fig. 1). These methods include quantitative PCR (qPCR)-based method, ELISA (enzyme-linked immunosorbent assay)-based method, as well as novel CRISPR-based method, etc.14,29–33 Some well-established approaches have been integrated into the microfluidic chip, and some novel techniques have the potential to be combined with microfluidics to develop an emerging diagnosis methodology. We later discuss the principles of each diagnosis approach and compare the specificity and sensitivity for the detection of virus samples. At the end of the article, we also look forward to future research directions and possible challenges to develop a more rapid, accurate, and affordable diagnosis chip.

FIG. 1.

FIG. 1.

The current main clinical inspection methods for the diagnosis of the COVID-19. Both antibody-based and nucleic acid-based methods require sample preparation and detection procedure with or without additional equipment to perform on-site or laboratory testing. The antibody-based method can verify whether the person who has exposed to the COVID-19 and developed the immunity from blood specimen. The nucleic acid-based approach can quantify the amount of virus staying in the human body from the specimen collected using a swab.

II. BIOLOGICAL PROPERTIES OF COVID-19

COVID-19 viruses are positive-stranded non-segmented single-stranded RNA viruses with 29.9 kb genome length.34 The gene sequence shows that COVID-19 belongs to Betacoronavirus lineage β. It is similar to the coronavirus found in Chinese chrysanthemums, such as MERS or SARS, but exists in a different clade.7,35 The structure of COVID-19 contains four main surface proteins, including spike protein (S), membrane protein (M), envelope protein (E), and nuclear sheath protein (or nucleocapsid, N).36,37 The structure of COVID-19 is illustrated in Fig. 2. There is a single-stranded RNA genetic material in the mantle.38 This piece of genetic material is the same as the previously discovered coronaviruses, including SARS and MERS. It mainly contains two major parts: genetic material expressing structural proteins and genes required for virus replication. The first part can produce the virus structure such as shell as mentioned previously, while the genetic material related to virus replication includes nonstructural proteins (nsp1 to nsp16).39,40 The nonstructural proteins are highly related to virus replication. For example, nsp12 is also known as RNA-dependent RNA polymerase and is predicted to directly participate in virus replication.41 Another example, nsp5, also known as 3C-like proteinase, can complete the cleavage of nsp4–16.42 The other feature of the coronavirus family is known as the crown-shaped spiny protrusions that have spike protein on their membrane.43 The spike protein plays an important role in pathogenic.44 Take COVID-19 as an example, COVID-19 spike protein S1 domain recognizes ACE2 (angiotensin converting enzyme 2) on human cells.45,46 When the virus particles are close to the host cell, the COVID-19 will recognize and engage the ACE2 or other possible receptors on host cells. Both ACE2 and ACE are important members of the renin–angiotensin system. The biological function of ACE is to catalyze angiotensin I into angiotensin II to promote blood vessel contraction and increases blood pressure.47 On the other hand, the biological function of ACE2 is to catalyze the conversion of angiotensin 2 to angiotensin-(1–7), which can cause low blood pressure. In other words, when human is infected by the COVID-19, ACE2 will accumulate and cause illness.48

FIG. 2.

FIG. 2.

The schematic of the COVID-19 structure. The COVID-19 virus is one type of coronavirus that contains a positive-strand single-stranded RNA and a variety of different surface proteins, including spike protein, membrane protein, and envelope protein. These features are often used to diagnose the presence of the virus.

Compared with SARS and MERS, the same family of coronaviruses, COVID-19 can spread on a large scale within a short period. The main reasons are (1) the reproduction number (R0) of COVID-19 is higher than that of SARS and MERS.49–51 For COVID-19, it is predicted to be 3.28–5.7, while SARS is 2 and MERS is less than 1.52 This also means that, on average, every COVID-19 patient infects approximately 3.28–5.7 healthy humans. (2) There are many asymptomatic infections of COVID-19, which will make it difficult to control the infection.53,54 Even the patients would not know that they have been infected with COVID-19 and spread it to other people without being alert. Therefore, the development of an advanced, rapid, and accurate inspection technology is currently an emerging issue for infection control.

III. SAMPLE PREPARATION

Before the clinical diagnosis of infectious diseases, sample preparation including sample collection is the most challenging task especially in the field or resource-limited situation.55 Improper preparation of samples can lead to a false-negative result, which may misinterpret the decision of treatment.56 At present, there are several approaches to collect specimens commonly used in clinical diagnosis and testing of COVID-19. Nasopharyngeal swab or throat swab of sputum is for upper respiratory tract specimen collection. Bronchoalveolar lavage is for the extraction of lower respiratory tract fluid. The fecal specimen can be collected using a swab, while the blood specimen is obtained using a blood draw.57,58 Among them, the blood specimen mainly is analyzed using ELISA analysis to detect the presence of virus antibodies in the blood, while the other types are used for nucleic acid detection to determine the nucleic acid molecules from a specific virus in the sample.59–61 Generally, it is necessary to pre-treat the collected patient samples before testing. For instance, the viral RNA has to be extracted first from the collected samples while the ribonuclease (e.g., RNase) should be avoided to prevent biased results. The method common in use and recommended by the CDC to extract viral RNA from COVID-19 patient's specimen is the use of the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany).18 Other similar products can also extract viral RNA, such as Mag-Bind® Viral RNA Xpress Kit, etc. However, these sample preparation methods may not be completely suitable for on-site testing because they require centrifugation and filtration procedures. To meet the needs of on-site testing, Wang et al. reported a technique that used magnetic force to separate RNA from viruses [Fig. 3(a)].62 They first prepared the customized magnetic nanoparticles (e.g., Fe3O4) in the laboratory. These nanoparticles are monodisperse magnetic beads with better uniform size and shape compared to the commercialized ones. After the arrival of samples at the test site, the users can add these nanoparticles to the samples to break the virus membrane, so that the RNA strains can attach to the nanoparticles due to the electrical charges. Meanwhile, a magnetic field is applied to collect the nanoparticles so that the viral RNA can be extracted on-site without any extra equipment for sample preparation. In addition, Vulto et al. reported a microfluidic chip for extracting the low-molecular-weight viral RNA [Fig. 3(b)].63 In principle, the specimen is first subjected to thermo-electric lysis. After completion, the viral RNA can be separated by colloidal electrophoresis due to different amounts of carried charges.64,65 Removing other substances that are not charged, the chip can differentiate the different RNA sequences based on their molecular weights at different times.66 This design can separate RNA in advance, targeting a specific range of RNA in the clinical practice. At the same time, the chip has been fully automated, leading this technology to become a potential and easy-to-use method for the extraction of COVID-19 virus RNA.

FIG. 3.

FIG. 3.

The technologies that have the potential to extract RNA from specimens on-site without using the complicated sample preparation procedure or equipment. (a) Magnetic suction of specimen RNA technology. Reproduced with permission from Wang et al., Lab Chip 18, 3507–3515 (2018). Copyright 2018 Royal Society of Chemistry. (b) RNA electrophoresis on a chip technology. Reproduced with permission from Vulto et al., Lab Chip 10, 610–616 (2010). Copyright 2010 Royal Society of Chemistry.

For the preparation of blood samples, the standard protocol is to centrifuge the whole blood and collect the plasma for ELISA analysis. However, this technology is not suitable for on-site testing. Thus, an alternative method was developed by Laksanasopin et al. for HIV testing in a remote area (e.g., Rwanda), where centrifugation is not easily accessible.67 They used the whole blood mixed with a specific buffer to dilute the sample and perform the test directly. Although this technology is not used to detect COVID-19, it may be applicable after modification. Other than the dilution of samples, filtration technology can also be utilized to isolate the target. For example, CytoSep® membrane and VividTM plasma separation membrane (Pall Medical) have been proven to effectively separate blood cells and plasma. This technology is also suitable for on-site blood testing, especially where only serum testing is required.68,69

IV. OFF-SITE DIAGNOSTIC TOOLS FOR VIRUS DETECTION

The gold standard method currently used for the COVID-19 diagnosis includes the detection of viral nucleic acid in the specimen using qPCR and identification of immunoglobulin G (IgG) or immunoglobulin M (IgM) in the serum using ELISA analysis depending on the stage of infection. In this section, we also introduce a variety of off-site diagnostic technologies that have been or have potential for COVID-19 detection. These off-site detection methods are carried out in the laboratory. The types of target viruses, specificity, detection limits, and equipment required for these methods are listed in Table I.

TABLE I.

Off-site virus detection approaches. PPV, positive predictive values; NPV, negative predictive values.

Methods Target virus True–false ratio Detection limit Time spend Instrument used Reference
Real-time PCR COVID-19 Sensitivity: 100% <100 copies/μl <1 h Thermal cycler 61
Antibody-based method COVID-19 PPV of IgG: 95%
NPV of IgG: 80%
PPV of IgM: 100%
NPV of IgM: 84%
5 IU/ml (commercial kit) 80–120 min No need or microplate reader only 60
On chip aptamer-based detection SARS Good 0.1–2 pg/ml < 1 h No need or microplate reader only 84
On chip antibody mimics-based SARS High 0.6 nM 10 min Current signal detector 87
Gold nanoparticle enhanced immuno-PCR Hantaan virus N/A 10 fg/ml 3 h Thermal cycler and microplate reader 92
Single chip for multiple viral nucleic acid tests Respiratory virus PPV: 100%
Specificity:100%
2–4 fg/μl 1 h Constant temperature heating tank 62

A. Real-time PCR based method

For an accurate diagnosis of infection, detection of nucleic acid is the most widely accepted method because of its high specificity. Real-time PCR or qPCR is the most general method for detecting the total amount of products after each cycle of PCR in a DNA amplification reaction using primers grafted with fluorescent dyes such as SYBR green.14,70 SYBR green is a fluorescent dye that can specifically bind to double-stranded nucleic acids. It can emit fluorescent signals after combining with double-stranded nucleic acids.71 After the amplification, the cycle threshold (Ct) value can be determined, that is, after how many PCR amplification cycles to realize the amount of original RNA based on the emitted fluorescence. During the COVID-19 pandemic, the RNA-dependent RNA polymerase (RdRp) gene is normally amplified and quantified from the sample collection of sputum, feces, throat swabs, serum, plasma, etc.17,72 When the threshold value is less than 35 in throat swabs detection, the patient will be considered as positive.73 The qPCR technique includes three steps of temperature controls: (1) denaturation—this step will increase the temperature to 95 °C. In this case, the secondary structure of the nucleic acid will be completely disintegrated to completely remove the wrong structure or primer and non-specific combination of non-target nucleic acid and primers; (2) annealing—This step is to lower the temperature to 50–65 °C which is below the primer melting temperature (Tm) so that the primers can bind to the target nucleic acid; (3) elongation—the last step is to heat the sample to 72 °C to allow DNA polymerase to be activated so that the amplification cycle can be continued and fulfilled.

In order to detect COVID-19 with high specificity and accuracy, the selected nucleic acid must be presented only from COVID-19 rather than from other similar viruses such as SARS or MERS. Table II demonstrates the sequences of nucleic acid primers and probes used in different countries and their target to identify COVID-19 using the qPCR. Although qPCR is the most widely used detection method nowadays to provide universally accurate diagnosis results, it is still challenging to rule out the existence of false-positive or false-negative results. The gene amplification requires more time and is not able to accomplish without sufficient laboratory resources including reagents and equipment.74

TABLE II.

Sequences of primers and probes used in different countries to detect COVID-19.

Country Target Forward primer Reverse primer Probe Reference
Germany RdRp GTGARATGGTCATGTGTGGCGG CARATGTTAAASACACTATTAGCATA CAGGTGGAACCTCATCAGGAGATGC 106
China ORF1ab CCCTGTGGGTTTTACACTTAA ACGATTGTGCATCAGCTGA CCGTCTGCGGTATGTGGAAAGGTTATGG 107
Nucleocapsid gene GGGGAACTTCTCCTGCTAGAAT CAGACATTTTGCTCTCAAGCTG TTGCTGCTGCTTGACAGATT
USA Nucleocapsid gene GACCCCAAAATCAGCGAAAT TCTGGTTACTGCCAGTTGAATCTG ACCCCGCATTACGTTTGGTGGACC 108
Nucleocapsid gene TTACAAACATTGGCCGCAAA GCGCGACATTCCGAAGAA ACAATTTGCCCCCAGCGCTTCAG
Nucleocapsid gene GGGAGCCTTGAATACACCAAAA TGTAGCACGATTGCAGCATTG AYCACATTGGCACCCGCAATCCTG

B. Multi-gene diagnosis DNA microarray

In addition to rapid detection, an accurate diagnosis is also critical to avoid false positives for suppressing the spread of disease. Zhou et al. used a DNA microarray (or DNA chip) to detect multiple SARS-specific genes after PCR at the same time.75 DNA microarray is a piece of glass or silicon wafer.76 Thousands of oligonucleotides probes are conjugated on the chip within a region of few square centimeters. These probes are complementary to a specific DNA fragment. Once the target nucleic acids are fluorescently labeled via PCR or RT-PCR, they can hybridize with the probes simultaneously and fluorescent signals are detected after the washing step. The advantage of this technology is joint inspections. On the same chip, multiple specific probes that target different viruses are conjugated, such as H1N1, SARS-CoV-2, and other viruses that cause upper respiratory tract infections. Other virus-specific and feature genes, including ORF1a, N protein gene, can be diagnosed in a single test to reduce false positives.77,78 Although this powerful technique can confirm the type of virus that the patient has been infected, the total expense for a single analysis is still not competitive.

C. Microfluidic chip for in situ PCR

As the number of people infected with COVID-19 rises, a rapid diagnosis method is required to distinguish COVID-19 from other infectious diseases. Based on the demand for accurate detection, PCR is one of the best choices among many options because of its high accuracy and high specificity, allowing this technology to distinguish true-false outcomes. Due to the high specificity of the primer and the target gene, it is usually effective to test whether the patient is infected with the virus. Moreover, false positives or false negatives may also occur at low viral loads, leading to several limitations of the PCR. For example, (1) the efficiency is low. It takes several hours to complete the whole reaction; (2) it requires a temperature controller with a cycling function. These two problems have been solved since a novel technology loop-mediated isothermal amplification (LAMP) was developed; (3) traditional PCR requires operators to complete the time-consuming reaction, and it is hard to screen multiple samples at the same time.18 To solve this problem, Cao et al. developed a microfluidic-based PCR chip, allowing the specimen (nasopharyngeal sample swab) to flow through a microchannel with serpentine and oscillating designs (Fig. 4).21 Each channel can be regarded as a PCR amplification cycle. In principle, from top to bottom, each part has a different specific temperature. The top channel keeps a high temperature (95 °C) for denaturation, the middle channel has a low temperature (55 °C) for annealing, and the bottom channel has a medium temperature (72 °C) for elongation. After the fluid flows through these channels, it can have the same thermal cycle as traditional PCR. Eventually, when the sample passes through the whole chip, the DNA amplification has been completed. This continuous-flow PCR may also be applied to the amplification of other viruses only when the amplification primers are replaced, including COVID-19.

FIG. 4.

FIG. 4.

Simplification of the complex laboratory PCR technology on a microfluidic chip. (a) The experimental setup of microfluidic-based PCR reaction. (b) The design of a microfluidic PCR chip. The serpentine and oscillating microchannel allows the sample to be repeatedly heated at 95 °C for denaturation, cooled down at 55 °C for annealing, and heated again at 72 °C for elongation. (c) The procedure of microfluidic-based PCR reaction from sampling, reaction to data analysis. Reproduced with permission from Cao et al., PLoS One 7, e33176 (2012). Copyright 2012 Public Library of Science.

D. Antibody-based diagnosis chip

Antibody testing is another type of diagnosis strategy for verifying viruses.60 After a period of infection, the body secretes antibodies to fight off pathogens.79 Under normal circumstances when the patient passes the acute infection period, the antibodies appear in the blood, allowing the antibody concentration to be quantified to determine whether the patient is infected with the virus.27,60,80 An antibody method for clinical diagnosis usually refers to the ELISA assay to detect antibodies in the samples. The principle is to utilize the specific binding characteristics between antibodies and antigens, cooperate with the color reagent reaction, and use the color intensity to quantify the content of specific target proteins of the sample. Among the various ELISA methods, the sandwich technique to enhance the specificity of detection is the most widely used.81,82 The target IgG or IgM is able to specifically bind to the characteristic protein of COVID-19 (e.g., N protein, S protein) immobilized on the solid plate. After about 30 min of incubation at 37 °C, the secondary antibody is added to specifically recognize human immunoglobulin so that the subsequent reaction can be amplified leading to color (or fluoresce) signals.27

However, the antibody method can only be used as an auxiliary test because the antibody concentration is too few to be detected in the blood during the acute infection period or the early infection. The research studied by Xiang et al. pointed out that the sensitivity of IgM from the patients with confirmed COVID-19 was 77.3% (51/66, positive case/total case), while the sensitivity of IgG was 83.3% (55/66). It means that not every confirmed patient can be detected by using the antibody method, suggesting that this technology can only provide special conditions or auxiliary diagnosis and is not suitable for the first-line diagnosis. For negative predictive values, the IgG test was 94.8% and the IgM test was 100%. These data indicate that the ELISA method may underestimate the patients who had infections.60

Although these techniques are not able to regard as the major diagnostic technique, it still worked surprisingly effective under certain circumstances. Take the case that happened in Taiwan as an example, a taxi driver died of COVID-19 in February 2020. In the beginning, the Taiwan Centers for Disease Control (CDC) did not locate the source of the infection and considered that the driver may be infected by an asymptomatic patient during car driving. Thus, Taiwan CDC used the antibody method to diagnose antibodies in the serum and found that the source of infection came from a Taiwanese businessman who returned from Zhejiang, China.17 Another case is a Belgian man who tested positive for COVID-19 in Taiwan on August 1. The patient underwent standard qPCR screening at his own expense. The initial Ct value was between 34 and 35, and the second Ct was lower than 34. Therefore, the Taiwan Disease Control Agency decided to conduct antibody tests to control the infection and confirm the source of infection. The results showed that the serum antibody was negative for IgM and positive for IgG, indicating that the infection time was earlier. Such data are useful for related case screening. Therefore, the antibody detection method can provide some information that the nucleic acid method is not able to verify, and this additional information can help to control the virus infection.

E. Aptamer-based detection chip

Ligand refers to a substance that can specifically bind to a receptor molecule on the surface of the target.83 It is often used to influence cell biochemical reactions or specific cells to occupy an important position in disease treatment, pathogen diagnosis, and other fields. Ahn et al. used SELEX (systematic evolution of ligands by exponential enrichment) technology to select a short single-stranded oligonucleotide called aptamer that specifically binds to a unique ligand, N protein of the SARS expressed on the surface of the viruses.84 The aptamer has a hairpin loop structure that can bind to the target protein to form a stable complex similar to the interaction between the antibody and antigen [Fig. 5(a)]. The first step of SELEX is to establish a nucleic acid sequence library by biochemical methods and mix the aptamer library with the target protein. The nucleic acid with a high affinity to the target protein can conjugate together, while the unconjugated nucleic acids are washed away. The conjugated aptamer then is amplified by PCR to generate multiple duplicates for the next round of the selection. After repeating the above steps for several cycles, a candidate nucleic acid with high specific identification to N protein is selected and regarded as an aptamer.85 After screening, the aptamer can be immobilized onto a plate through oligonucleotide hybridization. This technique demonstrated a detection limit as low as 2 pg/ml and the authors claimed to be at the same level as the conventional ELISA approach for detecting antibodies [Fig. 5(b)]. It can also be applied to the detection of COVID-19 by screening out suitable aptamers via SELEX. Similar to the antibody detection methods described previously, it can also be used as an antigen diagnosis for COVID-19 infected patients after passing the acute infection period.86

FIG. 5.

FIG. 5.

Non-antibody diagnosis for the detection of the virial proteins. (a) The sequence and configuration of the aptamer screened by SELEX. (b) The result of diagnosis using the SELEX technology. Reproduced with permission from Ahn et al., Analyst 134, 1896–1901 (2009). Copyright 2009 Royal Society of Chemistry.4 (c) The antibody mimic proteins are evenly spread on the surface of the chip coated with the nanowire. Once the viral proteins bind to the chip, the sample can be detected according to the current change. (d) Different concentrations of N proteins are detected on the chip, and the concentration of target proteins can be as low as 2 nM. Reproduced with permission from Ishikawa et al., ACS Nano 3, 1219–1224 (2009). Copyright 2009 American Chemical Society.

F. Antibody mimics-based detection chip

Ishikawa et al. developed a nanowire biosensor coated with the antibody mimic protein for detecting N protein expressed on SARS virus [Fig. 5(c)].87 The technology of biosensor combining biomaterial and sensor, and it mainly includes two parts: (1) sensitive biological detection element, such as antibody mimic proteins (AMPs) and (2) sensor for converting the signal detected into a visible signal to visualize the detected N protein as a change in current. For the sensitive biological detection element, AMP can be viewed as a single-domain antibody. Usually, the antibody consists of the Fab light chain part that can bind to the antigen and the Fc heavy chain part, while the antibody mimic proteins only contain the function of the light chain that can specifically bind to the antigen. The major difference is the molecular size of AMP which is only about 2–5 nm, while that of the normal antibody is around 10–15 nm. After screening and synthesizing the suitable AMP, it was coated to the surface of In2O3 nanowires. If SARS-specific N proteins are present in the sample, they can conjugate with the coated AMP and affect the current passed through the lower semi-conductor. Meanwhile, the lower sensor uses a silicon/silicon dioxide semiconductor to convert the detected signal into a current signal. This sensor can detect changes in the protein content in the sample by the verification of the detected current, but it is not able to specifically distinguish proteins. Therefore, the authors grafted AMP that can specifically bind to N proteins in advance and added bovine serum albumin (BSA) as a blocking reagent before testing. After adding the sample, the specific protein in the sample can combine with AMP, and the influence of off-target results can also be effectively reduced. If the upper antibody mimic proteins sense the existence of the N protein, the current passing through the lower semiconductor will change and the users can observe this change to judge the existence of N proteins in the sample. This system provides detection sensitivity for N protein concentration as low as 0.6 nM [Fig. 5(d)].87 This technology has a potential that applies to COVID-19 detection and diagnosis by changing the type of AMP specific to the COVID-19 N protein.

G. Single chip for multiple viral nucleic acid tests

Common viruses that cause upper respiratory tract infections include influenza virus A, influenza virus B, adenovirus, and coronavirus. Influenza virus A is a positive RNA virus and contains a variety of different subgroups. For example, H1N1, where the letter H represents hemagglutinin containing 1–18 types and N represents neuraminidase including 1–11 types type.88,89 The H1N1 virus caused a global pandemic in 2009, which has infected more than 1.3 × 106 people so far. People who are infected with H1N1 influenza may have a high fever, headache, systemic muscle aches, joint pain, marked fatigue, cough, sore throat, and stuffy nose. Almost 25% of patients have symptoms of diarrhea, vomiting, and dysentery.90,91 Wang et al. developed a microfluidic test strip to detect the H1N1 virus and other different respiratory viruses with proper adjustments (Fig. 6).62 This test consists of two steps. The first step is the magnetic nucleic acid extraction described previously. After dissolving the collected sample, the nucleic acid can be attracted by magnetic beads due to their strong electrical properties so that the non-nucleic acid materials (e.g., cell debris) are washed away. The nucleic acids are then released and collected. This method is a rapid and simple nucleic acid extraction technology, providing an excellent tool for using nucleic acid as a basic and fast screening marker. In the second step, the sample is added to the microfluidic chip integrating eight different microchannels. After entering the chip, the sample can be divided into multiple channels and each channel contains different gene amplification primers for analysis. For example, the first flow channel can be pre-loaded with H1N1 amplification primers, and the second flow channel can be added with H5N1 primers so that individual channel can simultaneously detect whether the specimen is infected with a specific single virus, confirming the type of infection for follow-up treatment. After the sample flows through the channels containing the amplification primers, the chip is heated to 60–65 °C, and LAMP technology is applied for gene amplification. Meanwhile, the product of the amplified LAMP is also generated (e.g., magnesium pyrophosphate) and detected by reacting with the colorant HNB (hydroxy naphthol blue) added in the chip in advance. The color change from purple to blue allows the user to easily observe whether the virus is present.62 This technology is also very suitable for the application of COVID-19 after the modification. It can be served as a detection platform that detects multiple different viruses at the same time or detects different areas of gene, including ORF1a, N protein gene, and other virus-specific genes.

FIG. 6.

FIG. 6.

The workflow of multiple virus joint inspection chips. After entering the chip, the sample can be split into multiple different flow channels for joint inspection. Reproduced with permission from Wang et al,. Lab Chip 18, 3507–3515 (2018). Copyright 2018 Royal Society of Chemistry

G. Gold nanoparticle enhanced immuno-PCR

False negatives sometimes may occur because the amount of expressed antigen is lower than the detection limit for the early viral infection. These cases have to be especially avoided in the detection of COVID-19 because of the high level of transmission. If there is a false negative situation, it is likely to cause a wider range of spread. To increase the detection limit and sensitivity, Chen et al. reported a technique of grafting gold nanoparticles on two substances, including (1) antibodies which can specifically bind to antigens and serve as secondary antibodies of sandwich ELISA; (2) reverse transcription DNA sequence which can be used to quantify gold nanoparticles. Sandwich ELISA is an antigen detection technology (Fig. 7).92 The antigen first combines with a specific antibody pre-coded on a solid disk, and then a gold nanoparticle-conjugated secondary antibody is added to bind to the antigen to perform a color reaction. Sandwich ELISA has higher accuracy than direct ELISA. The modified reverse transcription DNA is conjugated with the same gold nanoparticle so that the users can use the PCR technique to amplify and modify the reverse transcription DNA signal using the gold nanoparticle. The DNA signal can trace back to the concentration of the original gold nanoparticle and the final antigen concentration. After multiple DNA amplification, the signal can effectively be increased to address the issue of low antigen expression in the early stage of viral infection.

FIG. 7.

FIG. 7.

The technology of using magnetic beads to amplify nucleic acid signals and to detect a small amount of virus samples for early infection. This technology has the potential to reduce the infection window period. Reproduced with permission from Chen et al., J. Immunol. Methods 346, 64–70 (2009). Copyright 2009 Elsevier.

V. ON-SITE DIAGNOSTIC TOOLS FOR VIRUS DETECTION

In this section, we discuss the methods that have been or have the potential for on-site detection. The on-site detection is defined when the samples can be obtained and verified in the same location, minimizing the risk of contamination or exposure during the transportation. Table III lists the detection limits, sensitivity, detection target, and specificity of these methods.

TABLE III.

On-site virus detection approaches.

Methods Target virus True–false ratio Detection limit Time spend Instrument used Reference
On chip CRISPR-Cas12-based detection COVID-19 PPV: 95%
NPV: 100%
10 copies/μl 45 min Constant temperature heating tank 96
Antibody-based diagnostic platform Dengue virus and Zika virus Sensitivity: 76%–100%
Specificity: 89%–100%
1 ng/ml 15 min Not required 22
iPod platform and microfluidic chip to detect viral antigens HIV Sensitivity: 92%–100%
Specificity: 79%–100%
N/A 15 min iPod 67
On chip LAMP COVID-19 Similar as qPCR 10 fg/μl 0.5–1.5 h Constant temperature heating tank 98 and 99
RT-RPA based method COVID-19 Similar as qPCR 1 ag 10–50 min Constant temperature heating tank 98 and 101
On chip DNA hydrogel detection Ebola, MERS N/A 10−13M 30 min Constant temperature heating tank 103
CFPA Chip ASFV Sensitivity: 93%
Specificity: 100%
10 copies/μl 40 min Constant temperature heating tank 105

A. Antibody-based diagnostic platform or chip to detect viral antigens

Based on the previously described sandwich antibody method, Bosch et al. developed a set of microfluidic test strips that can complete antigen detection in a short time and show the color change that is visible to the naked eye [Fig. 8(a)].22 In principle, this test strip contains two parts. The first part is the control group which can identify whether the test piece is working properly. The second part is the test group. The antibodies specifically against the dengue virus (DENV) and Zika virus are conjugated on the nitrocellulose membrane. When the sample flows through the test strip, the viruses are captured following by flowing through the secondary antibody visible to the naked eye to complete the color recognition. Moreover, this technology can offer the detection limit of dengue virus as low as 1 ng/ml, and only 30 μl of serum sample is required to be detected with high sensitivity (76%–100%) and high specificity (89%–100%) for detecting four different stereotypes of dengue fever, including DENV1–4. It also has a sensitivity of 88% and a specificity of 100% for Pan-DENV.22 We believe that although this technology cannot provide the same low detection limit as qPCR, this technology has shown a great potential for rapid clinical screening of COVID-19. It also has the full potential for multi-antigen detection including various respiratory virus infections.

FIG. 8.

FIG. 8.

The low-cost, on-site detection technology of the virus is currently used for the detection of HIV, Zika virus, etc. (a) Virus detection test paper, purple ink represents the detected antigen or antibody. Reproduced with permission from Bosch et al., Sci. Transl. Med. 9, eaan1589 (2017). Copyright 2017 American Association for the Advancement of Science. (b) The diagnostic chip using iPod as the data processing platform. Reproduced with permission from Laksanasopin et al., Sci. Transl. Med. 7, 273re1 (2015). Copyright 2015 American Association for the Advancement of Science.

Also, Laksanasopin et al. established a microfluidic chip and optical signal sensing system that used an iPod for data processing [Fig. 8(b)].67 This system was used to detect HIV with a sensitivity of 92%–100% and specificity of 79%–100%. In principle, the microfluidic chip is based on the antigen method to sense the antibody in the sample. The sample flows through the chip system pre-grafted with antigen, and then the secondary antibody conjugated with gold particles is passed through. The unconjugated antibody is washed away so the silver reagents can wrap the outer layer of gold particles to enhance the signal. A combination of LED and photodiodes is used for sensing in the signal detection part. Such a system can increase the signal for those samples which are not able to be detected due to low virus antigen levels. The same can also be used for COVID-19 detection.

B. CRISPR-Cas12-based detection chip

The CRISPR (clustered regularly interspaced short palindromic repeat) system is derived from the natural defense mechanism of bacteria to fight against viruses that infect bacteria. When the virus (e.g., bacteriophage) infects bacteria for the second time, the guide RNA (gRNA) of the CRISPR system recognizes its sequence and activates the Cas endonuclease of the CRISPR system to cut off the intruder's genetic sequence.93 CRISPR so far has discovered three major systems including Cas9, Cas13, and Cas12. The Cas12 and Cas13 systems are particularly suitable for human disease detection.94 This concept has been demonstrated by using the Cas12-based lateral flow biosensor for the rapid detection of nucleic acids from the bacteria (Fig. 9).95 Recently, Broughton et al. have clinically demonstrated that CRISPR Cas12 can detect the presence of COVID-19 virus by DETECTR (DNA Endonuclease-Targeted CRISPR Trans Reporter) assay.96 The principle is to use RT-LAMP to reverse transcription and amplify the RNA from suspicious COVID-19 virus samples. Once the sufficient amount of cDNA is obtained, the synthetic gRNA that can recognize the COVID-19 specific cDNA sequence is to activate the Cas12 enzyme which can cut off the pre-added single-stranded DNA (ssDNA) probe. This ssDNA probe is designed to contain quencher and fluorescent reporter molecules. When the ssDNA is activated by the Cas12 system, the reporter molecule is cleaved to be visualized by a fluorescent reader so that the users can determine whether the patient is infected. For clinical readout applications, the easy-to-use lateral flow strips were developed without the use of complex laboratory infrastructure to diagnose infections from emerging infectious diseases. After loading the sample into the lateral flow strip, the complete ssDNA and the sheared ssDNA can separate for easier identification. The results demonstrated that the detection limit can be as low as 10 copies per μl input compared with the 1–3.2 copies per μl input of qPCR technology. Despite the detection limit, this technology has the advantage of being able to complete the test within 45 min for the use of first-line virus detection.

FIG. 9.

FIG. 9.

The workflow and the principle of the CRISPR-based rapid diagnosis method for the detection of the infectious disease. The sample is pretreated using LAMP and coupled with Cas12 detection. Reproduced with permission from Mukama et al., Biosensors Bioelectr. 159, 112143 (2020). Copyright 2020 Elsevier.95

C. On-chip loop-mediated isothermal amplification based method

LAMP and traditional PCR are both nucleic acid amplification technologies. Traditional PCR has three stages in the amplification process. (1) Denaturation at 95 °C; (2) annealing at 58 °C; (3) polymerization at 72 °C. Besides, it has high requirements for temperature control which has to be precisely controlled using a temperature control device for nucleic acid amplification. On the other hand, LAMP does not require the control of high and low-temperature changes. It only needs to be fixed at 60–65 °C and can achieve nucleic acid amplification faster than the PCR. This isothermal technology is particularly suitable for remote areas, occasions requiring rapid detection, point-of-care, or bedside.97

In addition to easy temperature control, LAMP's color rendering method is also extremely easy. As the amplification reaction proceeds, the amount of by-product pyrophosphate also increases. Normally, the amount of pyrophosphate is proportional to the amount of the original target nucleic acid. The user can visually recognize the turbidity by generating white precipitates of magnesium pyrophosphate. For COVID-19 detection, LAMP is also particularly suitable for rapid screening. Compared to the traditional PCR technology, LAMP can complete nucleic acid amplification and complete color rendering within 1 h. In addition, the clinicians also urgently search for a system that can perform multi-sample testing at the same time. Naveen et al. and Yu et al. have reported that after using RT-LAMP to amplify the nucleic acid of COVID-19, the by-product generation would cause the pH value change of the solution when an acid–base indicator is added to the centrifuge tube in advance. Thus, users can visualize the color change and determine whether the original sample contains viral nucleic acid. Compared with traditional qPCR, Naveen et al. reported that this technology can increase the detection limit by two orders and serve as a faster screening platform.98 On the other hand, LAMP technology is also very suitable to be applied in the microfluidics. Fang et al. established a microfluidic chip system to differentiate three human influenzas A substrains based on the multiplex microfluidic LAMP reactions called μLAMP (Fig. 10).99 It can provide a sensitivity of 10 fg/μl from the original target nucleic acid and the detection time only requires 0.5–1.5 h. As mentioned previously, this chip can also use the turbidity provided by magnesium pyrophosphate to identify the existence of the original nucleic acid. The quantitative method was established to measure the absorption of visible light (∼640 nm) to judge the change in turbidity. Based on the threshold time (Tt, which is the time required to reach the lowest concentration that can be detected by the absorption spectrum), Tt value can be used to measure the amount of target nucleic acid from the sample.

FIG. 10.

FIG. 10.

LAMP technology for on-site detection. LAMP can amplify the nucleic acids at a constant temperature. At the same time, users can use the turbidity of the sample to determine the original amount of the target nucleic acid. (a) Photograph of on-chip LAMP. (b) The sample can transport through the microchannel via capillary force. (c) The white precipitates are visualized for positive results, while no whiteness and turbidity for negative results. Reproduced with permission from Fang et al., Anal. Chem. Anal. Chem. 82, 3002–3006 (2010). Copyright 2010 American Chemical Society.

D. RT-RPA (recombinase polymerase amplification) based detection chip

Recombinase polymerase amplification is the other nucleic acid amplification technology. Unlike traditional PCR, RPA can amplify nucleic acids at an even lower temperature than the LAMP approach. The optimal amplification temperature for RPA is 37–42 °C. The PCR method requires a high temperature of 95 °C to untie the double-stranded nucleic acids into single strands. As the temperature drops, the primers can conjugate with specific complementary sequences to facilitate subsequent amplification. For traditional PCR, the temperature is necessary to guide the primers to engage in the correct position, while RPA requires only a recombinase to guide primers to conjugate specific complementary sequences so the DNA polymerase can initiate amplification.100

Due to the use of low and isothermal temperature, RPA can provide nucleic acid amplification tests more feasible at the bedside or in the field.100 For example, the Ebola virus broke out in many countries of Africa in 2014, and most of these countries are relatively remote and lack resources at that time. RPA technology is a more suitable candidate for the diagnosis of Ebola virus infection. To this day, the outbreak of the COVID-19 virus can also be detected using RPA to amplify nucleic acid. Xia et al. reported the use of RPA to detect COVID-19.101 First, the authors used RPA technology to amplify the nucleic acid of COVID-19 from the specimen and added the FRET probe after completion of the nucleic acid amplification. The FRET probe contains two parts: (1) a fluorescent molecule (e.g., FAM) and (2) a quencher (e.g., BHQ-1). This probe can specifically bind to the nucleic acid sequence of COVID-19. After binding, exonuclease III is added to disconnect the connection between the two parts of the FRET probe. When the quencher no longer works, the users can observe the fluorescence emission based on the FAM signal. Besides, this technique can obtain relative quantitative results. The emitted fluorescence intensity is positively correlated with the amount of the FRET probe bound to the nucleic acid sequence to ensure the amount of viral nucleic acid in the sample. Although this technology can quickly provide detection results and shorten the screening time, it sacrifices the detection limit. Naveen et al. reported that RPA technology can increase the detection limit by three orders of magnitude compared with qPCR.98 Therefore, we believe that this technology is more suitable for rapid detection, but further integrative solution is still necessary for improving the detection of viral infection when using microfluidics-based technology.

E. DNA hydrogel detection system

Hydrogel is a hydrophilic network formed by hydrophilic polymer chains. Recently, Lee et al. reported a new type of DNA hydrogel in which the polymer chain is composed of entangled inter- and intra-DNA chains (Fig. 11).102 These DNA chains contained a designed single-stranded DNA that contains (1) a complementary sequence to an antigen nucleic acid, (2) a complementary sequence to the neighboring sequence to form a dumbbell-shape nucleic acid, (3) a region that can be bound with a primer. After the hybridization of the sequence with the sample, the nucleic acid sequence can simultaneously form a dumbbell-like shape if the sample contains antigens that can be recognized by the designed sequence. Once the DNA ligase is added, the antigen sequence forms a covalent bond with the designed sequence. Finally, LAMP technology is used to amplify the dumbbell-shaped DNA sequences and to increase the amount of DNA, resulting in the formation of a visible DNA gel.

FIG. 11.

FIG. 11.

The DNA hydrogel detection method for virus diagnosis. (a) The principle of interaction between virus and detection probe. (b) The experimental results for virus detection. When the DNA gel is formed, the flow channel will be blocked, making the blue color dye unable to infiltrate. This can determine whether there is a viral nucleic acid in the sample. Reproduced with permission from Lee et al., Adv. Mater. 27, 3513–3517 (2015). Copyright 2015 John Wiley & Sons.

The same technique was then integrated with a microfluidic chip to test viruses such as Ebola and MERS.103 The chip includes the specimen inlet and three independent flow channels. One of the three independent flow channels contained the dumbbell-shaped nucleic acid probe described previously. If the sample flows contain a specific viral nucleic acid, after the amplification of the nucleic acid by LAMP, a DNA gel will form to block the flow channel. Eventually, a colored solution such as trypan blue dye is injected to determine which channel is blocked by the DNA hydrogel to detect the virus infection. We believe this technology can also be applied to detect COVID-19 only when the pathogen recognition sequence is replaced.

F. Microfluidic-circular fluorescent probe-mediated isothermal nucleic acid amplification (CFPA) chip

African swine fever virus (ASFV) is a large, double-stranded DNA virus in the Asfarviridae family.104 The disease is mainly contagious. It can be transmitted through food waste, animal secretions or excreta, vehicles, and personnel entrapment, etc. Infection can cause severe hemorrhagic fever in domestic pigs and lead to death. Ye et al. developed a set of DNA amplification system which is similar to LAMP, allowing to amplify DNA under a constant temperature environment without temperature control cycles like PCR.105 The mechanism of CFPA is shown in Fig. 12(a). The system contains a target amplified DNA sequence and two primers. Both primers are conjugated with a fluorescent substance and a quencher. When the target DNA is recognized by the forward primer recognize, the sequence is extended to form a circular structure. The reverse primer then assists to extend this specific sequence to generate an overlapping structure. After the amplification, the forward primer is cut off by an endonuclease, separating the fluorescent molecules from the quencher on the primer. These releasing fluorescent signals can be detected by a fluorescence spectrometer in real-time, demonstrating high sensitivity and specificity reaction. Meanwhile, the authors established a microfluidic system to divert a specimen into multiple different flow channels to simultaneously process 32 samples at the same time [Fig. 12(b)]. The entire test can rapidly amplify and quantify the target nucleic acids at a constant temperature. The author claimed that this platform can provide the detection limit of 10 copies/μl, good stability (CV <5%), high sensitivity (92.73%), and high specificity (100%). This system may also be used to amplify and quantify nucleic acids of COVID-19 after modification.

FIG. 12.

FIG. 12.

Microfluidic-CFPA chip for constant temperature DNA amplification technology. (a) The mechanism of CFPA. (b) The multi-channel design of the chip can simultaneously analyze 32 reactions at the same time. The results can be read and process with a handheld spectrometer. Reproduced with permission from Ye et al., ACS Sensor 4, 3066−3071 (2019). Copyright 2019 American Chemical Society.

VI. CONCLUSIONS AND FUTURE PERSPECTIVES

In this Review, we mainly divide several technologies that have been used in COVID-19 and other virus testings into laboratory testing and on-site testing. Laboratory testing includes PCR, ELISA, biosensors, and aptamer-based technologies that have not been used in clinical practice. On-site testing includes CRISPR-based, RT-RPA-based, RT-LAMP-based approaches. Both testing results have shown promising potential to diagnosis numerous infectious diseases when incorporated with microfluidic technology. The reason is not only the use of microfluidics as a detection platform can quickly and simplify miniaturize the complex laboratory process to a tiny and portable chip, but more importantly, such a platform can reduce the cost with minimum use of the costly equipment. For example, Laksanasopine et al. replaced the HIV test previously done in the laboratory with the original smartphone dongle.67 The authors obtained their data by using the HIV test system in Rwanda and claim that a complete set of test system only requires 34 US dollars compared to the traditional ELISA approach is about 18 450 US dollars due to the additional expense of reagents, a plate, and the use of the plate reader. Such a substantial price drop can provide an affordable testing platform for remote and resource-scarce countries. For the prevention and treatment of disease and from the perspective of public health, low-cost technology is necessary to fulfill this goal. The same is true for the prevention and treatment of COVID-19. Human beings also urgently need technologies that can detect the virus at remote locations to avoid handling and shipping.

On the other hand, we believe that traditional and developed analytical approaches such as ELISA and PCR are equally important. These technologies can provide services when the disease begins to develop at an early stage, without any modification and testing. In some specific situations, traditional techniques play a more important role than on-site testing. For example, in February 2020, Taiwan CDC traced the COVID-19 antibody from a taxi driver's serum; they immediately re-investigated other people who had contact with the source of infection. Such technology can also significantly help control the epidemic. Finally, we sincerely hope that COVID-19 can be brought under control. Accomplishing such a difficult task requires mutual assistance from all human beings. Also, vaccine development and testing technology development are the top priorities. At the same time, humans should also help themselves by wearing masks, washing hands frequently, and maintaining social distance.

AUTHORS' CONTRIBUTIONS

T.-H.H and J.-H.H. conceived the idea and outline of the paper. H.-Y.M., Y.-L.L., and J.-H.H. wrote the manuscript. All authors read and approved the manuscript.

ACKNOWLEDGMENTS

We thank AIP Publishing for editing our Review.

Note: This paper is part of the special issue on Microfluidic Detection of Viruses for Human Health

DATA AVAILABILITY

Data sharing is not applicable to this article as no new data were created or analyzed in this study.

REFERENCES

  • 1.Khan S. et al. , “The spread of novel coronavirus has created an alarming situation worldwide,” J. Infect. Public Health 13, 469–471 (2020). 10.1016/j.jiph.2020.03.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Wu Y.-C., Chen C.-S., and Chan Y.-J., “The outbreak of COVID-19: An overview,” J. Chin. Med. Assoc. 83, 217 (2020). 10.1097/JCMA.0000000000000270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Baud D. et al. , “Real estimates of mortality following COVID-19 infection,” Lancet Infect. Dis. 20, 773 (2020). 10.1016/S1473-3099(20)30195-X [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hu Z. et al. , “Clinical characteristics of 24 asymptomatic infections with COVID-19 screened among close contacts in Nanjing, China,” Sci. China Life Sci. 63, 706–711 (2020). 10.1007/s11427-020-1661-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Xia W. et al. , “Clinical and CT features in pediatric patients with COVID-19 infection: Different points from adults,” Pediatr. Pulmonol. 55, 1169–1174 (2020). 10.1002/ppul.24718 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Long C. et al. , “Diagnosis of the coronavirus disease (COVID-19): RRT-PCR or CT?,” Eur. J. Radiol. 126, 108961 (2020). 10.1016/j.ejrad.2020.108961 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Guo Y.-R. et al. , “The origin, transmission and clinical therapies on coronavirus disease 2019 (COVID-19) outbreak—An update on the status,” Mil. Med. Res. 7, 1–10 (2020). 10.1186/s40779-019-0229-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Nishiura H. et al. , “Estimation of the asymptomatic ratio of novel coronavirus infections (COVID-19),” Int. J. Infect. Dis. 94, 154 (2020). 10.1016/j.ijid.2020.03.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gao Z. et al. , “A systematic review of asymptomatic infections with COVID-19,” J. Microbiol. Immunol. Infect. (in press) (2020). 10.1016/j.jmii.2020.05.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gandhi M., Yokoe D. S., and Havlir D. V., “Asymptomatic transmission, the Achilles’ heel of current strategies to control covid-19,” N. Engl. J. Med. 382, 2158–2160 (2020). 10.1056/NEJMe2009758 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Le T. T. et al. , “The COVID-19 vaccine development landscape,” Nat. Rev. Drug Discov. 19, 305–306 (2020). 10.1038/d41573-020-00073-5 [DOI] [PubMed] [Google Scholar]
  • 12.Lurie N. et al. , “Developing covid-19 vaccines at pandemic speed,” N. Engl. J. Med. 382, 1969–1973 (2020). 10.1056/NEJMp2005630 [DOI] [PubMed] [Google Scholar]
  • 13.Nguyen T., Duong Bang D., and Wolff A., “2019 novel coronavirus disease (COVID-19): Paving the road for rapid detection and point-of-care diagnostics,” Micromachines 11, 306 (2020). 10.3390/mi11030306 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ai T. et al. , “Correlation of chest CT and RT-PCR testing in coronavirus disease 2019 (COVID-19) in China: A report of 1014 cases,” Radiology 296(2), E32–E40 (2020). 10.1148/radiol.2020200642 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Chan J. F.-W. et al. , “Improved molecular diagnosis of COVID-19 by the novel, highly sensitive and specific COVID-19-RdRp/Hel real-time reverse transcription-PCR assay validated in vitro and with clinical specimens,” J. Clin. Microbiol. 58, e00310–20 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Okba N. M. et al. , “SARS-CoV-2 specific antibody responses in COVID-19 patients,” medRxiv2020.03.18.20038059 (2020). [Google Scholar]
  • 17.Lee N.-Y. et al. , “A case of COVID-19 and pneumonia returning from Macau in Taiwan: Clinical course and anti-SARS-CoV-2 IgG dynamic,” J. Microbiol. Immunol. Infect. 53, 485–487 (2020). 10.1016/j.jmii.2020.03.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Esbin M. N. et al. , “Overcoming the bottleneck to widespread testing: A rapid review of nucleic acid testing approaches for COVID-19 detection,” RNA 26(7), 771–783 (2020). 10.1261/rna.076232.120 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Samiei E., Tabrizian M., and Hoorfar M., “A review of digital microfluidics as portable platforms for lab-on a-chip applications,” Lab Chip 16, 2376–2396 (2016). 10.1039/C6LC00387G [DOI] [PubMed] [Google Scholar]
  • 20.Yin J. et al. , “Integrated microfluidic systems with sample preparation and nucleic acid amplification,” Lab Chip 19, 2769–2785 (2019). 10.1039/C9LC00389D [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cao Q. et al. , “Microfluidic chip for molecular amplification of influenza A RNA in human respiratory specimens,” PLoS One 7, e33176 (2012). 10.1371/journal.pone.0033176 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bosch I. et al. , “Rapid antigen tests for dengue virus serotypes and Zika virus in patient serum,” Sci. Transl. Med. 9, eaan1589 (2017). 10.1126/scitranslmed.aan1589 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Tan Y.-C. et al. , “Design of microfluidic channel geometries for the control of droplet volume, chemical concentration, and sorting,” Lab Chip 4, 292–298 (2004). 10.1039/b403280m [DOI] [PubMed] [Google Scholar]
  • 24.Mu H. Y. et al. , “Triple selection strategy for in situ labeling of circulating tumor cells with high purity and viability toward preclinical personalized drug sensitivity analysis,” Adv. Biosyst. 4, 2000013 (2020). 10.1002/adbi.202000013 [DOI] [PubMed] [Google Scholar]
  • 25.Lescure F.-X. et al. , “Clinical and virological data of the first cases of COVID-19 in Europe: A case series,” Lancet Infect. Dis. 20, 697–706 (2020). 10.1016/S1473-3099(20)30200-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Yu F. et al. , “Quantitative detection and viral load analysis of SARS-CoV-2 in infected patients,” Clin. Infect. Dis. 71, 793–798 (2020). 10.1093/cid/ciaa345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Long Q.-X. et al. , “Antibody responses to SARS-CoV-2 in patients with COVID-19,” Nat. Med. 26, 845–848 (2020). 10.1038/s41591-020-0897-1 [DOI] [PubMed] [Google Scholar]
  • 28.Zhang Y. and Jiang H.-R., “A review on continuous-flow microfluidic PCR in droplets: Advances, challenges and future,” Anal. Chim. Acta 914, 7–16 (2016). 10.1016/j.aca.2016.02.006 [DOI] [PubMed] [Google Scholar]
  • 29.Van Elslande J. et al. , “Diagnostic performance of 7 rapid IgG/IgM antibody tests and the Euroimmun IgA/IgG ELISA in COVID-19 patients,” Clin. Microbiol. Infect. 26, 1082–1087 (2020). 10.1016/j.cmi.2020.05.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nagasawa M. et al. , “Investigation of anti-SARS-CoV-2 IgG and IgM antibodies in the patients with COVID-19 by three different ELISA test kits,” SN Compr. Clin. Med. 2, 1323–1327 (2020). 10.1007/s42399-020-00409-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Xiao A. T., Tong Y. X., and Zhang S., “False-negative of RT-PCR and prolonged nucleic acid conversion in COVID-19: Rather than recurrence,” J. Med. Virol. 92, 1755–1756 (2020). 10.1002/jmv.25855 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Zhang F., Abudayyeh O. O., and Gootenberg J. S., “A protocol for detection of COVID-19 using CRISPR diagnostics,” Protoc. Detect. COVID-19 CRISPR Diagn. 8 (2020). [Google Scholar]
  • 33.Dara M. and Talebzadeh M., “CRISPR/cas as a potential diagnosis technique for COVID-19,” Avicenna J. Med. Biotechnol. 12(3), 201–202 (2020). [PMC free article] [PubMed] [Google Scholar]
  • 34.Mousavizadeh L. and Ghasemi S., “Genotype and phenotype of COVID-19: Their roles in pathogenesis,” J. Microbiol. Immunol. Infect. (in press) (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.ul Qamar M. T. et al. , “Structural basis of SARS-CoV-2 3CLpro and anti-COVID-19 drug discovery from medicinal plants,” J. Pharm. Anal. 10, 313–319 (2020). 10.1016/j.jpha.2020.03.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Gong Y.-N. et al. , “Sequence variation among SARS-CoV-2 isolates in Taiwan,” bioRxiv (2020). [Google Scholar]
  • 37.Ibrahim I. M. et al. , “COVID-19 spike-host cell receptor GRP78 binding site prediction,” J. Infect. 80, 554–562 (2020). 10.1016/j.jinf.2020.02.026 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Uddin M. et al. , “SARS-CoV-2/COVID-19: Viral genomics, epidemiology, vaccines, and therapeutic interventions,” Viruses 12, 526 (2020). 10.3390/v12050526 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Cao Y. et al. , “Comparative genetic analysis of the novel coronavirus (2019-nCoV/SARS-CoV-2) receptor ACE2 in different populations,” Cell Discovery 6, 11 (2020). 10.1038/s41421-020-0147-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Phan T., “Genetic diversity and evolution of SARS-CoV-2,” Infect. Genet. Evol. 81, 104260 (2020). 10.1016/j.meegid.2020.104260 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Shannon A. et al. , “Remdesivir and SARS-CoV-2: Structural requirements at both nsp12 RdRp and nsp14 exonuclease active-sites,” Antiviral Res. 178, 104793 (2020). 10.1016/j.antiviral.2020.104793 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Astuti I., “Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2): An overview of viral structure and host response,” Diabetes Metab. Syndr. Clin. Res. Rev. 14, 407–412 (2020). 10.1016/j.dsx.2020.04.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Malik Y. A., “Properties of coronavirus and SARS-CoV-2,” Malays. J. Pathol. 42(1), 3–11 (2020). [PubMed] [Google Scholar]
  • 44.Jin Z. et al. , “Structure of M pro from SARS-CoV-2 and discovery of its inhibitors,” Nature 582, 289–293 (2020). 10.1038/s41586-020-2223-y [DOI] [PubMed] [Google Scholar]
  • 45.Hoffmann M. et al. , “SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor,” Cell 181, 280–271 (2020). 10.1016/j.cell.2020.02.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.South A. M., Diz D. I., and Chappell M. C., “COVID-19, ACE2, and the cardiovascular consequences,” Am. J. Physiol. Heart Circ. Physiol. 318, H1084–H1090 (2020). 10.1152/ajpheart.00217.2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Riviere G. et al. , “Angiotensin-converting enzyme 2 (ACE2) and ACE activities display tissue-specific sensitivity to undernutrition-programmed hypertension in the adult rat,” Hypertension 46, 1169–1174 (2005). 10.1161/01.HYP.0000185148.27901.fe [DOI] [PubMed] [Google Scholar]
  • 48.Rico-Mesa J. S., White A., and Anderson A. S., “Outcomes in patients with COVID-19 infection taking ACEI/ARB,” Curr. Cardiol. Rep. 22, 1–4 (2020). 10.1007/s11886-020-1252-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Li E. et al. , “Vapochromic crystals: Understanding vapochromism from the perspective of crystal engineering,” Chem. Soc. Rev. 49, 1517–1544 (2020). 10.1039/C9CS00098D [DOI] [PubMed] [Google Scholar]
  • 50.Liu Y. et al. , “The reproductive number of COVID-19 is higher compared to SARS coronavirus,” J. Travel Med. 27(2), taaa021 (2020). 10.1093/jtm/taaa021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yuan J. et al. , “Monitoring transmissibility and mortality of COVID-19 in Europe,” Int. J. Infect. Dis. 95, 311–315 (2020). 10.1016/j.ijid.2020.03.050 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kucharski A. and Althaus C. L., “The role of superspreading in Middle East respiratory syndrome coronavirus (MERS-CoV) transmission,” Eurosurveillance 20, 21167 (2015). 10.2807/1560-7917.ES2015.20.25.21167 [DOI] [PubMed] [Google Scholar]
  • 53.Gandhi M., Yokoe D. S., and Havlir D. V., Mass Medical Soc, 2020.
  • 54.Day M., British Medical Journal Publishing Group, 2020.
  • 55.Martzy R. et al. , “Challenges and perspectives in the application of isothermal DNA amplification methods for food and water analysis,” Anal. Bioanal. Chem. 411, 1695–1702 (2019). 10.1007/s00216-018-1553-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Woloshin S., Patel N., and Kesselheim A. S., “False negative tests for SARS-CoV-2 infection—Challenges and implications,” N. Engl. J. Med. 383, e38 (2020). 10.1056/NEJMp2015897 [DOI] [PubMed] [Google Scholar]
  • 57.Li Y. et al. , “Stability issues of RT-PCR testing of SARS-CoV-2 for hospitalized patients clinically diagnosed with COVID-19,” J. Med. Virol. 92, 903–908 (2020). 10.1002/jmv.25786 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Liu R. et al. , “Positive rate of RT-PCR detection of SARS-CoV-2 infection in 4880 cases from one hospital in Wuhan, China, from Jan to Feb 2020,” Clin. Chim. Acta 505, 172–175 (2020). 10.1016/j.cca.2020.03.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Lin Q. et al. , “Microfluidic immunoassays for sensitive and simultaneous detection of IgG/IgM/antigen of SARS-CoV-2 within 15 min,” Anal. Chem. 92, 9454–9458 (2020). 10.1021/acs.analchem.0c01635 [DOI] [PubMed] [Google Scholar]
  • 60.Xiang F. et al. , “Antibody detection and dynamic characteristics in patients with COVID-19,” Clin. Infect. Dis. 71, 1930–1934 (2020). 10.1093/cid/ciaa461 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Vogels C. B. F. et al. , “Analytical sensitivity and efficiency comparisons of SARS-CoV-2 RT–qPCR primer–probe sets,” Nat. Microbiol. 5, 1299–1305 (2020). 10.1038/s41564-020-0761-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Wang R. et al. , “Rapid detection of multiple respiratory viruses based on microfluidic isothermal amplification and a real-time colorimetric method,” Lab Chip 18, 3507–3515 (2018). 10.1039/C8LC00841H [DOI] [PubMed] [Google Scholar]
  • 63.Vulto P. et al. , “A microfluidic approach for high efficiency extraction of low molecular weight RNA,” Lab Chip 10, 610–616 (2010). 10.1039/B913481F [DOI] [PubMed] [Google Scholar]
  • 64.Fromm M. et al. , Methods in Enzymology (Elsevier, 1987), pp. 351–366. [Google Scholar]
  • 65.Masek T. et al. , “Denaturing RNA electrophoresis in TAE agarose gels,” Anal. Biochem. 336, 46–50 (2005). 10.1016/j.ab.2004.09.010 [DOI] [PubMed] [Google Scholar]
  • 66.De Wachter R. and Fiers W., “Preparative two-dimensional polyacrylamide gel electrophoresis of 32P-labeled RNA,” Anal. Biochem. 49, 184–197 (1972). 10.1016/0003-2697(72)90257-6 [DOI] [PubMed] [Google Scholar]
  • 67.Laksanasopin T. et al. , “A smartphone dongle for diagnosis of infectious diseases at the point of care,” Sci. Transl. Med. 7, 273re271 (2015). 10.1126/scitranslmed.aaa0056 [DOI] [PubMed] [Google Scholar]
  • 68.Bills B. J. and Manicke N. E., “Development of a prototype blood fractionation cartridge for plasma analysis by paper spray mass spectrometry,” Clin. Mass Spectrom. 2, 18–24 (2016). 10.1016/j.clinms.2016.12.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Pu F. et al. , “Direct quantitation of tenofovir diphosphate in human blood with mass spectrometry for adherence monitoring,” Anal. Bioanal. Chem. 412, 1243–1249 (2020). 10.1007/s00216-019-02304-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Fang Y. et al. , “Sensitivity of chest CT for COVID-19: Comparison to RT-PCR,” Radiology 296, 200432 (2020). 10.1148/radiol.2020200432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Marie D. et al. , “Enumeration and cell cycle analysis of natural populations of marine picoplankton by flow cytometry using the nucleic acid stain SYBR green I,” Appl. Environ. Microbiol. 63, 186–193 (1997). 10.1128/AEM.63.1.186-193.1997 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Chan J. F.-W. et al. , “Improved molecular diagnosis of COVID-19 by the novel, highly sensitive and specific COVID-19-RdRp/Hel real-time reverse transcription-PCR assay validated:  In vitro and with clinical specimens,” J. Clin. Microbiol. 58(5), e00310–00320 (2020). 10.1128/JCM.00310-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Duchamp M. B. et al. , “Pandemic A (H1N1) 2009 influenza virus detection by real time RT-PCR: Is viral quantification useful?,” Clin. Microbiol. Infect. 16, 317–321 (2010). 10.1111/j.1469-0691.2010.03169.x [DOI] [PubMed] [Google Scholar]
  • 74.Lee E. Y., Ng M.-Y., and Khong P.-L., “COVID-19 pneumonia: What has CT taught us?,” Lancet Infect. Dis. 20, 384–385 (2020). 10.1016/S1473-3099(20)30134-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Zhou Y.-m. et al. , “The design and application of DNA chips for early detection of SARS-CoV from clinical samples,” J. Clin. Virol. 33, 123–131 (2005). 10.1016/j.jcv.2004.10.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Heller M. J., “DNA microarray technology: Devices, systems, and applications,” Annu. Rev. Biomed. Eng. 4, 129–153 (2002). 10.1146/annurev.bioeng.4.020702.153438 [DOI] [PubMed] [Google Scholar]
  • 77.Huguenin A. et al. , “Broad respiratory virus detection in infants hospitalized for bronchiolitis by use of a multiplex RT-PCR DNA microarray system,” J. Med. Virol. 84, 979–985 (2012). 10.1002/jmv.23272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Renois F. et al. , “Rapid detection of respiratory tract viral infections and coinfections in patients with influenza-like illnesses by use of reverse transcription-PCR DNA microarray systems,” J. Clin. Microbiol. 48, 3836–3842 (2010). 10.1128/JCM.00733-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Lai C.-C. et al. , “Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and corona virus disease-2019 (COVID-19): The epidemic and the challenges,” Int. J. Antimicrob. Agents 55, 105924 (2020). 10.1016/j.ijantimicag.2020.105924 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Du Z. et al. , “Detection of antibodies against SARS-CoV-2 in patients with COVID-19,” J. Med. Virol. 92, 1735–1738 (2020). 10.1002/jmv.25820 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Paweska J. T., Burt F. J., and Swanepoel R., “Validation of IgG-sandwich and IgM-capture ELISA for the detection of antibody to rift valley fever virus in humans,” J. Virol. Methods 124, 173–181 (2005). 10.1016/j.jviromet.2004.11.020 [DOI] [PubMed] [Google Scholar]
  • 82.Van Vuren P. J. and Paweska J., “Laboratory safe detection of nucleocapsid protein of rift valley fever virus in human and animal specimens by a sandwich ELISA,” J. Virol. Methods 157, 15–24 (2009). 10.1016/j.jviromet.2008.12.003 [DOI] [PubMed] [Google Scholar]
  • 83.Munson P. J. and Rodbard D., “Ligand: A versatile computerized approach for characterization of ligand-binding systems,” Anal. Biochem. 107, 220–239 (1980). 10.1016/0003-2697(80)90515-1 [DOI] [PubMed] [Google Scholar]
  • 84.Ahn D.-G. et al. , “RNA aptamer-based sensitive detection of SARS coronavirus nucleocapsid protein,” Analyst 134, 1896–1901 (2009). 10.1039/b906788d [DOI] [PubMed] [Google Scholar]
  • 85.Schneider D. J., Vanderslice R., and Gold L., Google Patents, 1999.
  • 86.Zhang L. et al. , “Discovery of sandwich type COVID-19 nucleocapsid protein DNA aptamers,” Chem. Commun. 56, 10235–10238 (2020). 10.1039/D0CC03993D [DOI] [PubMed] [Google Scholar]
  • 87.Ishikawa F. N. et al. , “Label-free, electrical detection of the SARS virus N-protein with nanowire biosensors utilizing antibody mimics as capture probes,” ACS Nano 3, 1219–1224 (2009). 10.1021/nn900086c [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Hoyle L., “Structure of the influenza virus: The relation between biological activity and chemical structure of virus fractions,” J. Hyg. (Lond) 50(2), 229–245 (1952). 10.1017/s0022172400019562 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Neumann G. et al. , “H5n1 influenza viruses: Outbreaks and biological properties,” Cell Res. 20, 51–61 (2010). 10.1038/cr.2009.124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Vijaykrishna D. et al. , “Reassortment of pandemic H1N1/2009 influenza A virus in swine,” Science 328, 1529–1529 (2010). 10.1126/science.1189132 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Jamieson D. J. et al. , “H1N1 2009 influenza virus infection during pregnancy in the USA,” Lancet 374, 451–458 (2009). 10.1016/S0140-6736(09)61304-0 [DOI] [PubMed] [Google Scholar]
  • 92.Chen L. et al. , “Gold nanoparticle enhanced immuno-PCR for ultrasensitive detection of Hantaan virus nucleocapsid protein,” J. Immunol. Methods 346, 64–70 (2009). 10.1016/j.jim.2009.05.007 [DOI] [PubMed] [Google Scholar]
  • 93.Horvath P. and Barrangou R., “CRISPR/cas: The immune system of bacteria and archaea,” Science 327, 167–170 (2010). 10.1126/science.1179555 [DOI] [PubMed] [Google Scholar]
  • 94.Makarova K. S. et al. , “Evolution and classification of the CRISPR–Cas systems,” Nat. Rev. Microbiol. 9, 467–477 (2011). 10.1038/nrmicro2577 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Mukama O. et al. , “An ultrasensitive and specific point-of-care CRISPR/Cas12 based lateral flow biosensor for the rapid detection of nucleic acids,” Biosens. Bioelectron. 159, 112143 (2020). 10.1016/j.bios.2020.112143 [DOI] [PubMed] [Google Scholar]
  • 96.Broughton J. P. et al. , “CRISPR–Cas12-based detection of SARS-CoV-2,” Nat. Biotechnol. 38, 870–874 (2020). 10.1038/s41587-020-0513-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Notomi T. et al. , “Loop-mediated isothermal amplification of DNA,” Nucleic Acids Res. 28, e63 (2000). 10.1093/nar/28.12.e63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Naveen K. and Bhat A., “Development of reverse transcription loop-mediated isothermal amplification (RT-LAMP) and reverse transcription recombinase polymerase amplification (RT-RPA) assays for the detection of two novel viruses infecting ginger,” J. Virol. Methods 282, 113884 (2020). 10.1016/j.jviromet.2020.113884 [DOI] [PubMed] [Google Scholar]
  • 99.Fang X. et al. , “Loop-mediated isothermal amplification integrated on microfluidic chips for point-of-care quantitative detection of pathogens,” Anal. Chem. 82, 3002–3006 (2010). 10.1021/ac1000652 [DOI] [PubMed] [Google Scholar]
  • 100.Piepenburg O. et al. , Google Patents, 2008.
  • 101.Xia S. and Chen X., “Single-copy sensitive, field-deployable, and simultaneous dual-gene detection of SARS-CoV-2 RNA via modified RT–RPA,” Cell Discovery 6, 37 (2020). 10.1038/s41421-020-0175-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Lee H. Y. et al. , “DhITACT: DNA hydrogel formation by isothermal amplification of complementary target in fluidic channels,” Adv. Mater. 27, 3513–3517 (2015). 10.1002/adma.201500414 [DOI] [PubMed] [Google Scholar]
  • 103.Jung I. Y. et al. , “A highly sensitive molecular detection platform for robust and facile diagnosis of Middle East respiratory syndrome (MERS) corona virus,” Adv. Healthcare Mater. 5, 2168–2173 (2016). 10.1002/adhm.201600334 [DOI] [PubMed] [Google Scholar]
  • 104.Sánchez-Vizcaíno J. M., Laddomada A., and Arias M. L., Diseases of Swine, 11th ed. (Wiley, 2019), pp. 443–452. [Google Scholar]
  • 105.Ye X. et al. , “Microfluidic-CFPA chip for the point-of-care detection of African swine fever virus with a median time to threshold in about 10 min,” ACS Sens. 4, 3066–3071 (2019). 10.1021/acssensors.9b01731 [DOI] [PubMed] [Google Scholar]
  • 106.Corman V. M. et al. , “Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR,” Eurosurveillance 25(3), 2000045 (2020). 10.2807/1560-7917.ES.2020.25.3.2000045 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Zhu N. et al. , “A novel coronavirus from patients with pneumonia in China, 2019,” N. Engl. J. Med. 382, 727–733 (2020). 10.1056/NEJMoa2001017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 108.Lu X. et al. , “US CDC real-time reverse transcription PCR panel for detection of severe acute respiratory syndrome coronavirus 2,” Emerg. Infect. Dis. 26, 1654 (2020). 10.3201/eid2608.201246 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data sharing is not applicable to this article as no new data were created or analyzed in this study.


Articles from Biomicrofluidics are provided here courtesy of American Institute of Physics

RESOURCES