Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Dec 1.
Published in final edited form as: Gene Expr Patterns. 2020 Aug 21;38:119132. doi: 10.1016/j.gep.2020.119132

The modular expression patterns of three pigmentation genes prefigure unique abdominal morphologies seen among three Drosophila species

William A Dion 1, Mujeeb O Shittu 1, Tessa E Steenwinkel 1, Komal K B Raja 1,#a, Prajakta P Kokate 1, Thomas Werner 1,*
PMCID: PMC7725850  NIHMSID: NIHMS1626779  PMID: 32828854

Abstract

To understand how novel animal body colorations emerged, one needs to ask how the development of color patterns differs among closely related species. Here we examine three species of fruit flies – Drosophila guttifera (D. guttifera), D. palustris, and D. subpalustris – displaying a varying number of abdominal spot rows. Through in situ hybridization experiments, we examine the mRNA expression patterns for the pigmentation genes Dopa decarboxylase (Ddc), tan (t), and yellow (y) during pupal development. Our results show that Ddc, t, and y are co-expressed in modular, identical patterns, each foreshadowing the adult abdominal spots in D. guttifera, D. palustris, and D. subpalustris. We suggest that differences in the expression patterns of these three genes partially underlie the morphological diversity of the quinaria species group.

Keywords: Co-expression, Drosophila guttifera, Drosophila palustris, Drosophila subpalustris, pigmentation genes, quinaria species group

Graphical Abstract

graphic file with name nihms-1626779-f0001.jpg

1. Introduction

The complexity and diversity of animal body coloration in the natural world are astounding. Unique patterns like cheetah spots and zebra stripes beg the question – how did these traits evolve? To understand how novel morphologies arose, one needs to ask how alterations to organismal development occurred over evolutionary time (Raff, 2000). Butterfly wings have served as a system to unravel the molecular mechanisms underlying complex pattern development (Carroll et al., 1994; Matsuoka and Monteiro, 2018; Monteiro et al., 2013; Zhang and Reed, 2016; Zhang et al., 2017), and the examination of American cockroaches, large milkweed bugs, and twin-spotted assassin bugs progressed the knowledge of the process of body coloration (Lemonds et al., 2016, Liu et al., 2014; Zhang et al., 2019). Moreover, pigmentation has been shown to be vital to the lifecycles of agricultural pests and human disease vectors, such as the Asian tiger mosquito, black cutworm, brown planthopper, and kissing bug (Berni et al., 2020; Chen et al., 2018; Liu et al., 2019; Lu et al., 2019; Noh et al., 2020; Sterkel et al., 2019). However, these studies were built upon the robust knowledge of pattern and pigmentation development gained through the study of fruit flies, in particular, D. melanogaster.

The role of D. melanogaster as a model to understand fruit fly pigmentation spans decades (Brehme 1941; Wright 1987). Recent studies have examined the relationship between pigmentation and thermal plasticity (De Castro et al., 2018; Gibert et al., 2017), and how pigmentation of the male sex comb contributes to Drosophila mating success (Massey et al., 2019b). Investigating how pigmentation develops in D. melanogaster provided the foundation to understand the same processes in other fruit flies. This knowledge, in turn, has facilitated studies of species divergence (Lamb et al., 2020) and positioned Drosophila pigmentation as a model to study how gene-regulatory networks – the regulatory mechanisms responsible for organismal development (Davidson and Levin, 2005) – evolved (Camino et al., 2015; Gibert et al., 2018; Grover et al., 2018; Ordway et al., 2014; Rebeiz and Williams, 2017; Roeske et al., 2018). The Drosophila pigmentation pathway with the enzymes and reactions necessary to produce black, brown, and yellow coloration seen on the bodies of fruit flies, is shown in Figure 1 (Gibert et al., 2017; Massey et al., 2019a; Rebeiz and Williams, 2017; True et al., 2005; Wittkopp et al., 2003).

Figure 1. The pigmentation pathway of Drosophila.

Figure 1.

This illustration of the pigmentation pathway is adopted from (Gibert et al., 2017; Massey et al., 2019a; Rebeiz and Williams, 2017; True et al., 2005; Wittkopp et al., 2003). Tyrosine is converted to dopa by Pale, which is then converted into dopamine by Dopa decarboxylase (encoded by Ddc). Dopamine proceeds one of four ways: Yellow (encoded by y) can convert it into black melanin; it can become brown pigment through the activity of phenol oxidases; it can be converted into N–acetyl dopamine (NADA) through arylalkylamine N-acetyl transferases (aaNATs) and thus result in a lack of pigmentation through the activity of phenol oxidases; or it may become N-β-alanyl dopamine (NBAD) through the activity of Ebony, followed by a transition to a yellow-tan pigment by phenol oxidases. The protein Tan (encoded by t) functions opposite of Ebony by converting NBAD into dopamine. The gene products for Ddc, t, and y are highlighted.

While the process of Drosophila pigmentation patterning involves many genes, our study focuses on three: Ddc, t, and y, which are all essential for the production of black and brown coloration. Ddc is integral to the development of Drosophila pigmentation, with the mutant phenotype lacking the dark coloration seen on the wild type fly (Walter et al., 1996; Wright et al., 1976). The genes t and y are also required for melanization. Mutants of the t gene exhibit a tan as opposed to a black body pigmentation (Hotta and Benzer, 1969; McEwen, 1918; True et al., 2005), while y mutants display a yellow body color (Biessmann, 1985; Brehme, 1941).

D. melanogaster has a relatively simple abdominal pigmentation pattern, as compared to other Drosophila species. The quinaria group, an adaptive radiation of non-model fruit flies, displays a great variety of abdominal and wing pigmentation patterns (Bray et al., 2014; Werner et al., 2018). This abundant morphological diversity and the recent divergence of the lineage (approximately 10 to 20 million years ago (Izumitani et al., 2016; Spicer and Jaenike, 1996)) will help facilitate the identification of molecular mechanisms underlying differences in species morphology. One member of the quinaria group, D. guttifera, has emerged as a model to study complex pattern development (Fukutomi et al., 2020; Koshikawa et al., 2015; Koshikawa et al., 2017; Raja et al., 2020; Shittu et al., 2020; Werner et al., 2010).

The abdominal spot pattern of D. guttifera consists of six rows of spots: three rows on the left side (dorsal, median, and lateral row), which are mirrored on the right side of the abdomen (Figure 2). D. palustris lacks a pattern module (and sometimes two) of those seen in D. guttifera: the dorsal pair of spot rows is always missing; while the median spots display varying intensity and can even be completely absent (Werner et al., 2018). The most extreme reduction of this patterning theme among the three species is evident in D. subpalustris, where only the lateral pair of spot rows is present (Figure 2). Thus, the interspecific and even intraspecific differences in spot patterns are facilitated by the selective presence or absence of entire spot row pairs (modules) on the adult abdomens.

Figure 2. Spot pattern complexity in the quinaria species group.

Figure 2.

Three members of the quinaria group are shown from a lateral view. The dorsal (d), median (m), and lateral (l) rows of spots are labeled. Images are from (Werner et al., 2018).

In addition to displaying spots, the abdomens of each of the three fruit fly species exhibit wide areas of dark shading. D. guttifera shows two somewhat distinct shaded regions: a wide swath that is shared by all three species encompassing the spotted region, plus a specific dorsal midline shade. Furthermore, D. guttifera shows blackish stripes along the dorsal segment boundaries, which are absent in the other two species.

In the current study, we show that abdominal color pattern diversity among the quinaria species group members D. guttifera, D. palustris, and D. subpalustris is strictly modular and that Ddc, t, and y are co-expressed in identical patterns where dark spots will appear.

2. Results

2.1. D. guttifera pattern development

The gene expression patterns of Ddc, t, and y during pupal development foreshadowed the abdominal adult spots of D. guttifera. Ddc mRNA was detected at pupal stages P10, P12 and P13, t mRNA at P11 and P12, and y mRNA at P10 (Figure 3) (see section 5.2 for information regarding pupal (P) stages). For the rest of the pattern, only y expression correlated with both the dorsal midline shade and intersegment stripes at stage P10 (Figure 4). However, we were unable to detect any gene expression foreshadowing the broader shading around the dorsal and median spot rows.

Figure 3. The in situ hybridization signals of Ddc, t, and y during D. guttifera pupal development foreshadowed the adult spot pattern.

Figure 3.

The spot rows are labeled as dorsal (d), median (m), and lateral (l). (A, B) Adult D. guttifera from a dorsal and lateral view, respectively (Werner et al., 2018). (C, D, E) Ddc mRNA expression at stages P10, P12, and P13, respectively. (F, G) t mRNA at stages P11 and P12, respectively. (H, I) y mRNA expression at stage P10.

Figure 4. The in situ hybridization result of y during D. guttifera pupal development correlated with the adult abdominal dorsal midline shading and the intersegment stripes.

Figure 4.

(A) Dorsal view of adult D. guttifera (Werner et al., 2018). (B) y mRNA expression at stage P10 foreshadowing the dorsal midline shading and the intersegment stripes.

2.2. D. palustris pattern development

D. palustris lacks at least three components of the D. guttifera pattern: the dorsal pair of spot rows (sometimes even the median spot row pair), the dorsal midline shade, and the intersegment stripes. Just as in D. guttifera, the mRNA expression patterns of Ddc, t, and y prefigured the adult D. palustris spot pigmentation. Ddc mRNA was present at stages P11 and P12, t at P11 and P12, and y at P10 and P12 (Figure 5). However, only the expression of t mRNA at stage P12 correlated with the shading pattern (Figure 6).

Figure 5. The in situ hybridization signals of Ddc, t, and y during D. palustris pupal development foreshadowed the abdominal spot pattern.

Figure 5.

The spot rows are labeled as median (m) and lateral (l). (A, B) Adult D. palustris from a dorsal and lateral view, respectively (Werner et al., 2018). (C, D) Ddc mRNA expression at stages P11 and P12, respectively. (E, F) t gene expression foreshadowing spots at stages P11 and P12, respectively. (G, H) y mRNA expression at stages P10 and P12, respectively.

Figure 6. The in situ hybridization result of t during D. palustris pupal development correlated with the adult abdominal shading.

Figure 6.

(A) Lateral view of adult D. palustris (Werner et al., 2018). (B) t mRNA expression at stage P12 prefiguring the shading.

2.3. D. subpalustris pattern development

D. subpalustris exhibits the simplest pattern among the three species studied: one pair of lateral spot rows and shading similar to that of D. palustris. The Ddc, t, and y expression patterns during pupal development foreshadowed the abdominal spots of D. subpalustris; in situ hybridization signals were seen for Ddc at stage P11 and between stages P11 and P12, t at stages P11 and P12, and y at stage P10 (Figure 7). The shading pattern is prefigured by Ddc mRNA at stage P11 (Figure 8).

Figure 7. The in situ hybridization signals for Ddc, t, and y during D. subpalustris pupal development prefigured the abdominal spot pattern.

Figure 7.

The spot rows are labeled as lateral (l). (A, B) Adult D. subpalustris from a dorsal and lateral view, respectively (Werner et al., 2018). (C, D) Ddc gene expression foreshadowing spots at stage P11 and between stages P11 and P12, respectively. (E, F) t gene expression at stage P11 and P12, respectively. Image (E) is taken from a ventral view. (G, H) y mRNA expression at stage P10.

Figure 8. The in situ hybridization result for Ddc during D. subpalustris pupal development foreshadowed the adult abdominal shading.

Figure 8.

(A) Lateral view of adult D. subpalustris (Werner et al., 2018). (B) Ddc mRNA expression at stage P11.

3. Discussion

Here we show the evidence of pigmentation gene expression patterns prefiguring the complex coloration of three Drosophila species. Ddc, t, and y are spatially co-expressed in the developing abdomens, precisely foreshadowing the diverse dark spots in three quinaria group species. Interestingly, the shades and intersegment stripes are uniquely foreshadowed by only one of the three genes: Ddc in D. subpalustris, t in D. palustris, and y in D. guttifera. These data suggest that the regulation of Ddc, t, and y possibly co-evolved to paint complex abdominal spot patterns in concert, but not to collectively regulate the shading.

The spot pattern diversity seen among the three non-model species alone position them as an emerging system to study color pattern diversity. We show correlative evidence that the co-expression of three pigmentation genes is likely responsible for the spot patterning of these three quinaria group species. Intriguingly, each pair of spot rows behaves like a set of independent, serial homologs, similar to the repetitive pattern elements within butterfly wing sections (Monteiro 2008). Thus, these fruit fly abdominal pigmentation patterns may have broader implications to progressing our understanding of color pattern evolution and development across insects.

We show the expression patterns of three genes occurring at different pupal stages, ranging from P10 to P12. However, it has been shown in D. guttifera that this developmental timeframe is very short (P10 lasts almost 12 hours, however stages P11 through P13 are completed in less than 10 hours (Fukutomi et al., 2017)). Thus, we cannot state that these genes’ activities are restricted to the developmental stages shown here. It is also important to note that the lack of in situ hybridization signal could be a result of gene expression levels below the detection limit. This is likely why there is little to no signal among the pigmentation genes foreshadowing the median rows of spots in D. palustris. Additionally, the many tiny dots of in situ hybridization signal seen on the abdomens most likely correlate with the bristle sockets of the developing fly.

To fully understand the role of each gene in these three species’ color pattern development, we must utilize RNA interference and gene overexpression, as well as CRISPR/Cas9 approaches. Transgenic methods are established in D. guttifera (Shittu et al., 2020), and developing similar protocols to produce transgenic D. palustris and D. subpalustris will facilitate our further understanding of how color pattern development evolved among these three species. Pursuing the development of such approaches will facilitate a robust investigation of the mechanisms underlying these three species’ morphological diversity. Furthermore, these advances will facilitate access to study the complex patterning of the 26 members (Scott Chialvo et al., 2019) of the quinaria species group, which displays many modular combinations of spots, stripes, and shapes.

4. Conclusion

Our research is the first to show the expression patterns of pigmentation genes in D. palustris and D. subpalustris. Additionally, we provide further data with regards to an emerging model organism to study complex color pattern development, D. guttifera. Here, we provide qualitative evidence that the modular activities of Ddc, t, and y prefigure the abdominal spot patterns seen among these three species. These data offer a starting point for future transgenic studies to better understand the molecular mechanisms that underlie these unique modular morphologies. Our understanding of complex color pattern development is far from complete; however, continuing to study these three fruit flies, and the quinaria group as a whole, will help us connect the dots.

5. Experimental Procedures

5.1. Drosophila stocks – D. guttifera, D. palustris, and D. subpalustris

D. guttifera and D. subpalustris were purchased from the Drosophila Species Stock Center, stock numbers 15130 – 1971.10 and 15130 – 2071.00, respectively. We collected D. palustris in Waunakee, Wisconsin. All fly stocks were maintained at room temperature on cornmeal-sucrose-yeast medium (Werner et al., 2018).

5.2. Identification of pupal stages

Pupal developmental stages for D. guttifera were determined according to (Bainbridge and Bownes, 1981; Fukutomi et al., 2017). The same characteristics used to establish D. guttifera pupal stages were seen in D. palustris and D. subpalustris pupae, and were therefore used to determine the developmental stages of these two fruit flies.

5.3. in situ hybridization probe design for Ddc, t, and y

RNA in situ hybridization probes were 200 to 500 bases in length. We used Mean Green PCR Master Mix (Syzygy Biotech Solutions) to amplify the partial coding regions with forward and reverse primers (Table 1). The PCR products were extracted and purified with a Thermo Scientific GeneJET Gel Extraction Kit and cloned into the pGEM-TEasy vector, using E. coli DH5α cells. Colony PCR with the M13 forward and reverse universal primer pair was used for screening, and the Thermo Scientific GeneJET Plasmid Miniprep Kit was used for plasmid purification. The insertion direction into the pGEM-TEasy vector was determined through PCR with the M13 forward universal primer and either the internal forward or internal reverse primer (Table 1). Depending on the insertion direction, either SP6 or T7 RNA polymerase was used to produce a DIG (digoxigenin)-labeled RNA anti-sense probe (Roche DIG RNA Labelling Kit (SP6/T7)). GenePalette was used for computational biology (Rebeiz and Posakony, 2004).

Table 1. Primers used to construct in situ hybridization probes.

The D. guttifera Ddc exon 3 forward and reverse primer pair was used to amplify D. guttifera genomic DNA to make the probe to test for D. guttifera Ddc expression. Primer set (a) was used to generate Figure 3 (C), while set (b) was used for Figures 3 (D) and (E). The D. guttifera t exon 5 forward and reverse primer pair amplified D. guttifera genomic DNA to produce the probe used to characterize t in all three species. The forward and reverse primer pair for D. guttifera y exon 2 was used to amplify D. guttifera genomic DNA to develop the probe to determine y expression in D. guttifera. The D. palustris forward and reverse primer pairs for Ddc exon 3 and y exon 2 were used to amplify D. palustris genomic DNA to make the probes used to determine Ddc and y expression patterns in both D. palustris and D. subpalustris. Our choice to use probes constructed from a different species’ DNA was based on the close relationship of the quinaria species group (Izumitani et al., 2016; Spicer and Jaenike, 1996). All internal forward and internal reverse primer pairs were used for verification of the gene identity during the probe-making process.

Primer Name Primer Sequence
D. guttifera Ddc exon 3 (a) forward CACATGAAGGGCATCGAGACCGC
D. guttifera Ddc exon 3 (a) reverse CATGCGCAAGAAGTAGACATCCCG
D. guttifera Ddc exon 3 (a) internal forward CAACTTTGACTGCTCGGC
D. guttifera Ddc exon 3 (a) internal reverse CATGTTCACCTCAGCAGC
D. guttifera Ddc exon 3 (b) forward AGCCATTGATTCCGGATGCGG
D. guttifera Ddc exon 3 (b) reverse AATCGTGTGCTCATCCCACTCG
D. guttifera Ddc exon 3 (b) internal forward ACTGGCACAGTCCCAAGTTCC
D. guttifera Ddc exon 3 (b) internal reverse CATCTTGCCCAGCCAATCTAGC
D. guttifera t exon 5 forward CAGCGTCTGCTTGGCCACACG
D. guttifera t exon 5 reverse TTGCCGCTGCGCAACAATTCGG
D. guttifera t exon 5 internal forward GCTGAATCATTACTACTTTGTGG
D. guttifera t exon 5 internal reverse AATGGTGTTGATGCTGAACACG
D. guttifera y exon 2 forward CCAACATCGCCGTGGACATTG
D. guttifera y exon 2 reverse AATTGCGGAGTGTACGGCATCG
D. guttifera y exon 2 internal forward CTCCTACTTCTTCCCGGATCCC
D. guttifera y exon 2 internal reverse ATCAGATTGAACAGCTCGACGCC
D. palustris Ddc exon 3 forward TATCGTCATCACATGAAGGGC
D. palustris Ddc exon 3 reverse GCCATGCGCAAGAAGTAGAC
D. palustris Ddc exon 3 internal forward TGAAGCACGACATGCAGGG
D. palustris Ddc exon 3 internal reverse CAGACCCATGTTCACCTC
D. palustris y exon 2 forward GAGGAGGGCATCTTTGGC
D. palustris y exon 2 reverse CGATGCCATGGAATTGCGG
D. palustris y exon 2 internal forward TCTCGCACCGAGGACAGC
D. palustris y exon 2 internal reverse CGATCAGATTGAACAGCTCG

5.4. Preparation of pupae for RNA in situ hybridization

When pupae matured to the desired developmental stage, they were cut along the anterior-posterior axis either between the eyes or on their side through the eyes. The pupal halves were fixed in 4% paraformaldehyde (Electron Microscopy Sciences) and kept at −20°C in pure ethanol.

5.5. in situ Hybridization of the pupae

The in situ hybridization procedure was adopted from (Jeong et al., 2008). The tissues were washed between each step with PBST. On the first day, pupae were treated with a 1:1 xylenes to ethanol mixture to remove residual fat tissue. The pupal tissue was then fixed (4% paraformaldehyde), treated with Proteinase K (from Tritirachium album, Sigma-Aldrich) for 10 to 15 minutes (1:25,000 dilution of a 10 mg/mL stock solution), fixed again (4% paraformaldehyde), and then incubated with the anti-sense RNA probe (1:500 dilution) for 18 to 72 hours at 64°C to 65°C. Pupae were gently agitated periodically. The pupae were then incubated in Roche α-DIG AP Fab Fragments (1:6000) at 4°C overnight. On the final day, the tissues were incubated with the BCIP/NBT staining solution (Promega) in the dark until patterns were fully developed (approximately two to 18 hours).

5.6. Imaging of Ddc, t, and y expression patterns after in situ hybridization

z-Stacks of images were taken with Olympus cellSens software, using an Olympus SZX16 microscope and an Olympus DP72 camera. The digital images were stacked with Helicon Focus software.

5.7. Key Resources Table

For a summary of the resources essential to replicating this study, please see the Key Resources Table.

KEY RESOURCES TABLE

Reagent or resource Source Identifier
Antibodies
Bacterial and Virus Strains
Biological Samples
Chemicals, Peptides, and Recombinant Proteins
Critical Commercial Assays
Deposited Data
Experimental Models: Cell Lines
Experimental Models: Organisms/Strains
Drosophila guttifera This paper Drosophila Species Stock Center, stock numbers 15130 – 1971.10
Drosophila palustris This paper N/A - Available from the Laboratory of Dr. Thomas Werner at Michigan Technological University by request
Drosophila subpalustris This paper Drosophila Species Stock Center, stock numbers 15130 – 2071.00. Note that this stock was not available through the Drosophila species stock center as of July 5, 2020 and is available from the Laboratory of Dr. Thomas Werner at Michigan Technological University by request.
Oligonucleotides
Primers for in situ hybridization probes, see Table 1 This paper N/A
Recombinant DNA
Software and Algorithms
GenePalette Software Rebeiz and Posakony, 2004 http://www.genepalette.org/
Olympus cellSens N/A https://www.olympus-lifescience.com/en/software/cellsens/
Helicon Focus N/A https://www.heliconsoft.com/heliconsoft-products/helicon-focus/
Other
DIG RNA Labelling Kit (SP6/T7) Roche https://www.sigmaaldrich.com/catalog/product/roche/11175025910?lang=en&region=US
α-DIG AP Fab Fragments Roche https://www.sigmaaldrich.com/catalog/product/roche/11093274910?lang=en&region=US
BCIP/NBT staining solution Promega https://www.promega.com/products/biochemicals-and-labware/biochemical-buffers-and-reagents/bcip_nbt-color-development-substrate-_5_bromo_4_chloro_3_indolyl_phosphate_nitro-blue-tetrazolium_/?catNum=S3771
Proteinase K from Tritirachium album Sigma-Aldrich https://www.sigmaaldrich.com/catalog/product/sigma/p6556?lang=en&region=US
  • Unique adult abdominal spot patterns among three Drosophila species appear modular

  • Three pigmentation genes are co-expressed in the pupa where spots will appear later

  • One pigmentation gene different for each species prefigures dark abdominal shading

Acknowledgments

We thank Dr. Rupali Datta for valuable comments on the manuscript.

Funding

This work was supported by a National Institutes of Health grant (to TW) (grant number 1R15GM107801-01A1). The funding source had no influence in the study design; collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the article for publication.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Declaration of interests

None.

References

  1. Bainbridge SP, Bownes M Staging the metamorphosis of Drosophila melanogaster. J Embryol Exp Morphol. 1981;66(1): 57–80. [PubMed] [Google Scholar]
  2. Berni M, Bressan D, Simão Y, Julio A, Oliveira PL, Pane A et al. Pigmentation loci as markers for genome editing in the Chagas disease vector Rhodnius prolixus. bioRxiv. 2020:2020.2004.2029.067934. doi: 10.1101/2020.04.29.067934. [DOI] [Google Scholar]
  3. Biessmann H Molecular analysis of the yellow gene (y) region of Drosophila melanogaster. Proc Natl Acad Sci U S A. 1985;82(21): 7369–7373. doi: 10.1073/pnas.82.21.7369 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bray MJ, Werner T, Dyer KA Two genomic regions together cause dark abdominal pigmentation in Drosophila tenebrosa. Heredity. 2014:112(4): 454–462. doi: 10.1038/hdy.2013.124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brehme KS The effect of adult body color mutations upon the larva of Drosophila melanogaster. Proc Natl Acad Sci U S A. 1941;27(6): 254–261. doi: 10.1073/pnas.27.6.254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Camino EM, Butts JC, Ordway A, Vellky JE, Rebeiz M, Williams TM The evolutionary origination and diversification of a dimorphic gene regulatory network through parallel innovations in cis and trans. PLoS Genet. 2015;11(4): e1005136. doi: 10.1371/journal.pgen.1005136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Carroll S, Gates J, Keys D, Paddock S, Panganiban G, Selegue J, Williams J Pattern formation and eyespot determination in butterfly wings. Science. 1994;265(5168): 109–114. doi: 10.1126/science.7912449 [DOI] [PubMed] [Google Scholar]
  8. Chen X, Cao Y, Zhan S, Zhang Y, Tan A, Huang Y Identification of yellow gene family in Agrotis ipsilon and functional analysis of Aiyellow-y by CRISPR/Cas9. Insect Biochem Mol Biol. 2018;94: 1–9. doi: 10.1016/j.ibmb.2018.01.002 [DOI] [PubMed] [Google Scholar]
  9. Davidson E, Levin M Gene regulatory networks. Proc Natl Acad Sci U S A. 2005;102(14): 4935–4935. doi: 10.1073/pnas.0502024102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. De Castro S, Peronnet F, Gilles J-F, Mouchel-Vielh E, Gibert J-M bric à brac (bab), a central player in the gene regulatory network that mediates thermal plasticity of pigmentation in Drosophila melanogaster. PLoS Genet. 2018;14(8): e1007573. doi: 10.1371/journal.pgen.1007573 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Hotta Y, Benzer S Abnormal electroretinograms in visual mutants of Drosophila. Nature. 1969;222(5191): 354–356. doi: 10.1038/222354a0 [DOI] [PubMed] [Google Scholar]
  12. Fukutomi Y, Kondo S, Toyoda A, Shigenobu S, Koshikawa S Transcriptome analysis reveals evolutionary co-option of neural development and signaling genes for the wing pigmentation pattern of the polka-dotted fruit fly. bioRxiv. 2020:2020.2001.2009.899864. doi: 10.1101/2020.01.09.899864. [DOI] [PubMed] [Google Scholar]
  13. Fukutomi Y, Matsumoto K, Agata K, Funayama N, Koshikawa S Pupal development and pigmentation process of a polka-dotted fruit fly, Drosophila guttifera (Insecta, Diptera). Dev Genes Evol. 2017;227(3): 171–180. doi: 10.1007/s00427-017-0578-3 [DOI] [PubMed] [Google Scholar]
  14. Gibert J-M, Mouchel-Vielh E, Peronnet F Modulation of yellow expression contributes to thermal plasticity of female abdominal pigmentation in Drosophila melanogaster. Sci Rep. 2017;7: 43370. doi: 10.1038/srep43370 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gibert J-M, Mouchel-Vielh E, Peronnet F Pigmentation pattern and developmental constraints: flight muscle attachment sites delimit the thoracic trident of Drosophila melanogaster. Sci Rep. 2018;8: 5328. doi: 10.1038/s41598-018-23741-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Grover S, Williams ME, Kaiser R, Hughes JT, Gresham L, Rebeiz M, Williams TM Augmentation of a wound response element accompanies the origin of a Hox-regulated Drosophila abdominal pigmentation trait. Dev Biol. 2018;441(1): 159–175. doi: 10.1016/j.ydbio.2018.07.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Izumitani HF, Kusaka Y, Koshikawa S, Toda MJ, Katoh T Phylogeography of the subgenus Drosophila (Diptera: Drosophilidae): Evolutionary history of faunal divergence between the Old and the New Worlds. PLoS One. 2016; 11(7): e0160051. doi: 10.1371/journal.pone.0160051 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jeong S, Rebeiz M, Andolfatto P, Werner T, True J, Carroll SB The evolution of gene regulation underlies a morphological difference between two Drosophila sister species. Cell. 2008;132(5): 783–793. doi: 10.1016/j.cell.2008.01.014 [DOI] [PubMed] [Google Scholar]
  19. Koshikawa S, Giorgianni MW, Vaccaro K, Kassner VA, Yoder JH, Werner T, et al. Gain of cis-regulatory activities underlies novel domains of wingless gene expression in Drosophila. Proc Natl Acad Sci U S A. 2015;112(24): 7524–7529. doi: 10.1073/pnas.1509022112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Koshikawa S, Fukutomi Y, Matsumoto K Drosophila guttifera as a model system for unraveling color pattern formation, in: Sekimura T, Nijhout HF (Eds.), Diversity and evolution of butterfly wing patterns: an integrative approach. Singapore: Springer Singapore; 2017. pp. 287–301. doi: 10.1007/978-981-10-4956-9 [DOI] [Google Scholar]
  21. Lamb AM, Wang Z, Simmer P, Chung H, Wittkopp PJ ebony affects pigmentation divergence and cuticular hydrocarbons in Drosophila americana and D. novamexicana. bioRxiv. 2020:2020.2003.2005.977009. doi: 10.1101/2020.03.05.977009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lemonds TR, Liu J, Popadić A The contribution of the melanin pathway to overall body pigmentation during ontogenesis of Periplaneta americana. Insect Sci. 2016;23(4): 513–519. doi: 10.1111/1744-7917.12356 [DOI] [PubMed] [Google Scholar]
  23. Liu J, Lemonds TR, Popadić A The genetic control of aposematic black pigmentation in hemimetabolous insects: insights from Oncopeltus fasciatus. Evol Dev. 2014;16(5): 270–277. doi: 10.1111/ede.12090 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Liu T, Yang W-Q, Xie Y-G, Liu P-W, Xie L-H, Lin F, Li C-Y, Gu J-B, Wu K, Yan G-Y, Chen X-G Construction of an efficient genomic editing system with CRISPR/Cas9 in the vector mosquito Aedes albopictus. Insect Sci. 2019;26: 1045–1054. doi: 10.1111/1744-7917.12645 [DOI] [PubMed] [Google Scholar]
  25. Lu J-B, Zhang M-Q, Li L-C, Zhang C-X DDC plays vital roles in the wing spot formation, egg production, and chorion tanning in the brown planthopper. Arch Insect Biochem. 2019;101(2): e21552. doi: 10.1002/arch.21552 [DOI] [PubMed] [Google Scholar]
  26. Massey JH, Akiyama N, Bien T, Dreisewerd K, Wittkopp PJ, Yew JY, et al. Pleiotropic Effects of ebony and tan on Pigmentation and Cuticular Hydrocarbon Composition in Drosophila melanogaster. Frontiers in Physiology. 2019a;10(518). doi: 10.3389/fphys.2019.00518. doi: 10.3389/fphys.2019.00518 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Massey JH, Chung D, Siwanowicz I, Stern DL, Wittkopp PJ The yellow gene influences Drosophila male mating success through sex comb melanization. ELife. 2019b;8: e49388. doi: 10.7554/eLife.49388 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Matsuoka Y, Monteiro A Melanin pathway genes regulate color and morphology of butterfly wing scales. Cell Rep. 2018;24(1): 56–65. doi: 10.1016/j.celrep.2018.05.092 [DOI] [PubMed] [Google Scholar]
  29. McEwen RS The reactions to light and to gravity in Drosophila and its mutants. J Exp Zool. 1918;25(1): 49–106. doi: 10.1002/jez.1400250103 [DOI] [Google Scholar]
  30. Monteiro A Alternative models for the evolution of eyespots and of serial homology on lepidopteran wings. BioEssays. 2008;30(4): 358–366. doi: 10.1002/bies.20733 [DOI] [PubMed] [Google Scholar]
  31. Monteiro A, Chen BIN, Ramos DM, Oliver JC, Tong X, Guo MIN, et al. Distal-Less regulates eyespot patterns and melanization in Bicyclus butterflies. J Exp Zool Part B. 2013;320(5): 321–331. doi: 10.1002/jez.b.22503 [DOI] [PubMed] [Google Scholar]
  32. Noh MY, Kim SH, Gorman MJ, Kramer KJ, Muthukrishnan S, Arakane Y Yellow-g and Yellow-g2 proteins are required for egg desiccation resistance and temporal pigmentation in the Asian tiger mosquito, Aedes albopictus. Insect Biochem Mol Biol. 2020;103386. doi: 10.1016/j.ibmb.2020.103386 [DOI] [PubMed] [Google Scholar]
  33. Ordway AJ, Hancuch KN, Johnson W, Wiliams TM, Rebeiz M The expansion of body coloration involves coordinated evolution in cis and trans within the pigmentation regulatory network of Drosophila prostipennis. Dev Biol. 2014;392(2): 431–440. doi: 10.1016/j.ydbio.2014.05.023 [DOI] [PubMed] [Google Scholar]
  34. Raff RA Evo-devo: the evolution of a new discipline. Nat Rev Genet 2000;1(1): 74–79. doi: 10.1038/35049594 [DOI] [PubMed] [Google Scholar]
  35. Raja KKB, Shittu MO, Nouhan PME, Steenwinkel TE, Bachman EA, Kokate PP, et al. The regulation of a pigmentation gene in the formation of complex color patterns in Drosophila abdomens. bioRxiv. 2020:2020.04.09.034900. doi: 10.1101/2020.04.09.034900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rebeiz M, Posakony JW GenePalette: a universal software tool for genome sequence visualization and analysis. Dev Biol. 2004;271(2): 431–438. doi: 10.1016/j.ydbio.2004.04.011 [DOI] [PubMed] [Google Scholar]
  37. Rebeiz M, Williams TM Using Drosophila pigmentation traits to study the mechanisms of cis-regulatory evolution. Curr Opin Insect Sci. 2017;19: 1–7. doi: 10.1016/j.cois.2016.10.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Roeske MJ, Camino EM, Grover S, Rebeiz M, Williams TM Cis-regulatory evolution integrated the Bric-à-brac transcription factors into a novel fruit fly gene regulatory network. ELife 7. 2018;7: e32273. doi: 10.7554/eLife.32273 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Scott Chialvo CH, White BE, Reed LK, Dyer KA A phylogenetic examination of host use evolution in the quinaria and testacea groups of Drosophila. Mol. Phylogenet. Evol 2019;130: 233–243. doi: 10.1016/j.ympev.2018.10.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Shittu M, Steenwinkel T, Koshikawa S, Werner T The making of transgenic Drosophila guttifera. Methods Protoc. 2020; 3(2): 31. doi: 10.3390/mps3020031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Spicer GS, Jaenike J Phylogenetic analysis of breeding site use and α-amanitin tolerance within the Drosophila quinaria species group. Evolution. 1996;50(6): 2328–2337. doi: 10.1111/j.1558-5646.1996.tb03620.x [DOI] [PubMed] [Google Scholar]
  42. Sterkel M, Ons S, Oliveira PL DOPA decarboxylase is essential for cuticle tanning in Rhodnius prolixus (Hemiptera: Reduviidae), affecting ecdysis, survival and reproduction. Insect Biochem Mol Biol. 2019;108: 24–31. doi: 10.1016/j.ibmb.2019.03.006 [DOI] [PubMed] [Google Scholar]
  43. True JR, Yeh S-D, Hovemann BT, Kemme T, Meinertzhagen IA, Edwards TN, et al. Drosophila tan encodes a novel hydrolase required in pigmentation and vision. PLoS Genet. 2005;1(5): e63. doi: 10.1371/journal.pgen.0010063 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Walter MF, Zeineh LL, Black BC, McIvor WE, Wright TRF, Biessmann H Catecholamine metabolism and in vitro induction of premature cuticle melanization in wild type and pigmentation mutants of Drosophila melanogaster. Arch Insect Biochem. 1996;31(2): 219–233. doi: [DOI] [PubMed] [Google Scholar]
  45. Werner T, Koshikawa S, Williams TM, Carroll SB Generation of a novel wing colour pattern by the Wingless morphogen. Nature. 2010;464(7292): 1143–1148. doi: 10.1038/nature08896 [DOI] [PubMed] [Google Scholar]
  46. Werner T, Steenwinkel T, Jaenike J Drosophilids of the Midwest and Northeast. Version 2 Houghton, Michigan: J. Robert Van Pelt and John and Ruanne Opie Library, Michigan Technological University; 2018. [Google Scholar]
  47. Wittkopp PJ, Carroll SB, Kopp A Evolution in black and white: genetic control of pigment patterns in Drosophila. Trends Genet. 2003;19(9): 495–504. doi: 10.1016/S0168-9525(03)00194-X [DOI] [PubMed] [Google Scholar]
  48. Wright TRF The genetics of biogenic amine metabolism, sclerotization, and melanization in Drosophila melanogaster. Adv Genet. 1987;24: 127–222. doi: 10.1016/S0065-2660(08)60008-5 [DOI] [PubMed] [Google Scholar]
  49. Wright TR, Bewley GC, Sherald AF The genetics of Dopa decarboxylase in Drosophila melanogaster. II. Isolation and characterization of Dopa-decarboxylase-deficient mutants and their relationship to the alpha-methyl-dopa-hypersensitive mutants. Genetics. 1976;84(2): 287–310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhang L, Martin A, Perry MW, van der Burg KR, Matsuoka Y, Monteiro A Genetic basis of melanin pigmentation in butterfly wings. Genetics. 2017;205(4): 1537–1550. doi: 10.1534/genetics.116.196451 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang L, Reed RD Genome editing in butterflies reveals that spalt promotes and Distal-less represses eyespot colour patterns. Nat Commun. 2016;7: 11769. doi: 10.1038/ncomms11769 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zhang Y, Li H, Du J, Zhang J, Shen J, Cai W Three melanin pathway genes, TH, yellow, and aaNAT, regulate pigmentation in the Twin-Spotted Assassin Bug, Platymeris biguttatus (Linnaeus). Int J Mol Sci. 2019;20(11): 2728. doi: 10.3390/ijms20112728 [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES