Skip to main content
Frontiers in Nutrition logoLink to Frontiers in Nutrition
. 2020 Nov 24;7:589771. doi: 10.3389/fnut.2020.589771

High-Fat Diet Alters the Expression of Reference Genes in Male Mice

Xiuqin Fan 1, Hongyang Yao 1, Xuanyi Liu 1, Qiaoyu Shi 1, Liang Lv 2, Ping Li 1, Rui Wang 1, Tiantian Tang 1, Kemin Qi 1,*
PMCID: PMC7732482  PMID: 33330591

Abstract

Quantitative PCR (qPCR), the most accurate and sensitive technique for quantifying mRNA expression, and choice of appropriate reference genes for internal error controlling in qPCR are essential to understanding the molecular mechanisms that drive the obesity epidemic and its comorbidities. In this study, using the high-fat diet (HFD)-induced obese mouse model, we assessed the expression of 10 commonly used reference genes to validate gene-expression stability in adipose tissue, liver, and muscle across different time points (4, 8, 12, and 16 weeks after HFD feeding) during the process of obesity. The data were analyzed by the GeNorm, NormFinder, BestKeeper, and Delta-Ct method, and the results showed that the most stable reference genes were different for a specific organ or tissue in a specific time point; however, PPIA, RPLP0, and YWHAZ were the top three most stable reference genes in qPCR experiments on adipose, hepatic tissues, and muscles of mice in diet-induced obesity. In addition, the mostly used genes ACTB and GAPDH were more unstable in the fat and liver, the ACTB mRNA levels were increased in four adipose tissues, and the GAPDH mRNA levels were decreased in four adipose tissues and liver after HFD feeding. These results suggest that PPIA, RPLP0, or YWHAZ may be more appropriate to be used as reference gene than ACTB and GAPDH in the adipose tissue and liver of mice during the process of high-fat diet-induced obesity.

Keywords: reference genes, qPCR, obesity, mice, adipose tissue, liver

Introduction

The rapidly increasing prevalence of obesity worldwide and its associated metabolic complications, such as non-alcoholic fatty liver, dyslipidemia, and type 2 diabetes, have become a threat for human health (1, 2). To investigate the underlying mechanisms, a variety of tools and techniques including metabolic, proteomic, transcriptomic, and novel DNA sequencing strategies have been employed, among which quantitative PCR (qPCR) and reverse transcription (RT)-qPCR are the most accurate and sensitive techniques for quantifying mRNA in biological samples and have become accessible to virtually all research labs (3–5). However, there remain a number of problems associated with qPCR use, including variability of sample preparation, extraction and storage, RNA isolation and purification, RT, poor choice of primers, and inappropriate reference targets (3–5). In 2009, the minimum information for the publication of quantitative real-time PCR experiments (MIQE) was published to provide the scientific community with a consistent workflow and key considerations to perform qPCR experiments (4). However, the MIQE standards have not been embraced more widely in practice.

Normalizing to a reference gene, whose expression has to be stable and independent of the experimental conditions, is a key step for internally controlling for error in qPCR (4–6). During the past decades, β-actin (ACTB), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18S ribosomal RNA (18S), ribosomal protein large P0 (RPLP0), and TATA box-binding protein (TBP) have been used extensively as reference genes in physiological status and diseases including obesity (7–10). However, increasing evidence suggests that the expression of reference genes often varies considerably with differences in subjects, animal species, experimental models, disease conditions, tissue types, etc. (11, 12). Therefore, it is essential to validate potential reference genes to establish whether they are appropriate for a specific experimental purpose.

In recent years, several research groups have evaluated stability of reference genes for qPCR in human and mouse adipose tissue by different methods of mathematical algorithms (7, 13–17). However, consistent conclusions have not been reached owing to constant changes in fat accumulation of adipose tissue and associated cell size with the development of obesity, different analyzing methods used, etc.

Therefore, in this study, after reviewing the literature, a total of 10 commonly used reference genes involved in different biological functions, including ACTB, GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT), 18S, RPLP0, beta-2-microglobulin (B2M), TBP, peptidylprolyl isomerase A (PPIA), ubiquitin C (UBC), and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, and zeta polypeptide (YWHAZ), were determined to analyze gene-expression stability in tissues (adipose tissue, liver, and muscle) associated with energy and fat metabolism across different time points during the development of obesity in mice, using the NormFinder (18), GeNorm (11), BestKeeper (19), and Delta-Ct method (20).

Methods and Materials

Animal Procedures

Three- to four-week-old male C57BL/6J mice were purchased from the SPF Laboratory Animal Technology Co., Ltd (Beijing), and were housed at the animal facilities in the National Institute of Occupational Health and Poison Control, China CDC, under a 12-h (h) light 12-h dark cycle with cycles of air ventilation and constant temperature (23°C), with free access to water and food. After 1 week of recovery from transportation, the mice were randomly divided into two groups (n = 32 in each group) and fed with a high-fat diet (HFD) (34.9% fat by wt., 60% kcal) (No. H10060) and a normal-fat diet (NFD) (4.3% fat by wt., 10% kcal) (No. H10010) (Beijing Huafukang Bioscience Co. Inc., Beijing, China) based on formulas of the high-fat diets for DIO mice (D12492) and the paired control diet (D12450B) (Research Diets, New Brunswick, NJ, USA). The fat in both of the diets was from soybean oil and lard oil, and the diet formula was shown in Supplementary Table 1. The diets were sterilized with γ-irradiation 25 kGy and stored at −20°C until use.

Mouse body weight was measured weekly, and food consumption was detected at 4, 8, 12, and 16 weeks after feeding with 7 consecutive days of records. At 4, 8, 12, and 16 weeks after feeding respectively, the 12-h fasted mice (n = 8 in each group) in a fasted state were euthanized by intraperitoneal injection of an overdose of Avertin (500 mg kg−1 of 2,2,2-tribromoethanol, T-4840-2, Sigma-Aldrich Chemie GmbH, Steinheim, Germany) to minimize suffering. After euthanization, the epididymal, perirenal, subcutaneous inguinal fat, subscapular brown adipose tissue, liver, and femoral muscle were immediately dissected free of the surrounding tissue, removed, wrapped in aluminum foil, and frozen in liquid N2 and then were transferred to −80°C until use.

RT-qPCR for Candidate Reference Genes

Total RNA in tissues was prepared using the TRIzol Reagent kit (Invitrogen, Carlsbad, CA, USA). Briefly, 80 mg of epididymal, perirenal, or subcutaneous inguinal fat tissues and 20 mg of subscapular brown adipose tissue, liver, or femoral muscle were homogenized in 1 mL of TRIzol reagent. After centrifugation, RNA was extracted with chloroform and precipitated with isopropyl alcohol, then resuspended in 30-100 μL of DEPC-treated water, and finally its concentration and purity in each sample were determined by a DS-11 Spectrophotometer (DeNovix) (Supplementary Table 2). One microgram of extracted RNA in each sample was used for reverse-transcribed cDNA First-strand (cDNA) synthesis using the All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (TransGen Biotech, Beijing, China) according to the procedures provided by the manufacturer. The mRNA expression of targeted genes including ACTB, GAPDH, 18S, HPRT, RPLP0, B2M, TBP, PPIA, UBC, and YWHAZ was measured by real-time qPCR with a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad) using Top Green qPCR SuperMix (Trans Gen). The oligonucleotide primers for these target genes were from the PrimerBank (https://pga.mgh.harvard.edu/primerbank/), and the published papers (7, 21, 22) were tested for specificity using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome), showing all to be validated with over 90% efficiency in amplification (Table 1). Each reaction was performed in the final volume of 20 μL including 1 μL of cDNA and 200 nM of each primer, with the thermocycle program consisting of an initial hot start cycle at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s, 60°C for 15 s, and 72°C for 10 s. The specificity of the amplification was analyzed by agarose gel electrophoresis (Supplementary Figure 1) and melting curves (Supplementary Figure 2).

Table 1.

Detail of primers used for each of the 10 evaluated reference genes.

Gene symbol Gene name Gene function Primer sequence (5′-3′) Amplicon length (bp) Efficiency (%)
ACTB Actin beta Cytoskeletal structural protein GTGACGTTGACATCCGTAAAGA
GCCGGACTCATCGTACTCC
245 97.0
GAPDH Glyceraldehyde-3-phosphate dehydrogenase Oxidoreductase in glycolysis and gluconeogenesis AGGTCGGTGTGAACGGATTTG
TGTAGACCATGTAGTTGAGGTCA
123 92.1
HPRT Hypoxanthine guanine phosphoribosyl transferase Purine metabolism AAGCTTGCTGGTGAAAAGGA
TTGCGCTCATCTTAGGCTTT
186 98.8
18S 18S ribosomal RNA Ribosome RNA TTGACTCAACACGGGAAACC
AGACAAATCGCTCCACCAAC
121 102.5
RPLP0 Ribosomal protein, large, P0 Ribosomal proteins AGATTCGGGATATGCTGTTGGC
TCGGGTCCTAGACCAGTGTTC
109 92.4
B2M Beta-2 microglobulin Component of MHC class I TTCTGGTGCTTGTCTCACTGA
CAGTATGTTCGGCTTCCCATTC
104 97.7
TBP TATA box-binding protein Transcription factor AGAACAATCCAGACTAGCAGCA
GGGAACTTCACATCACAGCTC
120 95.4
PPIA Peptidylprolyl isomerase A Chaperone GAGCTGTTTGCAGACAAAGTTC
CCCTGGCACATGAATCCTGG
125 90.8
UBC Ubiquitin C Protein degradation AGCCCAGTGTTACCACCAAGAAGG
TCACACCCAAGAACAAGCACAAGGA
101 95.2
YWHAZ Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide Protein kinase C signaling pathway GAAAAGTTCTTGATCCCCAATGC
TGTGACTGGTCCACAATTCCTT
134 97.3

Evaluation of Candidate Reference Genes

Reference gene expression variability was evaluated by a combined analysis of Delta-Ct method, Normfinder, geNorm, and BestKeeper. The Ct (cycle threshold) is defined as the number of cycles required for the fluorescent signal to cross the threshold (i.e., exceeds background level). Ct levels are inversely proportional to the amount of target nucleic acid in the sample (i.e., the lower the Ct level the greater the amount of target nucleic acid in the sample). Ct is specific to the expression of one gene whereas Delta Ct shows the difference of expression between two genes. This Delta-Ct method generated “pair of genes” comparisons between each candidate reference genes and the other candidate reference genes within each sample and calculated the average standard deviation (SD) against the other candidate reference genes (20). The NormFinder algorithm directly and robustly estimates candidate normalization gene expression stability and ranks reference genes depending on the variation within the intra- and the inter-group. As Andersen mentioned in his report, the NormFinder procedure focuses on differences between sample subgroups, and the result is less affected by the correlated expression of the reference genes (18). In 2002, Vandesompele et al. have developed the software GeNorm that evaluates the most stable pair of reference genes by the M value, which is calculated from the arithmetic mean of pair-wise variations of each gene, a low M value represented stable gene expression (11). BestKeeper calculates the expression variability of reference genes based on the SD, and the coefficient of variance (CV) takes into account Ct values of candidate reference genes instead of relative quantities (19). The genes with the lowest SD and CV were treated as the most stable reference genes, and reference genes with SD > 1 were excluded (19). Following these four analyses, each candidate reference gene obtained a specific ranking value. A consensual analysis was finally performed by the calculation of the geometric mean of the four ranking values for each gene leading to a consensus variability score for each reference gene.

Statistical Analysis

All statistical analyses were conducted by SPSS 21.0. The Kolmogorov–Smirnov test was used to evaluate whether the data is normally distributed. We used the unpaired t-test for the normally distributed data and the Mann–Whitney U-test for the non-normally distributed data to calculate the difference between the NFD group and the HFD group, where P < 0.05 was considered statistically significant.

Results

Changes in Body Weight During the Development of Obesity

As shown in Figure 1, mouse body weight was significantly increased in the HFD group with more calories to intake, compared to the NFD group after feeding for 4, 8, 12, or 16 weeks (P < 0.05).

Figure 1.

Figure 1

Changes in body weight and daily caloric intake during the development of obesity. Three- to four-week-old C57BL/6J male mice were fed a high-fat diet (HFD) for 4–16 weeks, with a normal-fat diet (NFD) as a control. (A) Body weight; (B) caloric intake. Data are shown as the means ± SD. **Compared to the NFD group, P < 0.01; ***compared to the NFD group, P < 0.005.

Stability Analysis of Candidate Reference Genes

Figure 2 shows the profile and distribution of Ct values for the 10 candidate reference genes in different tissues. For each reference gene, similar expressional profiles were shown across samples in all types of tissues. However, a wide difference in expression levels was found among the 10 references, with the Ct values ranging from 8.47 ± 0.80 to 27.05 ± 1.02. The highest abundance gene was 18S RNA, which was significantly different from the others, whose abundance was in an increasing trend with B2M > GAPDH > PPIA > ACTB > RPLP0 > UBC > HPRT > YWHAZ > TBP. Meanwhile, some genes had a wide range in expression, e.g., B2M, GAPDH, ACTB, and UBC, indicating a higher variability, whereas others were in a narrow range, e.g., PPIA, RPLP0, and TBP, indicating more stably expressed.

Figure 2.

Figure 2

Distribution of Ct values for reference genes. Three- to four-week-old C57BL/6J male mice were fed a high-fat diet (HFD), with a normal-fat diet (NFD) as a control. At 4, 8, 12, and 16 weeks after feeding, mice were sacrificed respectively, and organs and tissues were dissected. The mRNA expression of reference genes was examined by RT-qPCR and their Ct values were analyzed by averaging the data in both groups of mice from the four time points. The boxes indicate the 25th and 75th percentiles, and the line across the box is the media, and whiskers correspond to the minimum and maximum values. (A) epididymal fat; (B) perirenal fat; (C) inguinal subcutaneous fat; (D) subscapular brown adipose tissue; (E) liver; (F) femoral muscle; (G) average for all types of tissues.

To determine the ranking of the reference genes in tissues at different time points, the 10 candidate genes were analyzed by the geNorm and NormFinder algorithms, the comparative Delta-Ct method, and the BestKeeper software tool and further were calculated to identify stably expressed genes between the NFD group and the HFD group.

In the epididymal fat, as shown in Table 2, the identified set of four reference genes included PPIA, YWHAZ, RPLP0, and 18S after 4 weeks' feeding intervention. The optimal set of reference genes after 8 weeks' feeding appeared to be RPLP0, HPRT, B2M, and PPIA. The genes RPLP0, PPIA, B2M, and YWHAZ were represented a good choice as reference genes after 12 weeks' feeding. After 16 weeks' feeding, the best four reference genes were RPLP0, PPIA, HPRT, and YWHAZ. Furthermore, to assess the overall stability of each gene during the development of obesity, the data at the four time points were included in the analysis, and the result showed that PPIA, RPLP0, and YWHAZ were more stable in expression. In the perirenal fat, the calculation of the geometric mean from the NormFinder, GeNorm, BestKeeper, and Delta-Ct indentified RPLP0, PPIA, YWHAZ, ACTB, 18S, B2M, and TBP as more stably expressed at 4, 8, 12, or 16 weeks. Still, PPIA, RPLP0, and YWHAZ were shown as more stably expressed genes if all four time points were included for analysis (Table 3). In the inguinal fat, PPIA, TBP, YWHAZ, HPRT, RPLP0, and B2M were identified as more stably expressed at 4, 8, 12, or 16 weeks, and the expression of PPIA TBP and RPLP0 was indicated more stable with data from all four points analyzed (Table 4). In brown adipose tissue, PPIA, TBP, RPLP0, YWHAZ, and HRPT were more stably expressed at 4, 8, 12, or 16 weeks, and similar to the inguinal fat, RPLP0, TBP, and PPIA represented the best set of reference genes with all four time points considered (Table 5).

Table 2.

Analysis of reference gene expression variability in the epididymal fat during the development of obesity.

NormFinder GeNorm BestKeeper Delta-Ct Consensus
Genes Stability value Genes Stability value Genes SD Genes SD Genes Geometric mean of ranking values
4 w
NFD/HFD (n = 8/8)
RPLP0 0.135 PPIA 0.244 PPIA 0.260 YWHAZ 0.429 PPIA 1.57
PPIA 0.139 YWHAZ 0.244 18S 0.286 RPLP0 0.430 YWHAZ 2.34
ACTB 0.154 18S 0.259 YWHAZ 0.305 PPIA 0.430 RPLP0 2.66
B2M 0.168 ACTB 0.298 ACTB 0.321 ACTB 0.467 18S 3.66
YWHAZ 0.183 RPLP0 0.311 RPLP0 0.366 18S 0.509 ACTB 3.72
18S 0.233 B2M 0.333 B2M 0.419 B2M 0.514 B2M 5.42
HPRT 0.308 TBP 0.381 TBP 0.466 GAPDH 0.562 TBP 7.48
TBP 0.372 GAPDH 0.409 GAPDH 0.500 TBP 0.566 GAPDH 7.97
GAPDH 0.438 HPRT 0.477 HPRT 0.530 HPRT 0.667 HPRT 8.45
UBC 0.452 UBC 0.575 UBC 0.767 UBC 0.882 UBC 10.00
8 w
NFD/HFD (n = 8/8)
B2M 0.074 RPLP0 0.172 YWHAZ 0.163 RPLP0 0.309 RPLP0 2.00
RPLP0 0.090 HPRT 0.172 18S 0.219 HPRT 0.321 HPRT 2.99
PPIA 0.140 B2M 0.180 TBP 0.221 PPIA 0.335 B2M 3.03
HPRT 0.149 TBP 0.202 PPIA 0.228 B2M 0.344 PPIA 3.83
TBP 0.199 ACTB 0.223 HPRT 0.230 ACTB 0.345 YWHAZ 4.14
YWHAZ 0.245 PPIA 0.236 ACTB 0.263 TBP 0.380 TBP 4.36
ACTB 0.247 YWHAZ 0.247 B2M 0.265 YWHAZ 0.401 ACTB 5.69
GAPDH 0.274 18S 0.275 RPLP0 0.287 GAPDH 0.421 18S 6.00
18S 0.420 GAPDH 0.305 GAPDH 0.381 18S 0.495 GAPDH 8.49
UBC 0.942 UBC 0.472 UBC 1.030 UBC 0.985 UBC 10.00
12 w
NFD/HFD (n = 8/8)
PPIA 0.065 RPLP0 0.168 B2M 0.176 PPIA 0.313 RPLP0 1.68
RPLP0 0.083 B2M 0.168 RPLP0 0.212 RPLP0 0.321 PPIA 1.86
B2M 0.095 PPIA 0.198 18S 0.213 B2M 0.326 B2M 2.06
YWHAZ 0.155 YWHAZ 0.220 PPIA 0.275 YWHAZ 0.379 YWHAZ 4.43
HPRT 0.188 HPRT 0.250 GAPDH 0.281 GAPDH 0.382 18S 5.42
18S 0.208 18S 0.272 YWHAZ 0.306 ACTB 0.385 HPRT 5.92
GAPDH 0.267 GAPDH 0.297 HPRT 0.330 HPRT 0.405 GAPDH 5.92
ACTB 0.282 TBP 0.313 ACTB 0.343 18S 0.416 ACTB 7.67
TBP 0.321 ACTB 0.328 TBP 0.358 TBP 0.451 TBP 8.74
UBC 0.376 UBC 0.445 UBC 0.636 UBC 0.788 UBC 10.00
16 w
NFD/HFD (n = 8/8)
RPLP0 0.083 PPIA 0.152 TBP 0.146 PPIA 0.323 RPLP0 2.00
HPRT 0.098 HPRT 0.152 RPLP0 0.230 RPLP0 0.351 PPIA 2.11
B2M 0.112 B2M 0.194 GAPDH 0.253 YWHAZ 0.356 HPRT 3.36
YWHAZ 0.125 RPLP0 0.232 PPIA 0.282 HPRT 0.364 YWHAZ 4.16
PPIA 0.133 YWHAZ 0.244 YWHAZ 0.287 B2M 0.365 B2M 4.21
18S 0.141 TBP 0.274 18S 0.298 GAPDH 0.402 TBP 4.28
TBP 0.221 GAPDH 0.291 B2M 0.350 18S 0.407 GAPDH 5.63
GAPDH 0.285 18S 0.303 HPRT 0.365 TBP 0.408 18S 6.70
UBC 0.330 ACTB 0.342 ACTB 0.567 ACTB 0.491 ACTB 9.24
ACTB 0.384 UBC 0.439 UBC 0.662 UBC 0.817 UBC 9.74
All
NFD/HFD (n = 32/32)
PPIA 0.041 B2M 0.286 PPIA 0.293 RPLP0 0.488 PPIA 2.14
RPLP0 0.047 ACTB 0.286 YWHAZ 0.324 YWHAZ 0.505 RPLP0 2.38
YWHAZ 0.093 18S 0.343 HPRT 0.408 PPIA 0.542 YWHAZ 2.91
B2M 0.111 RPLP0 0.358 RPLP0 0.527 ACTB 0.563 B2M 3.83
HPRT 0.160 TBP 0.383 TBP 0.553 HPRT 0.568 HPRT 5.10
TBP 0.213 YWHAZ 0.407 18S 0.561 B2M 0.598 ACTB 5.63
18S 0.220 PPIA 0.421 ACTB 0.587 GAPDH 0.599 18S 5.80
ACTB 0.231 GAPDH 0.439 GAPDH 0.619 TBP 0.611 TBP 5.89
GAPDH 0.291 HPRT 0.465 B2M 0.621 18S 0.623 GAPDH 7.97
UBC 0.372 UBC 0.742 UBC 1.366 UBC 1.508 UBC 10.00

NFD, normal-fat diet; HFD, high-fat diet; All, all four points (4 w, 8 w, 12 w, 16 w); SD, standard deviation. Gene names indicated in bold are the most appropriate selection of 4 reference genes for all comparisons.

Table 3.

Analysis of reference gene expression variability in the perirenal fat during the development of obesity.

NormFinder GeNorm BestKeeper Delta-Ct Consensus
Genes Stability value Genes Stability value Genes SD Genes SD Genes Geometric mean of ranking values
4 w
NFD/HFD (n = 8/8)
PPIA 0.054 TBP 0.179 18S 0.544 RPLP0 0.344 RPLP0 2.55
RPLP0 0.110 YWHAZ 0.179 ACTB 0.577 PPIA 0.350 PPIA 2.83
YWHAZ 0.119 RPLP0 0.200 B2M 0.589 ACTB 0.378 YWHAZ 3.13
B2M 0.149 PPIA 0.224 YWHAZ 0.601 YWHAZ 0.388 ACTB 3.50
ACTB 0.197 ACTB 0.255 TBP 0.632 TBP 0.431 TBP 3.50
TBP 0.210 HPRT 0.282 HPRT 0.670 HPRT 0.434 18S 4.76
HPRT 0.225 B2M 0.305 RPLP0 0.673 B2M 0.479 B2M 4.92
18S 0.266 18S 0.323 PPIA 0.683 18S 0.508 HPRT 6.24
GAPDH 0.415 GAPDH 0.397 GAPDH 0.986 GAPDH 0.617 GAPDH 9.00
UBC 0.446 UBC 0.527 UBC 1.234 UBC 0.936 UBC 10.00
8 w
NFD/HFD (n = 8/8)
RPLP0 0.095 RPLP0 0.242 18S 0.481 PPIA 0.404 RPLP0 2.00
PPIA 0.134 PPIA 0.242 YWHAZ 0.537 RPLP0 0.416 PPIA 2.30
YWHAZ 0.140 YWHAZ 0.289 ACTB 0.565 ACTB 0.470 YWHAZ 2.91
B2M 0.221 18S 0.297 HPRT 0.574 YWHAZ 0.474 18S 3.31
18S 0.251 HPRT 0.332 B2M 0.591 HPRT 0.486 ACTB 4.56
TBP 0.306 ACTB 0.347 TBP 0.604 18S 0.491 HPRT 5.14
HPRT 0.319 B2M 0.374 PPIA 0.608 TBP 0.526 B2M 5.79
ACTB 0.397 TBP 0.397 RPLP0 0.634 B2M 0.545 TBP 6.70
UBC 0.424 GAPDH 0.483 GAPDH 0.751 GAPDH 0.717 GAPDH 9.24
GAPDH 0.642 UBC 0.582 UBC 1.053 UBC 0.871 UBC 9.74
12 w
NFD/HFD (n = 8/8)
RPLP0 0.073 PPIA 0.102 TBP 0.401 PPIA 0.332 PPIA 1.97
B2M 0.082 B2M 0.102 18S 0.402 RPLP0 0.388 RPLP0 2.06
PPIA 0.104 RPLP0 0.158 RPLP0 0.483 B2M 0.402 B2M 2.63
YWHAZ 0.215 HPRT 0.235 B2M 0.483 YWHAZ 0.470 TBP 3.94
18S 0.217 YWHAZ 0.278 PPIA 0.484 TBP 0.506 YWHAZ 4.68
TBP 0.294 ACTB 0.318 YWHAZ 0.533 HPRT 0.506 18S 4.86
HPRT 0.344 18S 0.357 GAPDH 0.533 ACTB 0.515 HPRT 6.05
UBC 0.454 TBP 0.386 HPRT 0.593 18S 0.540 ACTB 7.61
ACTB 0.475 GAPDH 0.462 UBC 0.697 GAPDH 0.608 GAPDH 8.68
GAPDH 0.600 UBC 0.550 ACTB 0.757 UBC 0.780 UBC 9.49
16 w
NFD/HFD (n = 8/8)
PPIA 0.076 PPIA 0.196 TBP 0.661 PPIA 0.477 PPIA 1.57
B2M 0.106 YWHAZ 0.196 18S 0.807 RPLP0 0.515 RPLP0 3.08
RPLP0 0.170 RPLP0 0.239 GAPDH 0.887 YWHAZ 0.526 YWHAZ 3.13
YWHAZ 0.228 B2M 0.301 YWHAZ 0.931 HPRT 0.546 B2M 4.09
HPRT 0.252 HPRT 0.333 RPLP0 0.985 B2M 0.584 TBP 4.28
18S 0.531 TBP 0.411 PPIA 0.988 GAPDH 0.690 18S 5.09
GAPDH 0.572 18S 0.454 B2M 1.030 TBP 0.749 HPRT 5.32
TBP 0.595 GAPDH 0.487 HPRT 1.134 18S 0.767 GAPDH 5.63
ACTB 0.597 ACTB 0.561 ACTB 1.464 ACTB 0.787 ACTB 9.00
UBC 1.033 UBC 0.762 UBC 1.822 UBC 1.347 UBC 10.00
All
NFD/HFD (n = 32/32)
RPLP0 0.075 PPIA 0.294 TBP 0.637 RPLP0 0.503 RPLP0 1.86
PPIA 0.077 YWHAZ 0.294 18S 0.688 PPIA 0.505 PPIA 2.21
YWHAZ 0.096 HPRT 0.344 RPLP0 0.728 HPRT 0.544 YWHAZ 3.13
B2M 0.102 RPLP0 0.389 YWHAZ 0.749 YWHAZ 0.561 TBP 3.98
18S 0.122 B2M 0.419 B2M 0.771 B2M 0.606 HPRT 4.41
HPRT 0.251 TBP 0.449 PPIA 0.799 TBP 0.635 18S 4.70
TBP 0.329 18S 0.465 HPRT 0.806 18S 0.663 B2M 4.73
ACTB 0.406 ACTB 0.513 GAPDH 0.815 ACTB 0.681 ACTB 8.24
UBC 0.421 GAPDH 0.559 ACTB 0.868 GAPDH 0.694 GAPDH 8.97
GAPDH 0.534 UBC 0.714 UBC 1.368 UBC 1.162 UBC 9.74

NFD, normal-fat diet; HFD, high-fat diet; All, all four points (4 w, 8 w, 12 w, 16 w); SD, standard deviation. Gene names indicated in bold are the most appropriate selection of 4 reference genes for all comparisons.

Table 4.

Analysis of reference gene expression variability in the subcutaneous inguinal fat during the development of obesity.

NormFinder GeNorm BestKeeper Delta-Ct Consensus
Genes Stability value Genes Stability value Genes SD Genes SD Genes Geometric mean of ranking values
4 w
NFD/HFD (n = 8/8)
TBP 0.066 PPIA 0.175 18S 0.413 YWHAZ 0.389 PPIA 2.55
PPIA 0.123 YWHAZ 0.175 UBC 0.659 HPRT 0.396 TBP 2.78
RPLP0 0.130 RPLP0 0.185 TBP 0.724 PPIA 0.399 YWHAZ 3.08
HPRT 0.167 TBP 0.204 HPRT 0.737 RPLP0 0.401 HPRT 3.56
YWHAZ 0.206 HPRT 0.237 B2M 0.786 TBP 0.404 RPLP0 4.12
ACTB 0.260 B2M 0.260 ACTB 0.797 B2M 0.501 18S 5.62
B2M 0.292 ACTB 0.295 PPIA 0.822 ACTB 0.519 B2M 5.96
UBC 0.496 GAPDH 0.368 RPLP0 0.853 GAPDH 0.680 UBC 6.00
GAPDH 0.615 UBC 0.462 YWHAZ 0.857 UBC 0.692 ACTB 6.48
18S 0.777 18S 0.558 GAPDH 1.086 18S 0.941 GAPDH 8.71
8 w
NFD/HFD (n = 8/8)
PPIA 0.107 RPLP0 0.159 18S 0.212 PPIA 0.322 PPIA 1.68
TBP 0.123 YWHAZ 0.159 PPIA 0.363 YWHAZ 0.409 RPLP0 3.31
HPRT 0.198 TBP 0.249 B2M 0.385 HPRT 0.424 TBP 3.31
YWHAZ 0.214 PPIA 0.303 TBP 0.388 RPLP0 0.426 YWHAZ 3.46
RPLP0 0.221 HPRT 0.332 HPRT 0.456 TBP 0.433 HPRT 3.87
UBC 0.264 B2M 0.352 RPLP0 0.514 B2M 0.477 18S 4.60
B2M 0.271 18S 0.384 GAPDH 0.523 UBC 0.517 B2M 5.24
18S 0.306 UBC 0.415 UBC 0.523 18S 0.538 UBC 7.20
ACTB 0.428 ACTB 0.456 YWHAZ 0.547 ACTB 0.557 GAPDH 9.15
GAPDH 0.467 GAPDH 0.510 ACTB 0.735 GAPDH 0.608 ACTB 9.24
12 w
NFD/HFD (n = 8/8)
HRRT 0.120 RPLP0 0.433 GAPDH 0.772 HRRT 0.629 HRRT 1.86
PPIA 0.239 HPRT 0.433 B2M 0.776 PPIA 0.645 PPIA 2.45
B2M 0.289 PPIA 0.492 PPIA 0.805 RPLP0 0.666 RPLP0 3.03
RPLP0 0.331 B2M 0.516 YWHAZ 0.857 ACTB 0.719 B2M 3.46
YWHAZ 0.354 ACTB 0.558 TBP 0.866 YWHAZ 0.726 YWHAZ 5.14
18S 0.386 18S 0.584 HRRT 0.944 B2M 0.743 GAPDH 5.20
ACTB 0.448 YWHAZ 0.603 RPLP0 0.976 TBP 0.805 ACTB 5.79
TBP 0.505 TBP 0.629 ACTB 1.053 18S 0.807 TBP 6.88
GAPDH 0.754 GAPDH 0.670 18S 1.054 GAPDH 0.879 18S 7.14
UBC 1.015 UBC 0.869 UBC 2.011 UBC 1.478 UBC 10.00
16 w
NFD/HFD (n = 8/8)
PPIA 0.099 B2M 0.174 18S 0.326 PPIA 0.403 PPIA 2.11
RPLP0 0.195 HPRT 0.174 GAPDH 0.502 YWHAZ 0.467 RPLP0 3.08
YWHAZ 0.205 YWHAZ 0.255 RPLP0 0.631 RPLP0 0.470 YWHAZ 3.22
TBP 0.228 PPIA 0.296 TBP 0.720 HPRT 0.472 HPRT 4.23
HPRT 0.283 RPLP0 0.331 PPIA 0.759 TBP 0.488 B2M 4.24
B2M 0.363 TBP 0.344 YWHAZ 0.829 B2M 0.538 TBP 4.68
UBC 0.412 ACTB 0.401 UBC 0.963 ACTB 0.598 18S 5.33
ACTB 0.541 GAPDH 0.475 HPRT 0.967 GAPDH 0.621 GAPDH 5.83
GAPDH 0.552 18S 0.533 B2M 1.008 18S 0.768 ACTB 7.91
18S 0.572 UBC 0.588 ACTB 1.180 UBC 0.776 UBC 8.37
All
NFD/HFD (n = 32/32)
PPIA 0.085 PPIA 0.358 TBP 0.710 PPIA 0.563 PPIA 1.19
B2M 0.112 TBP 0.358 PPIA 0.730 RPLP0 0.651 TBP 2.45
RPLP0 0.135 RPLP0 0.408 18S 0.730 TBP 0.681 RPLP0 2.91
HPRT 0.144 HPRT 0.485 RPLP0 0.798 HPRT 0.682 B2M 4.16
YWHAZ 0.176 B2M 0.530 B2M 0.801 ACTB 0.708 HPRT 4.60
TBP 0.193 ACTB 0.567 GAPDH 0.833 B2M 0.739 18S 6.59
18S 0.263 YWHAZ 0.619 HPRT 0.860 YWHAZ 0.802 YWHAZ 6.65
ACTB 0.368 GAPDH 0.680 YWHAZ 0.901 GAPDH 0.843 ACTB 6.82
UBC 0.471 18S 0.762 ACTB 0.980 UBC 1.015 GAPDH 7.87
GAPDH 0.575 UBC 0.832 UBC 1.068 18S 1.072 UBC 9.49

NFD, normal-fat diet; HFD, high-fat diet; All, all four points (4 w, 8 w, 12 w, 16 w); SD, standard deviation. Gene names indicated in bold are the most appropriate selection of 4 reference genes for all comparisons.

Table 5.

Analysis of reference gene expression variability in the brown adipose tissue during the development of obesity.

NormFinder GeNorm BestKeeper Delta-Ct Consensus
Genes Stability value Genes Stability value Genes SD Genes SD Genes Geometric mean of ranking values
4 w
NFD/HFD (n = 8/8)
PPIA 0.056 PPIA 0.136 PPIA 0.120 PPIA 0.266 PPIA 1.00
RPLP0 0.095 TBP 0.136 TBP 0.139 TBP 0.288 TBP 2.38
YWHAZ 0.123 ACTB 0.165 RPLP0 0.149 YWHAZ 0.304 RPLP0 3.13
TBP 0.124 RPLP0 0.180 ACTB 0.152 RPLP0 0.323 YWHAZ 4.24
ACTB 0.194 18S 0.201 18S 0.165 ACTB 0.323 ACTB 4.36
18S 0.195 YWHAZ 0.219 YWHAZ 0.237 18S 0.336 18S 5.23
UBC 0.210 UBC 0.262 UBC 0.283 UBC 0.388 UBC 7.00
HPRT 0.221 HPRT 0.296 B2M 0.319 HPRT 0.426 HPRT 8.24
B2M 0.222 B2M 0.326 HPRT 0.337 B2M 0.440 B2M 8.74
GAPDH 0.362 GAPDH 0.366 GAPDH 0.426 GAPDH 0.527 GAPDH 10.00
8 w
NFD/HFD (n = 8/8)
PPIA 0.073 PPIA 0.187 PPIA 0.152 YWHAZ 0.295 PPIA 1.19
YWHAZ 0.082 TBP 0.187 RPLP0 0.181 PPIA 0.311 YWHAZ 2.38
RPLP0 0.092 RPLP0 0.189 HPRT 0.181 HPRT 0.321 RPLP0 2.91
HPRT 0.139 YWHAZ 0.216 YWHAZ 0.184 RPLP0 0.335 HPRT 3.66
TBP 0.145 HPRT 0.239 18S 0.206 TBP 0.363 TBP 4.33
B2M 0.189 GAPDH 0.262 B2M 0.207 GAPDH 0.408 B2M 6.70
18S 0.211 ACTB 0.288 TBP 0.207 B2M 0.408 GAPDH 7.14
GAPDH 0.249 B2M 0.305 ACTB 0.211 ACTB 0.426 18S 7.30
ACTB 0.267 18S 0.332 GAPDH 0.294 18S 0.466 ACTB 7.97
UBC 0.332 UBC 0.419 UBC 0.492 UBC 0.714 UBC 10.00
12 w
NFD/HFD (n = 8/8)
RPLP0 0.079 RPLP0 0.209 PPIA 0.119 YWHAZ 0.281 RPLP0 1.41
YWHAZ 0.109 TBP 0.209 RPLP0 0.138 RPLP0 0.284 PPIA 2.45
PPIA 0.119 18S 0.218 HPRT 0.150 PPIA 0.296 YWHAZ 2.63
HPRT 0.127 PPIA 0.236 YWHAZ 0.165 HPRT 0.297 HPRT 3.94
18S 0.153 HPRT 0.252 18S 0.180 TBP 0.323 TBP 4.36
TBP 0.189 YWHAZ 0.262 TBP 0.185 18S 0.340 18S 4.61
B2M 0.198 ACTB 0.275 ACTB 0.198 B2M 0.352 B2M 7.48
ACTB 0.280 B2M 0.287 B2M 0.229 ACTB 0.367 ACTB 7.48
UBC 0.308 UBC 0.324 GAPDH 0.361 UBC 0.427 UBC 9.24
GAPDH 0.362 GAPDH 0.354 UBC 0.377 GAPDH 0.473 GAPDH 9.74
16 w
NFD/HFD (n = 8/8)
RPLP0 0.036 RPLP0 0.151 RPLP0 0.090 RPLP0 0.314 RPLP0 1.00
YWHAZ 0.106 HPRT 0.151 YWHAZ 0.117 YWHAZ 0.317 YWHAZ 2.00
HPRT 0.111 HPRT 0.176 HPRT 0.120 HPRT 0.320 HPRT 3.00
PPIA 0.113 PPIA 0.187 PPIA 0.138 PPIA 0.347 PPIA 4.00
18S 0.130 TBP 0.227 TBP 0.188 TBP 0.398 TBP 5.44
B2M 0.200 18S 0.261 18S 0.200 18S 0.413 18S 5.73
TBP 0.227 ACTB 0.297 B2M 0.250 ACTB 0.462 B2M 7.20
UBC 0.291 B2M 0.323 ACTB 0.296 B2M 0.468 ACTB 7.71
ACTB 0.322 GAPDH 0.367 GAPDH 0.360 GAPDH 0.547 GAPDH 9.24
GAPDH 0.408 UBC 0.430 UBC 0.465 UBC 0.669 UBC 9.46
All
NFD/HFD (n = 32/32)
RPLP0 0.062 RPLP0 0.236 RPLP0 0.152 RPLP0 0.427 RPLP0 1.00
PPIA 0.080 TBP 0.236 18S 0.193 PPIA 0.442 TBP 3.22
YWHAZ 0.107 ACTB 0.288 TBP 0.215 TBP 0.461 PPIA 3.60
HPRT 0.146 18S 0.329 ACTB 0.243 YWHAZ 0.466 18S 4.23
18S 0.149 B2M 0.370 B2M 0.324 HPRT 0.477 ACTB 5.05
TBP 0.155 PPIA 0.407 GAPDH 0.403 ACTB 0.495 YWHAZ 5.09
B2M 0.156 YWHAZ 0.423 PPIA 0.423 B2M 0.500 B2M 5.92
UBC 0.253 HPRT 0.435 YWHAZ 0.423 18S 0.523 HPRT 6.16
ACTB 0.259 GAPDH 0.467 HPRT 0.445 GAPDH 0.604 GAPDH 8.35
GAPDH 0.347 UBC 0.525 UBC 0.627 UBC 0.732 UBC 9.46

NFD, normal-fat diet; HFD, high-fat diet; All, all four points (4 w, 8 w, 12 w, 16 w); SD, standard deviation. Gene names indicated in bold are the most appropriate selection of 4 reference genes for all comparisons.

In the liver, as shown in Table 6, the more stable reference genes were B2M, RPLP0, PPIA, and ACTB at 4 weeks, HRPT, PPIA, YWHAZ, and RPLP0 at 8 weeks, PPIA, RPLP0, HRPT, and TBP at 12 weeks, and YWHAZ, RPLP0, PPIA, and HRPT at 16 weeks. The expressions of HRPT, YWHAZ, and RPLP0 were identified to be more stable for all the four time points.

Table 6.

Analysis of reference gene expression variability in the liver during the development of obesity.

NormFinder GeNorm BestKeeper Delta-Ct Consensus
Genes Stability value Genes Stability value Genes SD Genes SD Genes Geometric mean of ranking values
4 w
NFD/HFD (n = 8/8)
B2M 0.047 PPIA 0.179 18S 0.255 RPLP0 0.299 B2M 2.00
RPLP0 0.052 B2M 0.179 B2M 0.353 PPIA 0.328 RPLP0 2.21
YWHAZ 0.059 RPLP0 0.183 TBP 0.377 ACTB 0.340 PPIA 2.66
ACTB 0.075 YWHAZ 0.198 RPLP0 0.383 B2M 0.347 ACTB 4.36
PPIA 0.079 ACTB 0.205 PPIA 0.453 YWHAZ 0.356 YWHAZ 4.68
HPRT 0.107 TBP 0.223 ACTB 0.457 TBP 0.406 18S 5.20
TBP 0.110 GAPDH 0.238 GAPDH 0.462 HPRT 0.417 TBP 5.24
GAPDH 0.142 HPRT 0.259 YWHAZ 0.502 GAPDH 0.423 HPRT 7.42
18S 0.234 18S 0.345 HPRT 0.529 18S 0.716 GAPDH 7.48
UBC 0.334 UBC 0.470 UBC 1.061 UBC 0.874 UBC 10.00
8 w
NFD/HFD (n = 8/8)
YWHAZ 0.047 PPIA 0.116 18S 0.372 HPRT 0.328 HPRT 2.21
PPIA 0.052 HPRT 0.116 TBP 0.397 RPLP0 0.343 PPIA 2.55
HPRT 0.066 YWHAZ 0.136 B2M 0.438 PPIA 0.351 YWHAZ 3.31
RPLP0 0.079 RPLP0 0.168 HPRT 0.474 ACTB 0.365 RPLP0 3.72
ACTB 0.165 GAPDH 0.192 ACTB 0.478 YWHAZ 0.371 ACTB 4.95
GAPDH 0.179 ACTB 0.207 RPLP0 0.498 B2M 0.412 18S 5.20
B2M 0.196 B2M 0.219 PPIA 0.510 GAPDH 0.429 B2M 5.45
TBP 0.307 TBP 0.255 YWHAZ 0.541 TBP 0.505 TBP 5.66
18S 0.553 18S 0.312 GAPDH 0.604 18S 0.650 GAPDH 6.59
UBC 0.844 UBC 0.539 UBC 1.377 UBC 1.258 UBC 10.00
12 w
NFD/HFD (n = 8/8)
PPIA 0.056 PPIA 0.140 18S 0.170 RPLP0 0.316 PPIA 1.86
B2M 0.082 HPRT 0.140 YWHAZ 0.295 PPIA 0.321 RPLP0 3.08
RPLP0 0.095 TBP 0.154 HPRT 0.308 HPRT 0.328 HPRT 3.22
TBP 0.117 YWHAZ 0.169 TBP 0.323 TBP 0.328 TBP 3.72
ACTB 0.137 B2M 0.180 RPLP0 0.360 B2M 0.332 YWHAZ 4.28
HPRT 0.142 RPLP0 0.202 PPIA 0.395 YWHAZ 0.337 B2M 4.33
YWHAZ 0.148 ACTB 0.227 B2M 0.396 ACTB 0.365 18S 5.20
GAPDH 0.280 GAPDH 0.255 ACTB 0.426 GAPDH 0.429 ACTB 6.65
18S 0.580 18S 0.328 GAPDH 0.561 18S 0.661 GAPDH 8.24
UBC 0.637 UBC 0.439 UBC 0.939 UBC 0.796 UBC 10.00
16 w
NFD/HFD (n = 8/8)
PPIA 0.064 RPLP0 0.045 HPRT 0.466 YWHAZ 0.278 YWHAZ 2.000
YWHAZ 0.065 YWHAZ 0.045 TBP 0.471 RPLP0 0.283 RPLP0 2.340
RPLP0 0.085 PPIA 0.097 B2M 0.473 PPIA 0.294 PPIA 2.913
B2M 0.156 HPRT 0.146 YWHAZ 0.576 HPRT 0.330 HPRT 2.991
HPRT 0.175 B2M 0.174 RPLP0 0.585 B2M 0.340 B2M 4.162
TBP 0.239 TBP 0.191 18S 0.603 TBP 0.354 TBP 4.559
ACTB 0.272 ACTB 0.214 ACTB 0.619 ACTB 0.374 ACTB 7.000
18S 0.279 18S 0.232 PPIA 0.620 18S 0.391 18S 7.445
GAPDH 0.318 GAPDH 0.276 GAPDH 0.677 GAPDH 0.455 GAPDH 9.000
UBC 0.633 UBC 0.399 UBC 1.183 UBC 0.887 UBC 10.000
All
NFD/HFD (n = 32/32)
RPLP0 0.032 YWHAZ 0.195 TBP 0.480 HPRT 0.430 HPRT 2.21
PPIA 0.033 HPRT 0.195 HPRT 0.502 RPLP0 0.440 YWHAZ 2.59
B2M 0.103 B2M 0.258 YWHAZ 0.514 YWHAZ 0.440 RPLP0 3.25
ACTB 0.105 TBP 0.271 B2M 0.549 PPIA 0.475 TBP 3.74
YWHAZ 0.109 PPIA 0.295 18S 0.589 ACTB 0.481 B2M 3.83
HPRT 0.156 ACTB 0.311 PPIA 0.614 B2M 0.509 PPIA 3.94
TBP 0.161 RPLP0 0.319 ACTB 0.657 TBP 0.538 ACTB 5.38
GAPDH 0.240 GAPDH 0.333 RPLP0 0.663 GAPDH 0.561 18S 7.77
18S 0.402 18S 0.393 GAPDH 0.723 18S 0.731 GAPDH 8.24
UBC 0.543 UBC 0.667 UBC 1.849 UBC 1.463 UBC 10.00

NFD, normal-fat diet; HFD, high-fat diet; All, all four points (4 w, 8 w, 12 w, 16 w); SD, standard deviation. Gene names indicated in bold are the most appropriate selection of 4 reference genes for all comparisons.

In femoral muscle, as shown in Table 7, the more stable reference genes were RPLP0, HRPT, PPIA, and TBP at 4 weeks, HRPT, PPIA, YWHAZ, and GAPDH at 8 weeks, YWHAZ, TBP, PPIA, and HRPT at 12 weeks, and RPLP0, YWHAZ, B2M, and PPIA at 16 weeks. If all data from the four time points were analyzed, YWHAZ, RPLP0, and GAPDH were shown more stable in expression.

Table 7.

Analysis of reference gene expression variability in the femoral muscle during the development of obesity.

NormFinder GeNorm BestKeeper Delta-Ct Consensus
Genes Stability value Genes Stability value Genes SD Genes SD Genes Geometric mean of ranking values
4 w
NFD/HFD (n = 8/8)
PPIA 0.024 HPRT 0.196 RPLP0 0.253 RPLP0 0.328 RPLP0 2.11
HPRT 0.035 TBP 0.196 PPIA 0.304 HPRT 0.374 HPRT 2.21
TBP 0.045 YWHAZ 0.208 TBP 0.312 PPIA 0.379 PPIA 2.34
YWHAZ 0.056 RPLP0 0.216 18S 0.321 TBP 0.385 TBP 2.91
RPLP0 0.066 PPIA 0.238 GAPDH 0.333 YWHAZ 0.386 YWHAZ 4.53
B2M 0.087 ACTB 0.262 HPRT 0.343 ACTB 0.422 ACTB 6.70
ACTB 0.106 GAPDH 0.291 YWHAZ 0.344 B2M 0.432 18S 6.90
18S 0.114 B2M 0.315 ACTB 0.367 GAPDH 0.483 GAPDH 7.09
GAPDH 0.132 18S 0.334 B2M 0.379 18S 0.496 B2M 7.42
UBC 0.406 UBC 0.504 UBC 1.056 UBC 1.082 UBC 10.00
8 w
NFD/HFD (n = 8/8)
HPRT 0.127 HPRT 0.191 18S 0.499 PPIA 0.355 HPRT 2.43
TBP 0.135 GAPDH 0.191 B2M 0.565 RPLP0 0.368 PPIA 3.22
GAPDH 0.148 PPIA 0.230 YWHAZ 0.619 YWHAZ 0.394 YWHAZ 3.46
YWHAZ 0.159 YWHAZ 0.260 RPLP0 0.633 B2M 0.396 GAPDH 3.98
ACTB 0.166 TBP 0.280 HPRT 0.685 ACTB 0.405 RPLP0 4.28
PPIA 0.168 RPLP0 0.295 PPIA 0.693 GAPDH 0.406 B2M 4.60
RPLP0 0.213 B2M 0.308 GAPDH 0.715 HPRT 0.407 TBP 5.03
B2M 0.334 ACTB 0.320 TBP 0.728 TBP 0.444 18S 5.20
18S 0.464 18S 0.352 ACTB 0.824 18S 0.575 ACTB 6.51
UBC 1.027 UBC 0.525 UBC 1.449 UBC 1.034 UBC 10.00
12 w
NFD/HFD (n = 8/8)
TBP 0.085 YWHAZ 0.237 TBP 0.370 PPIA 0.332 YWHAZ 2.63
HPRT 0.119 18S 0.237 YWHAZ 0.376 RPLP0 0.402 TBP 2.71
PPIA 0.127 PPIA 0.255 HPRT 0.383 ACTB 0.406 PPIA 2.71
B2M 0.134 GAPDH 0.268 B2M 0.385 YWHAZ 0.408 HPRT 4.41
GAPDH 0.165 RPLP0 0.280 18S 0.404 B2M 0.415 18S 4.86
YWHAZ 0.182 ACTB 0.295 PPIA 0.423 TBP 0.430 B2M 5.03
18S 0.247 HPRT 0.320 ACTB 0.428 GAPDH 0.443 RPLP0 5.18
ACTB 0.292 B2M 0.335 RPLP0 0.460 18S 0.450 ACTB 5.63
RPLP0 0.333 TBP 0.386 GAPDH 0.472 HPRT 0.457 GAPDH 5.96
UBC 0.875 UBC 0.608 UBC 1.037 UBC 1.183 UBC 10.00
16 w
NFD/HFD (n = 8/8)
RPLP0 0.136 RPLP0 0.217 PPIA 0.273 RPLP0 0.339 RPLP0 1.68
B2M 0.176 YWHAZ 0.217 TBP 0.515 YWHAZ 0.414 YWHAZ 2.63
YWHAZ 0.179 B2M 0.255 18S 0.560 B2M 0.414 B2M 3.08
GAPDH 0.188 ACTB 0.273 YWHAZ 0.592 GAPDH 0.450 PPIA 4.56
ACTB 0.195 GAPDH 0.294 B2M 0.596 ACTB 0.469 GAPDH 4.68
PPIA 0.269 18S 0.331 GAPDH 0.614 HPRT 0.513 18S 5.45
18S 0.311 HPRT 0.366 UBC 0.626 18S 0.521 ACTB 5.62
TBP 0.318 TBP 0.396 RPLP0 0.634 PPIA 0.538 TBP 5.83
HPRT 0.349 PPIA 0.440 HPRT 0.654 TBP 0.543 HPRT 7.64
UBC 0.499 UBC 0.540 ACTB 0.738 UBC 0.811 UBC 9.15
All
NFD/HFD (n = 32/32)
GAPDH 0.062 HPRT 0.278 PPIA 0.431 RPLP0 0.403 YWHAZ 2.21
YWHAZ 0.090 TBP 0.278 YWHAZ 0.512 YWHAZ 0.460 RPLP0 2.63
TBP 0.108 YWHAZ 0.318 RPLP0 0.557 ACTB 0.462 GAPDH 3.64
RPLP0 0.117 RPLP0 0.331 18S 0.559 B2M 0.490 HPRT 3.66
HPRT 0.126 GAPDH 0.338 TBP 0.592 GAPDH 0.494 TBP 3.81
PPIA 0.136 ACTB 0.359 HPRT 0.594 HPRT 0.499 PPIA 4.56
B2M 0.144 B2M 0.387 GAPDH 0.615 TBP 0.502 ACTB 6.00
ACTB 0.150 18S 0.410 B2M 0.630 PPIA 0.506 B2M 6.29
18S 0.279 PPIA 0.433 ACTB 0.670 18S 0.593 18S 7.14
UBC 0.419 UBC 0.609 UBC 1.289 UBC 1.101 UBC 10.00

NFD, normal-fat diet; HFD, high-fat diet; All, all four points (4 w, 8 w, 12 w, 16 w); SD, standard deviation. Gene names indicated in bold are the most appropriate selection of 4 reference genes for all comparisons.

As shown in Tables 2–7, UBC was the least stable gene in expression in all six types of tissues during the development of obesity, followed by GAPDH, ACTB, and 18S, which have been commonly used in the adipose tissue and hepatic tissue.

Effect of High-Fat Diet on Reference Gene Expression

Furthermore, the candidate genes were examined by using the top two stable reference genes as internal standards, and similar results were shown that PPIA and RPLP0 in all four types of adipose tissue, HRPT, YWHAZ, and RPLP0 in the liver, and YWHAZ, RPLP0, and GAPDH in muscle were more stably expressed from 4 to 16 weeks. The more changeable expression was seen with UBC in all tissues, and ACTB and GAPDH in the four types of adipose tissue and the liver.

We found that HFD feeding increased the mRNA levels of ACTB in four types of adipose tissues at 4w, 8w, 12w, and 16w, and the differences became more significant with the development of obesity. The GAPDH mRNA levels were decreased in four types of adipose tissues and liver at 4w, 8w, 12w, and 16w after HFD feeding (Figure 3, Supplementary Tables 3–8). Significant changes were found in the TNFα (a positive control) expression with HFD feeding (Supplementary Figure 3).

Figure 3.

Figure 3

Changes in the mRNA expression of reference genes in tissues during the process of obesity. Three- to four-week-old C57BL/6J male mice were fed a high-fat diet (HFD), with a normal-fat diet (NFD) as a control. At 4, 8, 12, and 16 weeks after feeding, mice were sacrificed respectively, and organs and tissues were dissected. The mRNA expression of reference genes was examined by RT-qPCR. The relative expression of reference genes with the HFD feeding to the NFD feeding was determined with the top two candidate reference genes as the invariant internal control in each tissue, specifically normalized to RPLP0 (A) or PPIA (B) in the epididymal fat, RPLP0 (C) or PPIA (D) in the perirenal fat, PPIA (E) or TBP (F) in the subcutaneous inguinal fat, RPLP0 (G) or TBP (H) in the subscapular brown adipose tissue, HPRT (I) or YWHAZ (J) in the liver, and YWHAZ (K) or RPLP0 (L) in the femoral muscle. All data are presented as the means ± SD; n = 8 in either the HFD or the NFD group at each time points. *Significantly different from the NFD group (p < 0.05).

Discussion

In this study, a detailed analysis of candidate reference genes in the fat (epididymal, perirenal, subcutaneous inguinal, and brown adipose tissue), liver, and femoral muscle at different time points (4, 8, 12, and 16 weeks), demonstrated a set of more stable reference genes, which were more suitable for use in energy and fat metabolism associated tissues in the HFD induced-obese mice. Although the four methods, which were applied for analysis of gene stability, use different analytical approaches, the results were similar in all groups. The most stable reference genes were slightly different for a specific organ or tissue in a specific time point during the process of obesity pathogenesis. Further analysis with combined time points indicated that the genes PPIA, RPLP0, and YWHAZ were ranked top three among the 10 reference genes in the epididymal fat and the perirenal fat and that PPIA, TBP, and RPLP0 were ranked top three in the inguinal fat and brown adipose tissue. In the liver, the top three more stably expressed genes were HRPT, YWHAZ, and RPLP0, and in the femoral muscle, YWHAZ, RPLP0, and GAPDH were identified as the top three genes.

Reference genes have been demonstrated to be variable in obesity by several studies. Being consistent with our findings, RPLP0 has been validated as one of the top-ranking reference genes in human and rat adipose tissue (16, 23). TBP and ATPF1 should be used as reference genes in qPCR experiments on the adipose tissue with metabolic disease (7). In the DIO mouse model, the most stable candidates are 18S and PPIA in the epididymal fat and HPRT1 and PPIA in the heart, whereas they are 18S and GAPDH in the epididymal fat and RPI7 and GAPDH in the heart in wild-type and db/db mice (15). There have been quantities of studies on HFD-induced obesity, especially in those metabolism-related tissues, such as adipose tissues, liver, and muscle (24, 25). For example, Zhang et al. (23) found that four frequently used reference genes have different expression stabilities in three types of adipose tissue from the control and high-fat diet rats. Perez and his colleagues assessed the relative stability of the 10 candidate reference genes in perigonadal adipose tissue from chow and high-fat high-sucrose-fed C57BL/6 mice (15). Our results are consistent with a previous study by Zhang et al., who validated that RPLP0 was the best reference gene in three types of rat adipose tissue (23). In another study, Gabrilsson and colleagues evaluated reference genes in human adipose tissue. They found that of the frequently used reference genes, RPLP0 was highest ranked (16). In this study, different reference genes were validated for each time point in liver (B2M for 4 w, HPRT for 8 w, PPIA for 12 w, YWHAZ for 16 w) and femoral muscle (HPRT for 8 w, YWHAZ for 12 w, PPIA for 4w, and 16 w).

The genes ACTB, GAPDH, and 18S have been mostly employed as the sole reference genes for qPCR data normalization (26–31). However, our results showed that they were more unstable genes in the adipose and hepatic tissues. In consistent with our findings, it has been reported that ACTB is one of the most unstable genes in mouse models of obesity and diabetes and that the ACTB expression in the hypothalamus and intestine from an obese rat model is markedly altered with changes in energy status (32). Also, the expressions of B2M, GAPDH, and ACTB are varied with types of adipose tissue, metabolic status, and different experimental conditions in mice (7, 33). Regarding the expression of GAPDH and ACTB in human tissues, the controversy exists. Some studies reported that GAPDH and ACTB are reported to be among the most stably expressed in the human samples (12, 13). Mehta et al. validated ACTB as a stable reference gene most suitable for gene expression studies of human visceral adipose tissue (13), and GAPDH, together with CYCA and RPL27, has been identified as the most stable genes in human epicardial fat depots of lean, overweight, and obese subjects (17), whereas others demonstrated that SDHA and HSPCB are ranked as the most stable candidates in human in the subcutaneous fat (15), and GAPDH and ACTB showed a significant variation in human adipose (16) and are less appropriate reference genes in human omental and subcutaneous adipose tissue from obesity and type 2 diabetes patients, because of the variational expression (34). Thus, the stability of expression of reference genes differs between species and between healthy/disordered tissue within one specie.

It is noteworthy that reference proteins, also called housekeeping proteins, are key internal controls serving to normalize the western blot or immunoblot data. In studies on obesity and other diseases, GAPDH, β-actin, or β-tubulin has been used extensively as housekeeping protein in determination of target protein expression. However, it has been previously reported that common housekeeping proteins are not always reliable loading controls (35, 36). Although a direct correlation between the levels of mRNA and that of protein exists due to the expressed mRNA translated into protein (37), many studies have demonstrated discrepancies between mRNA and protein levels, indicating that mRNA levels are not sufficient to predict protein levels in many scenarios (38–40). Therefore, the results from reference genes cannot be extrapolated to reference proteins. With regard to the more stable reference genes screened in the current study, their translated proteins as reference controls have been investigated by few studies. Kim et al. reported that among the seven housekeeping proteins (HPRT1, PPIA, GYS1, TBP, YWHAZ, GAPDH, and ACTB) in the rat cerebrum, cerebellum, cardiac ventricle, and atrium, psoas major muscle, femoral muscle, liver, spleen, kidney, and aorta tissues, HPRT1, PPIA, YWHAZ, and GAPDH are more stably expressed across tissues (41). Nonetheless, whether the corresponding proteins translated from more stably expressed genes PPIA, RPLP0, and YWHAZ are appropriate for references in protein studies of obesity, needs to be clarified in the future.

In conclusion, although the most stable reference gene was different among specific organs/tissues with the development of obesity, PPIA, RPLP0, or YWHAZ should be used as reference gene in qPCR experiments on adipose, hepatic tissues, and muscles of mice in diet-induced obesity and associated metabolic complications.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.

Ethics Statement

The animal study was reviewed and approved by Committee on the Ethics of Institute of Laboratory Animal Sciences, National Institute of Occupational Health and Poison Control of China.

Author Contributions

XF participated in the study design, statistical analysis, and paper writing. HY carried out mouse feeding and the mRNA expression experiments. XL and QS participated in the mRNA expression experiments. LL, PL, RW, and TT participated in the statistical analysis. KQ conceived the study and participated in its design and coordination. The paper was written by XF and KQ. All authors reviewed and commented on the manuscript.

Conflict of Interest

LL was employed by the company Zeesan Biotech. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Footnotes

Funding. This work was supported by the National Natural Science Foundation of China (to XF, No. 81800750) and Research Funds of Profession Quota Budget from Beijing Municipal Science and Technology Commission (2019-bjsekyjs-lnd to KQ).

Supplementary Material

The Supplementary Material for this article can be found online at: https://www.frontiersin.org/articles/10.3389/fnut.2020.589771/full#supplementary-material

References

  • 1.NCD Risk Factor Collaboration (NCD-RisC) . Trends in adult body-mass index in 200 countries from 1975 to 2014: a pooled analysis of 1698 population-based measurement studies with 192 million participants. Lancet. (2016) 387:1377–96. 10.1016/S0140-6736(16)30054-X [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.World Health Organization Obesity and Overweight. (2020). Available online at: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed 15 April, 2020).
  • 3.Huggett J, Dheda K, Bustin S, Zumla A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. (2005) 6:279–84. 10.1038/sj.gene.6364190 [DOI] [PubMed] [Google Scholar]
  • 4.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. (2009) 55:611–22. 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]
  • 5.Taylor SC, Mrkusich EM. The state of RT-quantitative PCR: firsthand observations of implementation of minimum information for the publication of quantitative real-time PCR experiments (MIQE). J Mol Microbiol Biotechnol. (2014) 24:46–52. 10.1159/000356189 [DOI] [PubMed] [Google Scholar]
  • 6.Green MR, Sambrook J. Analysis and normalization of real-time polymerase chain reaction (PCR) experimental data. Cold Spring Harb Protoc. (2018) 2018:769–7. 10.1101/pdb.top095000 [DOI] [PubMed] [Google Scholar]
  • 7.Almeida-Oliveira F, Leandro JGB, Ausina P, Sola-Penna M, Majerowicz D. Reference genes for quantitative PCR in the adipose tissue of mice with metabolic disease. Biomed Pharmacother. (2017) 88:948–55. 10.1016/j.biopha.2017.01.091 [DOI] [PubMed] [Google Scholar]
  • 8.Fang S, Suh JM, Reilly SM, Yu E, Osborn O, Lackey D, et al. Intestinal FXR agonism promotes adipose tissue browning and reduces obesity and insulin resistance. Nat Med. (2015) 21:159–65. 10.1038/nm.3760 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Pospisilik JA, Schramek D, Schnidar H, Cronin SJ, Nehme NT, Zhang X, et al. Drosophila genome-wide obesity screen reveals hedgehog as a determinant of brown versus white adipose cell fate. Cell. (2010) 140:148–60. 10.1016/j.cell.2009.12.027 [DOI] [PubMed] [Google Scholar]
  • 10.Sun L, Trajkovski M. MiR-27 orchestrates the transcriptional regulation of brown adipogenesis. Metabolism. (2014) 63:272–82. 10.1016/j.metabol.2013.10.004 [DOI] [PubMed] [Google Scholar]
  • 11.Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. (2002) 3:RESEARCH0034. 10.1186/gb-2002-3-7-research0034 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.van Rijn SJ, Riemers FM, van den Heuvel D, Wolfswinkel J, Hofland L, Meij BP, et al. Expression stability of reference genes for quantitative RT-PCR of healthy and diseased pituitary tissue samples varies between humans, mice, and dogs. Mol Neurobiol. (2014) 49:893–9. 10.1007/s12035-013-8567-7 [DOI] [PubMed] [Google Scholar]
  • 13.Mehta R, Birerdinc A, Hossain N, Afendy A, Chandhoke V, Younossi Z, et al. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples. BMC Mol Biol. (2010) 11:39. 10.1186/1471-2199-11-39 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Taube M, Andersson-Assarsson JC, Lindberg K, Pereira MJ, Gäbel M, Svensson MK, et al. Evaluation of reference genes for gene expression studies in human brown adipose tissue. Adipocyte. (2015) 4:280–5. 10.1080/21623945.2015.1039884 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Perez LJ, Rios L, Trivedi P, D'Souza K, Cowie A, Nzirorera C, et al. Validation of optimal reference genes for quantitative real time PCR in muscle and adipose tissue for obesity and diabetes research. Sci Rep. (2017) 7:3612. 10.1038/s41598-017-03730-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gabrielsson BG, Olofsson LE, Sjögren A, Jernås M, Elander A, Lönn M, et al. Evaluation of reference genes for studies of gene expression in human adipose tissue. Obes Res. (2005) 13:649–52. 10.1038/oby.2005.72 [DOI] [PubMed] [Google Scholar]
  • 17.Chechi K, Gelinas Y, Mathieu P, Deshaies Y, Richard D. Validation of reference genes for the relative quantification of gene expression in human epicardial adipose tissue. PLoS ONE. (2012) 7:e32265. 10.1371/journal.pone.0032265 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. (2004) 64:5245–50. 10.1158/0008-5472.CAN-04-0496 [DOI] [PubMed] [Google Scholar]
  • 19.Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: bestKeeper–Excel-based tool using pair-wise correlations. Biotechnol Lett. (2004) 26:509–15. 10.1023/B:BILE.0000019559.84305.47 [DOI] [PubMed] [Google Scholar]
  • 20.Silver N, Best S, Jiang J, Thein SL. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol Biol. (2006) 7:33. 10.1186/1471-2199-7-33 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Herman MA, Peroni OD, Villoria J, Schön MR, Abumrad NA, Blüher M, et al. A novel ChREBP isoform in adipose tissue regulates systemic glucose metabolism. Nature. (2012) 484:333–8. 10.1038/nature10986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Fischer K, Ruiz HH, Jhun K, Finan B, Oberlin DJ, van der Heide V, et al. Alternatively activated macrophages do not synthesize catecholamines or contribute to adipose tissue adaptive thermogenesis. Nat Med. (2017) 23:623–30. 10.1038/nm.4316 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Zhang WX, Fan J, Ma J, Rao YS, Zhang L, Yan YE. Selection of suitable reference genes for quantitative real-time PCR normalization in three types of rat adipose tissue. Int J Mol Sci. (2016) 17:E968. 10.3390/ijms17060968 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Suárez-Zamorano N, Fabbiano S, Chevalier C, Stojanović O, Colin DJ, Stevanović A, et al. Microbiota depletion promotes browning of white adipose tissue and reduces obesity. Nat Med. (2015) 21:1497–501. 10.1038/nm.3994 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lee HH, An SM, Ye BJ, Lee JH, Yoo EJ, Jeong GW, et al. TonEBP/NFAT5 promotes obesity and insulin resistance by epigenetic suppression of white adipose tissue beiging. Nat Commun. (2019) 10:3536. 10.1038/s41467-019-11302-w [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Yoon YI, Chung MY, Hwang JS, Han MS, Goo TW, Yun EY. Allomyrina dichotoma (Arthropoda: Insecta) larvae confer resistance to obesity in mice fed a high-fat diet. Nutrients. (2015) 7:1978–91. 10.3390/nu7031978 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zhao M, Chen X. Eicosapentaenoic acid promotes thermogenic and fatty acid storage capacity in mouse subcutaneous adipocytes. Biochem Biophys Res Commun. (2014) 450:1446–51. 10.1016/j.bbrc.2014.07.010 [DOI] [PubMed] [Google Scholar]
  • 28.Berry DC, Jiang Y, Arpke RW, Close EL, Uchida A, Reading D, et al. Cellular aging contributes to failure of cold-induced beige adipocyte formation in old mice and humans. Cell Metab. (2017) 25:166–81. 10.1016/j.cmet.2016.10.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Shan B, Wang X, Wu Y, Xu C, Xia Z, Dai J, et al. The metabolic ER stress sensor IRE1α suppresses alternative activation of macrophages and impairs energy expenditure in obesity. Nat Immunol. (2017) 18:519–29. 10.1038/ni.3709 [DOI] [PubMed] [Google Scholar]
  • 30.Zhao P, Wong KI, Sun X, Reilly SM, Uhm M, Liao Z, et al. TBK1 at the crossroads of inflammation and energy homeostasis in adipose tissue. Cell. (2018) 172:731–43. 10.1016/j.cell.2018.01.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Brestoff JR, Kim BS, Saenz SA, Stine RR, Monticelli LA, Sonnenberg GF, et al. Group 2 innate lymphoid cells promote beiging of white adipose tissue and limit obesity. Nature. (2015) 519:242–6. 10.1038/nature14115 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Li B, Matter EK, Hoppert HT, Grayson BE, Seeley RJ, Sandoval DA. Identification of optimal reference genes for RT-qPCR in the rat hypothalamus and intestine for the study of obesity. Int J Obes. (2014) 38:192–7. 10.1038/ijo.2013.86 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol. (2000) 25:169–93. 10.1677/jme.0.0250169 [DOI] [PubMed] [Google Scholar]
  • 34.Catalán V, Gómez-Ambrosi J, Rotellar F, Silva C, Rodríguez A, Salvador J, et al. Validation of endogenous control genes in human adipose tissue: relevance to obesity and obesity-associated type 2 diabetes mellitus. Horm Metab Res. (2007) 39:495–500. 10.1055/s-2007-982502 [DOI] [PubMed] [Google Scholar]
  • 35.Araujo LCC, Bordin S, Carvalho CRO. Reference gene and protein expression levels in two different NAFLD mouse models. Gastroenterol Res Pract. (2020) 2020:1093235. 10.1155/2020/1093235 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Goasdoue K, Awabdy D, Bjorkman ST, Miller S. Standard loading controls are not reliable for Western blot quantification across brain development or in pathological conditions. Electrophoresis. (2016) 37:630–4. 10.1002/elps.201500385 [DOI] [PubMed] [Google Scholar]
  • 37.Li JJ, Biggin MD. Gene expression. Statistics requantitates the central dogma. Science. (2015) 347:1066–7. 10.1126/science.aaa8332 [DOI] [PubMed] [Google Scholar]
  • 38.Maier T, Güell M, Serrano L. Correlation of mRNA and protein in complex biological samples. FEBS Lett. (2009) 583:3966–73. 10.1016/j.febslet.2009.10.036 [DOI] [PubMed] [Google Scholar]
  • 39.Schwanhäusser B, Busse D, Li N, Dittmar G, Schuchhardt J, Wolf J, et al. Corrigendum: global quantification of mammalian gene expression control. Nature. (2013) 495:126–7. 10.1038/nature11848 [DOI] [PubMed] [Google Scholar]
  • 40.Vogel C, Marcotte EM. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat Rev Genet. (2012) 13:227–32. 10.1038/nrg3185 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kim HJ, Na JI, Min BW, Na JY, Lee KH, Lee JH, et al. Evaluation of protein expression in housekeeping genes across multiple tissues in rats. Korean J Pathol. (2014) 48:193–200. 10.4132/KoreanJPathol.2014.48.3.193 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author.


Articles from Frontiers in Nutrition are provided here courtesy of Frontiers Media SA

RESOURCES