Temporally Uncoupled Signal and Coding Joint Formation in Human V(D)J Recombination

Abstract

In vertebrate antigen receptor gene rearrangement, V(D)J recombination events can occur by deletion or by inversion. For deletional events, the signal joint is deleted from the genome. Nearly half of the immunoglobulin light chain genes undergo V(D)J recombination in an inversional manner, and both signal and coding joint formation must occur to retain chromosomal integrity. But given the undetermined amount of pre-B and pre-T cell death that occurs during V(D)J recombination, the efficiency with which both joints are completed is not known, nor is the relative efficiency (balance) of signal versus coding joint formation. Signal joint formation only requires Ku and XRCC4:DNA ligase 4 of the nonhomologous DNA end joining repair pathway. Coding joint formation requires these proteins as well, but in addition requires Artemis and DNA-dependent protein kinase to open the hairpin DNA coding ends, which the RAG complex generated; and further processing is required because the hairpin opening generates incompatible 3’ overhangs. Mutations in some of the end processing enzymes affect one, but only minimally the other joint. We have devised a precise cellular assay that does not have any cellular, enzymatic or biochemical selective bias to assess signal and coding joint formation independently, and it can detect intermediates for which one joint has formed but not the other. We find that intermediates with only one completed joint are more abundant than molecules with both joints completed. This indicates that either joint can form independent of the other and joint formation can be a relatively slow process.

1. INTRODUCTION

V(D)J recombination relies on the RAG complex binding to two recombination signal sequences (RSS), located adjacent to a coding segment, designated V, D, or J (Figure 1)(Lewis, 1994; Schatz and Swanson, 2011). Each RSS has a heptamer and a nonamer sequence flanking either a 12 or a 23 bp spacer. Each recombination event requires the pairing of one RSS with a 12 bp spacer (12RSS) and one with a 23 bp spacer (23RSS). The RAG complex nicks and then hairpins each coding end at the proximal edge of each adjacent heptamer (Chen et al., 2020). The resulting signal ends are blunt with a 5’P and 3’OH configuration, and these ends are joined by Ku and XRCC4:DNA ligase IV to form a signal joint (SJ). After hairpin opening by Artemis:DNA-PKcs, followed by further nucleolytic and polymerase end processing, the two coding ends will be joined together to form a coding joint (CJ) (Ma et al., 2002). If the two RSS sites are oriented in opposite directions on a DNA segment, a deletional event of the DNA between the coding ends will occur leading to the formation of a SJ-bearing circle, when the SJ is completed, while the CJ remains in the genome. If the two RSS sites are in the same orientation along the chromosome, then an inversion event will take place leading to both the SJ and CJ remaining on the same DNA segment or chromosome. It is clear that some coding ends fail to join at an unknown frequency because chromosomal translocations occur in pre-B and pre-T cells (Lieber, 2016).

Figure 1. The Enzymatic Steps in V(D)J Recombination.

The RAG complex (RAG1-RAG2 tetramer) initiates binding of a 12RSS/23RSS pair of substrates, nicking, and hairpin formation. The hairpin formation occurs concurrently to generate two coding ends and two signal ends. The coding ends are in a hairpin configuration, and Artemis:DNA-PKcs is required to nick the hairpins, which results in a 3’ overhang at each coding end, and these overhangs are usually not compatible for ligation until nuclease action and polymerases of the NHEJ pathway modify those two coding ends. In contrast, the signal ends are blunt and potentially directly ligatable, although TdT, is present in the cells, often adds nucleotides at either signal end prior to ligation.

All assay measurements of SJ or CJ have positive features as well as limitations. Our previously published unselected extrachromosomal human and mouse substrates (and their recombination products) are typically harvested in a manner that requires a covalently closed circular plasmid state (Gauss et al., 1998; Gauss and Lieber, 1993; Hesse et al., 1987; Lieber et al., 1987). This means that intermediate conformations of the substrate in the process of being converted to recombinant product are not typically recovered. For inversion substrates, key intermediates that only have one joint (either SJ or CJ) completed would not be recovered, and only recombinants with both joints completed are measured. For deletion substrates, only the joint retained (either SJ or CJ) on the plasmid is measured. A number of other assays have been developed that involve a fluorescent protein readout (e.g., GFP or a variant) (Bredemeyer et al., 2006; Neal et al., 2016; Niewolik et al., 2006). Such assays require a DNA recombination event and the expression of a protein as a consequence of the recombination. Both genome-integrated and extrachromosomal versions of such assays measure the read out on a whole cell basis. However, the number of substrates within each cell is usually more than one, and V(D)J recombination may only occur on a subset of the substrates. This means that there is a threshold across which a cell must cross to convert from non-fluorescent to fluorescent. Therefore, the measurement can be underestimating the number of cells with recombinants or overestimating the true frequency of the molecules that recombined. In addition, intermediates of recombination, if measured in these assays, require additional methods, such as Southern blot or ligation-mediated PCR, and these are not easily quantified.

Here, we have devised a droplet digital PCR (ddPCR) assay that can detect the SJ or CJ independent of one another on an inversion substrate. This allows determination of how similar these junctions are in their efficiency of formation within living cells. Further, our approach can detect SJ even if the CJ is incomplete, and vice versa. We find that SJ and CJ formation are temporally uncoupled such that one joint often remains incomplete when the other has formed. Despite their substantial temporal gap and distinct DNA enzyme requirements, the overall ratio of SJ/CJ is close to 1 in human pre-B cells. The biological implications of two such different reactions achieving similar efficiencies are considered.

2. MATERIALS AND METHODS

2.1. Cells, Transfection, and Cell Harvest. Human 697 cell line, a pre-B cell line established from human ALL patient in relapse, was used for transfection (Figure 2) (Esguerra et al., 2020).

Figure 2. Experimental Scheme.

The human pre-B cell line was from a relapsed acute lymphoblastic leukemia patient. After transfection of pGG49 [deletion substrate retaining the signal joint (SJ)] or pGG52 [the inversion substrate] into the 697 cells and incubation for 24 or 48 hours, the samples were processed in the manner diagrammed.

The cell line is maintained in RPMI1640, 10% fetal calf serum with penicillin and streptomycin. For each transfection, 3 × 10⁶ cells in log phase growth were transfected in 400 ul of serum free medium containing freshly prepared DEAE-dextran at a final concentration of 10 μg/ml with 0.8 μg of substrate DNA using an electroporator at 0.25 kV (Bio-Rad) (Gauss and Lieber, 1992a). The transfected cells were recovered and 4.2 ml of complete medium was added to each transfection, followed by incubation at 37°C for up to 48 hours. The transfected cells were harvested 48 hours after transfection for recombination analysis unless otherwise indicated. From each transfection, 1.3% of the cells was centrifuged, resuspended in 40 ul phosphate buffered saline (PBS), and frozen for the ddPCR assay. The remaining 98.7% of the transfected cells was harvested using the rapid alkaline preparation (RAP) method for a bacterial transformation ‘plating’ assay, as described below in brief and in detail previously (Gauss and Lieber, 1993; Hesse et al., 1987).

Where indicated, 60% of the transfected cells were sorted by fluorescence-activated cell sorting (FACS) to eliminate the dead cells at 24 hours after transfection, and the cells were harvested at 48 hr for ddPCR and plating assays (Esguerra et al., 2020). In experiments as indicated, 1.3% of the cells and nuclei from 30% of the cells were harvested and frozen for the ddPCR assay (see below), and the remaining 68.7% of the cells were harvested for the plating assay at 48 hours after transfection.

2.2. Plasmids. pGG49 and pGG52 are V(D)J recombination substrates as described previously and illustrated in Figure 3A (Gauss et al., 1998; Gauss and Lieber, 1993, 1996).

Figure 3. ddPCR Assay for Signal and Coding Joint Formation for the V(D)J Recombination Substrates pGG49 (SJ) and the pGG52 (inversion substrate retaining both SJ and CJ).

A. The substrates and products of V(D)J recombination are shown.

B. The locations of primers and probes for the ddPCR assay are shown on the left side of panel B, and whether a ddPCR product will be generated is diagrammed on the right side of panel B. The method for calculating the recombination frequency is also shown.

The signal joint deletion substrate, pGG49, deletes the prokaryotic transcription stop signal that is placed between a 12- and a 23-spacer signal sequences upon recombination in human cells. The pGG52 plasmid is an inversion substrate that forms a signal joint and a coding joint with an inversion of the prokaryotic transcription stop signal upon recombination in human cells. The recombinants from both substrates confer chloramphenicol resistance in addition to the ampicillin resistance of the substrates when transformed into E. coli.

2.3. Cellular Transfection of Human Pre-B Cells, Prokaryotic Transformation (Plating Assay), and Recombinant Sequencing.

Measurement of V(D)J recombination by cellular transfection followed by a transformation (plating) assay uses extrachromosomal DNA transfected into a human pre-B cell line (Gauss and Lieber, 1992b, 1993). The plasmids designed for this assay confer ampicillin (Amp) resistance upon transformation in bacteria. Upon completion of V(D)J recombination, an additional resistance to chloramphenicol (Cam) is generated. Recombination frequency is determined by taking the ratio of the AmpCam (AC) colonies versus Amp (A) colonies.

Plasmid DNA from 24 recombinants of experiments using pGG52 detected in the plating assay was extracted from overnight culture of single colonies for recombinant sequencing. Sanger sequencing was carried out using the primer named ddP-coding For (Table 1).

Table 1.

Probe and primer sequences for ddPCR assays.

common target (backbone)
	name	sequence (5’ –> 3’)
probe	ddP-backHEX	CTGTATTCCTAGCAGATCTGGCGCCG
primer 1	ddP-backFor	GGGACCTCTTCGTTGTGTAGGT
primer 2	ddP-backRev	CCAGCAACGCGGCCCGA
signal joint target
	name	sequence (5’ –> 3’)
probe	ddP-signalFAM	TGTGCACAGTGGTAGTACTCCACT
primer 1	ddp-signalFor	CGACTGCAGGGTTTTTGTTC
primer 2	ddp-signalRev	AGGGTTTTTGTACAGCCAGA
coding joint target
	name	sequence (5’ –> 3’)
probe	ddP-codingFAM	GCGCCAATCGAGCCATGTCG
primer 1	ddP-codingFor	TCGATGAATTCCCCTGTTGA
primer 2	ddP-coding Rev	GGTGAGAATCGCAGCAACT

2.4. Droplet Digital PCR (ddPCR) V(D)J Recombination Cellular Assay.

One ddPCR assay was designed to detect a common target on the backbone of both the substrates and the recombinants (Table 1 and 2B). Two other ddPCR assays were designed to detect the occurrence of the signal joint and the coding joint on the recombinants (Table 1 and 3B). The assay probe for the signal joint is an exact match to the precise signal joint sequence, and it will only detect recombinants with a precise signal joint. The coding joint assay will only generate a PCR product from the recombinants with a completed coding joint, regardless of any loss or gain of nucleotides at the junction, and the orientation of the primers eliminates any potential background PCR from unrecombined substrates. The cells harvested from the transfection experiments were frozen in PBS and used directly after diluting with water to a predetermined concentration for the final ddPCR reactions. Ideally, 20,000 droplets are generated for each ddPCR reaction, and the target DNA concentration is determined using Poisson statistics to analyze the fraction of the positive droplets in the PCR reaction. To optimize the template concentration to be in a range that would result in sufficient numbers of positive and negative droplets for a reliable calculation, all samples were first run at different concentrations to determine the adequate dilution of each harvest needed for the analysis.

Table 2.

Average recombination frequency and fold difference between different substrates and assays.

Substrate	ddPCR	Plating assay	Fold difference
			plating/ddPCR	ddPCR/plating
pGG49	0.097	0.254	2.62	0.38
pGG52	0.038	0.015	0.39	2.53
Fold difference of pGG49/pGG52	2.55	16.93

At least eight independent ddPCR reactions were done for the harvest from each transfection experiment (four experiments for pGG49 and six experiments for pGG52). The common target in the backbone of the plasmid substrate was detected using a HEX labeled TaqMan probe, and the signal joint and the coding joint targets were detected using FAM labeled TaqMan probes. The ddPCR reaction has a final concentration of 250 nM probe, 900 nM of each primers, 1x ddPCR Supermix for Probes without dUTP (Bio-Rad Laboratories, Inc., Hercules, CA), and the template. Each reaction mixture was partitioned into up to 20,000 droplets in a Bio-Rad QX200 Droplet Generator and amplified in a Bio-Rad C1000 Touch Thermal Cycler with the following cycling condition: 95°C for 10 minutes, followed by 39 cycles of 95°C for 30 seconds and 57°C for 60 seconds, and a final single 10 minutes cycle at 95°C, with 2°C per second ramping for all the steps. After the amplification, the droplets were read and analyzed in a Bio-Rad QX200 Droplet Reader. For experiments with plasmid pGG49, ddPCR reactions with multiplexing of the common target (HEX) and the signal joint target (FAM) were carried out. In these experiments, both unrecombined plasmid and recombined plasmid will give rise to positive HEX signal for the common backbone target, while only the recombined plasmid with the precise signal joint will be detected as being FAM positive. In experiments with inversion substrate pGG52, two separate ddPCR reactions were done for each sample: multiplexing of the common target (HEX) and the signal joint target (FAM) in one reaction; and multiplexing of the common target (HEX) and the coding joint target (FAM) in a second reaction. The recombination frequency was determined by dividing the sum of calculated signal joint or coding joint target concentration by the sum of calculated common target concentration from all of the ddPCR reactions for the same sample.

3. RESULTS

3.1. Experimental Scheme.

Four human pre-B cell transfection experiments were carried out using plasmid pGG49, a deletion signal joint recombination substrate, that forms a signal joint upon V(D)J recombination, deleting the DNA located between the 12RSS and 23RSS (Figure 3A). For the plating assay, plasmid DNA harvested by RAP, which only recovers DNA in closed circular configuration from the transfected pre-B cells, was used for the genetic transformation (plating assay) in E. coli. Therefore, plasmid DNA that has been nicked by the RAG complex or other enzymes in the pre-B cells will not be recovered. Also, plasmids that have suffered a double-strand break (DSB), such as those with incomplete joint formation from V(D)J recombination, will not be recovered in the harvest. Completed recombination products with any loss or gain of nucleotides in the junction of the signal joint will give rise to a colony on both the single- and double-drug selection plates, just like the products with precise signal joints.

Whole cells or nuclei are used for ddPCR assay, which will amplify DNA, including fragments that harbor the amplicon sequences that are being targeted. The signal joint of the recombinants is known to be precisely preserved (no resection) with only rare nucleotide loss at the recombination junction (Gauss and Lieber, 1993; Kulesza and Lieber, 1998). Nucleotide addition, which depends on the level of terminal deoxynucleotidyl transferase (TdT), is the more common cause for an imprecise signal joint (Lieber et al., 1988). A TaqMan probe was used that matches the precise signal joint sequence; therefore, the signal joint ddPCR assay would not allow the amplification of an imprecise signal joint on a recombined substrate. (While a negative ddPCR assay detecting the loss of DNA between the two signal sequences that can allow the detection of imprecise signal joints can be used, it is not as reliable as the positive assay detecting the precise signal joint formation in our testing.)

A separate ddPCR assay is designed to detect all coding joint formation, independent of signal joint formation. For the inversion substrate, the plating assay will only detect molecules completing both SJ and SJ, in contrast to ddPCR which can detect each joint independently. The potential V(D)J recombination events, including completed products and intermediates that can occur in the recombination zone are illustrated in Figure 4A and Figure 5A. The expected results for both the plating assay and the ddPCR assay as well as the configurations of the plasmid substrate included in the recombination frequency calculation are also illustrated in Figure 4A and Figure 5A.

Figure 4. Comparison of ddPCR and the Plating Assay for V(D)J Recombination for the Signal Joint Deletion Substrate pGG49.

A. The detectability of the possible substrates, partial products, and final products by ddPCR and by the plating assay are shown.

B. The calculated recombination frequencies are shown for the four independent transfection experiments.

Figure 5. Comparison of ddPCR and the Plating Assay for V(D)J Recombination for the Inversion Substrate pGG52.

A. The detectability of the possible substrates, partial products, and final products by ddPCR and by the plating assay are shown.

B. The calculated recombination frequencies are shown for the SJ for the six independent transfection experiments.

C. The calculated recombination frequencies are shown for the CJ for the six independent transfection experiments.

3.2. ddPCR Assay Detects Recombination Signal Joint Formation on a Signal Joint Deletion Substrate, pGG49, in Human Pre-B Cells.

In two transfection experiments, 40% of the transfected pre-B cells were cultured for 48 hours before harvest and 60% of the live transfected pre-B cells were sorted by FACS 24 hours after transfection and cultured for another 24 hours before harvest. The recombination frequencies of 0.162% and 0.159% were detected by the plating assay in the cells without FACS sorting (Figure 4B, experiments A1 and A2). The recombination frequencies of 0.32% and 0.265%, were detected by the plating assay in the same transfected cells but sorted by FACS at 24 hours after transfection (Figure 4B, experiments A1 and A2). In these same experiments (A1 and A2), recombination frequencies of 0.032% and 0.058% in the transfected cells without sorting by FACS, respectively, were detected by the ddPCR assay (Figure 4B). The recombination frequencies of 0.200% and 0.133% were detected by the ddPCR assay in experiment A1 and A2, respectively, with sorting by FACS (Figure 4B). The differences of recombination frequency from different transfection experiments are due to transfection efficiency and the differences in V(D)J recombination activity in individual cells. The finding that higher recombination frequencies were observed in cells with sorting by FACS at 24 hours after transfection would suggest that sorting by FACS eliminates cells harboring the substrate but that do not carry out V(D)J recombination, likely due to failure of cell survival.

Differences in recombination frequency are also observed between the plating and the ddPCR assay. In the plating assay, recombinants with imprecise signal joints can give rise to a double drug resistant bacterial colony, just as recombinants with precise signal joints (Fig. 4A). Unlike the plating assay, in the ddPCR assay, only the recombinants with precise signal joints will give rise to a FAM positive signal, and all DNA with the backbone target sequence for the assay will give rise to a positive HEX signal in a droplet, regardless of whether any breaks exist on the molecule (Fig. 4A). The recombination frequency calculation for the ddPCR assay would have a larger denominator, but most likely a smaller numerator than that in the plating assay for the same sample (Fig. 4A). Therefore, the consistently lower recombination frequency calculated in the ddPCR assay than the plating assay is expected.

Plasmid DNA was harvested in two other transfection experiments without sorting by FACS. In these experiments, at 48 hours after transfection, an aliquot of 1.3% of the cells without further processing and nuclei from an aliquot of 30% of the cells were harvested for the ddPCR assay. The remaining 68.7% of the cells were harvested by RAP for the plating assay. Recombination frequencies of 0.275% and 0.419% were detected in the plating assay (Fig. 4B, experiments B1 and B2). Recombination frequencies of 0.077% and 0.220% were observed using the whole cells, and recombination frequencies of 0.405% and 0.497% were detected using the nuclei in the ddPCR assay, respectively (Fig. 4B, experiments B1 and B2). ddPCR showed lower recombination frequencies in whole cells than in the plating assays of the same experiments as observed in experiments A1 and A2. However, ddPCR using nuclei detected comparable recombination frequencies to the plating assay of the same experiments. This finding would suggest that a substantial fraction of the plasmid DNA remained outside of the nucleus.

3.3. ddPCR Detects Signal Joint Recombination of an Inversion Substrate and Suggests the Presence of Recombination Intermediates at High Frequency.

In six transfection experiments, pGG52, the inversion recombination substrate, that forms a signal joint and a coding joint upon inversional V(D)J recombination was used (Fig. 3A and Fig. 5A). The same signal joint and the backbone multiplex ddPCR assays were used to detect the precise signal joint formation on pGG52 as experiments with pGG49. A coding joint detection assay that is paired with the backbone assay in the multiplex ddPCR was designed to detect coding joint formation on pGG52. The coding joints have been known to acquire nucleotide additions or losses at the junction frequently. The coding joint ddPCR assay allows the amplification of plasmid DNA that harbors a coding joint having nucleotide changes in the recombination junction (Fig. 3B).

In four transfection experiments using pGG52 as a substrate, recombination frequencies of 0.016%, 0.010%, 0.006%, and 0.018% were detected with the plating assay (Fig. 5B, experiments C1, C2, C3, and C4). The plating assay detects recombination events that completed both signal joint and coding joint, but it cannot detect recombination events in which only one of the two joints is completed. Two sets of ddPCR assay were carried out for each experiment: one detects the signal joint and the backbone target, and the other detects the coding joint and the backbone target. Signal joint recombination frequencies of 0.066%, 0.023%, 0.088%, and 0.013%, were observed, respectively (Fig. 5B, experiments C1, C2, C3, and C4).

In two other transfection experiments, aliquots of whole pre-B cells and nuclei were harvested for the ddPCR assay. The remaining pre-B cells were harvested by RAP for the plating assay at 48 hours after pGG52 was transfected into the pre-B cells. Recombination frequencies of 0.022% and 0.019% were detected by the plating assay (Fig. 5B, experiments D1 and D2). Recombination frequencies of 0.012% and 0.025% were detected using whole cells, and recombination frequencies of 0.040% and 0.044% were observed in the ddPCR using nuclei for the signal joint ddPCR assay (Fig. 5B, experiments D1 and D2). Higher recombination frequencies for the signal joint were detected in the nuclei than using whole pre-B cells. This difference between nuclei versus whole cells is consistent with the observation in the corresponding experiments of pGG49.

Contrary to detecting a higher signal joint recombination in the plating assay than in the ddPCR assay with pGG49 described above, the signal joint recombination is higher in the ddPCR assay than plating assay in four of the six experiments using pGG52. The average signal joint recombination frequency of pGG49 is about 2.6-fold higher in the plating assay (0.254%) than in the ddPCR signal joint assay (0.097%)(Fig. 4B, experiments with unsorted whole cells; Table 2). The average signal joint recombination frequency of pGG52 is more than 2.5-fold lower in the plating assay (0.015%) than in the ddPCR signal joint assay (0.038%) (Fig. 5B, experiments with whole cells; Table 2). The major difference between what can be detected by the ddPCR assay between pGG49 and pGG52 is that the ddPCR signal joint assay can detect a recombination intermediate that has a precise signal joint formation and an unfinished coding joint, which is absent from pGG49 experiments (Fig. 5A, recombination zone configurations 4a and 4b). The finding of the reverse trend of pGG52 signal joint recombination frequency detected by the two methods strongly suggests that recombination intermediates harboring a precise signal joint without completion of the coding joint are likely present at a relatively high frequency compared with the completed recombination products on pGG52 in human cells. pGG49 does not require a second joint formation and would not have an intermediate with a DSB during the V(D)J recombination process after the signal joint is formed in the pre-B cells. The high frequency of recombination intermediates likely contributes to the much lower recombination frequency of pGG52 than that of pGG49 in the plating assay, since any intermediates harboring nicks or DSB will not be harvested by the RAP, which only recovers closed circular molecules.

The average recombination frequency of the four pGG49 experiments (unsorted cells, 0.254%) is nearly 17-fold higher than that of the six experiments using pGG52 as substrate detected by the plating assay (0.015%) (Fig. 4B and Fig. 5B; Table 2). The same comparison only showed a 2.5-fold higher average signal joint recombination frequency for pGG49 than for pGG52 by the ddPCR assay (0.097% and 0.038%) (Fig. 4B and Fig. 5B; Table 2) suggesting that signal joint formation may occur at a lower frequency on pGG52 than pGG49. A lower recombination frequency was consistently observed on the inversion substrate than the signal deletion substrate as reported previously (Gauss and Lieber, 1993). One explanation that has been proposed previously is that inversions may be less frequent than deletions because inversions require two joints, whereas readout from deletion substrates only requires one joint to form. However, the clear contrast between the plating assay (17-fold difference) and ddPCR (2.5-fold difference) suggests reasons beyond this to account for the large difference between inversion and deletion substrates in the plating assay.

3.4. ddPCR Detects Coding Joint Recombination on pGG52 in Human Pre-B Cells and Suggests a Similar Joint Formation Frequency for Signal and Coding Joints.

The plating assay requires the formation of both signal and coding joints, other than the much less common hybrid joint formation, for the recombination event to be detected. ddPCR can detect both signal and coding joints and can detect some of the recombination intermediates in transfection experiments using an inversion substrate (Fig. 5A). Coding joint recombination frequencies of 0.218%, 0.030%, 0.174%, and 0.061%, respectively, were observed by ddPCR in the same four experiments described above for the signal joint assay (Fig. 5C, experiments C1, C2, C3, and C4). In the other two experiments, recombination frequencies of 0.039% and 0.138% were observed using whole cells, and recombination frequencies of 0.107% and 0.202% were found using nuclei, respectively, in the ddPCR assay (Fig. 5C, experiments D1 and D2). The coding joint recombination frequencies are consistently higher than the signal joint recombination frequencies in all six experiments and regardless whether whole cells or nuclei was used in ddPCR assay. The average recombination frequency of coding joint (0.110%) is nearly 3-fold higher than that of signal joint (0.038%) in the ddPCR assay (Fig. 5B and Fig. 5C). The coding joint ddPCR assay can detect the completed recombination products, regardless of whether the signal joint is precise while the signal joint ddPCR assay cannot (Fig. 5A, recombination zone configurations 8a, and 8b).

3.5. Sequencing of Recombinants from the Plating Assay Indicate TdT Activity in the Human Pre-B Line.

Nineteen unique sequences were observed in the recombination zone of 24 independent colonies from two transfection experiments sequenced using the Sanger sequencing method (Fig. 6). It is most likely that the 5 duplicate sequences arose from replication after E. coli transformation instead of being independent recombination events or replication of the same recombinant product in the human cells. Of the 19 unique recombination events, precise and imprecise signal joints are of similar frequency. Four have only coding joint information due to deletion of the signals. Two events are hybrid joints.

Figure 6. Junctional Sequences for Inversion Substrate Products.

The dashes indicate local nucleotide (nt) resection. The nt additions are primarily due to TdT. But the junctional additions that are shown as both bolded and underlined are P nts, and these occur only at full-length coding ends and arise after the hairpin opening step.

The imprecision at the signal joint is entirely due to nucleotide addition, as none of the signal joints demonstrated nucleotide loss. The nucleotide additions are all consistent with TdT activity, as has been described previously (Gauss and Lieber, 1993; Lieber et al., 1988). The coding joints demonstrate typical extents of local nucleotide resection as well as nucleotide addition. The nucleotide addition is consistent with TdT activity, except for one junction that had a 3-nucleotide inverted repeat at a full-length coding end. Such events are called P-nucleotide additions and are due to retention of nucleotides from hairpin opening (underlined nucleotides in line 5) (Lu et al., 2007). One other junction had TdT additions, but the first two nucleotides were consistent with being P nucleotides (underlined nucleotides in line 12) (Gauss and Lieber, 1996). One of the two hybrid joints also had TdT addition at the coding end. All of these features are consistent with normal V(D)J recombination.

4. DISCUSSION

In V(D)J recombination, the 12RSS and 23RSS double-strand breaks are generated essentially simultaneously by the RAG complex, but the timing of the Artemis hairpin opening of the coding ends and the NHEJ processing of the signal and coding ends to form SJ and CJ remains unknown (Schatz and Swanson, 2011). One disadvantage to date in using inversional V(D)J substrates is that the SJ and CJ formation could not be quantitatively measured independent of one another. The V(D)J ddPCR assay described here provides a remedy for this disadvantage and permits new insights. In the current study, we carried out four experiments with pGG49, a deletion signal joint substrate, and six experiments with pGG52, an inversion substrate, in 697 cells, a human pre-B cell line. The recombination frequency in each of these experiments was determined using the well-established plating assay and this novel ddPCR assay. ddPCR can detect signal joint formation on pGG49, as well as both signal and coding joints independent of one another on pGG52. The ddPCR results suggest high frequencies of recombination intermediates harboring only one recombination joint without the formation of the other on pGG52; that is, most inversion reaction products are incomplete and have formed either the SJ or the CJ, but not both at 48 hours after transfection. The ddPCR results also suggest that the limited level of coding joints and signal joints formed is roughly similar. Overall, ddPCR is more precise than the plating assay, and the capability of detecting both signal and coding joints on a single substrate in the same transfection experiment by ddPCR can provide more insight into the mechanism and process than the plating assay, which can only detect recombinants for which both joints are completed and can not detect events where only one of the two inversion junctions is completed.

Previously, the plating assay showed a higher recombination frequency for deletional signal joint forming substrates, such as pGG49, than the inversion substrate, such as pGG52. Finding of a 17-fold higher average recombination frequency on pGG49 than pGG52 using the plating assay in the current study is consistent with a previous study finding a 12- to 26.8-fold difference in recombination frequency between these two substrates in various human pre-B cell lines. This difference between the two-joint formation and a single-joint formation has been hypothesized to be due to the enzymatic challenge in completing two joints versus one joint. The average signal joint formation frequency is only ~2.5-fold higher on pGG49 than on pGG52 using the ddPCR assay, in contrast to the 17-fold difference detected by the plating assay. This would support the hypothesis that the large difference between the recombination frequency of pGG49 and pGG52 observed in the plating assay is mostly due to the inability of the assay to detect SJ formation without completion of the CJ.

The capability of analyzing SJ and CJ independently by ddPCR allows the comparison of the efficiency of their formation on the same substrate in the same cells. The average completion efficiency of the CJ (0.11%) is almost 3-fold higher than that of SJ (0.038%) detected by ddPCR. Sequences of 17 unique recombinants (excluding the two recombinants with hybrid joints) from the plating assay reveals that 11 of the 17 molecules cannot be detected by the signal joint ddPCR assay design here, because the probe can only detect precise SJ, and does not detect SJ that have junctional addition or loss. While the number of recombinants sequenced is small, it suggests that the signal joint formation efficiency can be potentially 2.83-fold (17/6) higher than the 0.038% detected by ddPCR. When considering the detection capability of the ddPCR assay for SJ and CJ, the SJ and CJ formation ratio of the two joints would be nearly one. This finding strongly suggests that SJ and CJ form at similar efficiencies despite the extremely different DNA end configurations involved (blunt versus hairpinned ends) and the different enzymes required for SJ versus CJ formation.

For the SJ to form efficiently, the RAG complex needs to be removed from the RSS sites. It is known that the RAG complex binds tightly to the RSS sites (Jones and Gellert, 2001; Ramsden and Gellert, 1995). Mechanisms for degrading the RAG complex have been identified (Jiang et al., 2005; Lin and Desiderio, 1993; Lin and Desiderio, 1994). This may contribute to removal of the RAG complex from the RSS sites and may be important for ligation by Ku and XRCC:DNA ligase IV to permit SJ formation. For the CJ to form efficiently, the coding end hairpins must be nicked by Artemis:DNA-PKcs (Ma et al., 2002). The hairpin opening leaves the coding ends with 3’ overhangs that are typically 2 to 6 nucleotides in length. Microhomology between these two 3’ overhangs may be present initially, or generated by the action of polymerases (Pol X polymerases, which include polymerase mu, polymerase lambda or terminal deoxynucleotidyl transferase). Alternatively, local resection by Artemis:DNA-PKcs can also expose terminal microhomology. These steps must precede the action of Ku plus XRCC4:DNA ligase IV (Pannunzio et al., 2018). It is noteworthy that the overall efficiency of SJ and CJ appear to be similar, given that the DNA end and enzymatic differences involved could have made this difficult to achieve.

The recombination frequency detected by the plating assay is 2.6-fold higher than by the ddPCR signal assay in the pGG49 experiments. This difference is consistent with what the sequencing data reveals from the pGG52 experiments as discussed above and further supports the inference of similar efficiency in SJ and CJ formation. This finding also indicates that the recombination frequency detected by the plating assay and the ddPCR assay are consistent and comparable. Based on this indication, the assumption can be made that the recombination frequency of molecules with both SJ and CJ completed would also be 0.015% in the ddPCR assay (which is the same as the frequency in the plating assay, which requires the completion of both joints). Therefore, the recombination frequency of molecules which have either SJ or CJ (not both joints) completed in the pGG52 experiments would be about 0.095%, which is determined by taking the 0.11% CJ frequency minus 0.015% [or 0.092% derived from (the SJ frequency of 0.038% x 2.83) minus 0.015%]. This extrapolation suggests that the vast majority of the molecules undergoing recombination (as high as 92% of the recombination reactions initiated by the RAG complex) only have a single joint completed at the 48 hour time point after transfection. Although these assays are not directly detecting the rate of V(D)J recombination but only the frequency at time points, the findings in the current study indicate that V(D)J recombination can be sufficiently slow to permit detection a high proportion at which only one joint is completed rather than both.

In this study, we have devised a ddPCR assay that can detect SJ and CJ on the same substrate independent of one another. This allows quantitation of the efficiency of SJ and CJ formation independently on the same substrate, and this was not possible previously using the plating assay or other assays described in the literature. The mechanisms that affect SJ and CJ formation can be further studied using the ddPCR assay in future experiments. Also, the ddPCR assay can be used to analyze factors that may affect SJ and CJ differently when such information is crucial for development of drugs that rely on inhibiting one relative to the other.

Highlights.

• The cellular efficiency of signal relative to coding end joining in V(D)J recombination is not known.

• ddPCR permits independent analysis of signal (SJ) and coding joints (CJ) on inversion substrates.

• SJ and CJ formation are temporally uncoupled such that one joint can often remain incomplete when the other has formed.

• Despite their temporal gap, the overall ratio of SJ/CJ is close to 1 in a human pre-B cell line.

Abbreviations.

SJ,

Signal joint

CJ

coding joint

DNA-PKcs

DNA-dependent protein kinase catalytic subunit